ID: 960981828

View in Genome Browser
Species Human (GRCh38)
Location 3:123236037-123236059
Sequence CTAGAGGAATGGAGGGAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 406
Summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 365}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960981820_960981828 28 Left 960981820 3:123235986-123236008 CCAGAATAGGCAAATCCAGAGAG 0: 13
1: 280
2: 1068
3: 1835
4: 2376
Right 960981828 3:123236037-123236059 CTAGAGGAATGGAGGGAAATAGG 0: 1
1: 0
2: 2
3: 38
4: 365
960981822_960981828 13 Left 960981822 3:123236001-123236023 CCAGAGAGACAGGAAGTAGATTA 0: 1
1: 13
2: 182
3: 674
4: 1282
Right 960981828 3:123236037-123236059 CTAGAGGAATGGAGGGAAATAGG 0: 1
1: 0
2: 2
3: 38
4: 365

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960981828 Original CRISPR CTAGAGGAATGGAGGGAAAT AGG Intronic
901102643 1:6731010-6731032 CTCGGGGAAGGGAGAGAAATCGG - Intergenic
903010696 1:20328049-20328071 GCAGAGGAAAGGAGGGAAAGGGG + Intronic
905776382 1:40669985-40670007 CAAGAGGGATGGAGAGAAGTGGG - Intergenic
905893318 1:41530431-41530453 CCAGGGGCATGGAGGGACATGGG - Intronic
906714110 1:47954315-47954337 CCAGGGAAAGGGAGGGAAATGGG - Intronic
906832120 1:49044189-49044211 CAAGAGGAAGAGAGGGAAGTAGG + Intronic
907069881 1:51524780-51524802 AGAGAGGAAAGGAAGGAAATAGG - Intergenic
907840148 1:58149084-58149106 ATAGTGGAATGGAGAGAAAGGGG - Intronic
909574858 1:77162445-77162467 TTGGGAGAATGGAGGGAAATTGG + Intronic
910474840 1:87595682-87595704 GGAGAGGAGGGGAGGGAAATAGG - Intergenic
910998159 1:93131526-93131548 GTAAAGGAAAGGAGGAAAATAGG + Intronic
912228793 1:107768028-107768050 GTGGAGGAATGGAGGAAAGTAGG + Intronic
913019540 1:114774786-114774808 CTAGAGAAATGGAAGGAAAGGGG + Intronic
913060290 1:115198177-115198199 CTAGAGGTATGAAGATAAATAGG - Intergenic
914827832 1:151147818-151147840 CTAGAGGAAAGGAGGGGGAAGGG + Intergenic
914894348 1:151655220-151655242 CTTTAGGAATGGAGCTAAATTGG - Intronic
915243776 1:154542191-154542213 CTAGAGGAAGAAAGGGAAAAGGG - Intronic
915929865 1:160053697-160053719 CTAGAGGATGGGAGGGAAAGGGG - Intronic
918113419 1:181477590-181477612 AAAGAGGAATGGAGGAAAAAAGG - Intronic
919581612 1:199382825-199382847 CTAGAGCAATGGAAGTATATTGG + Intergenic
919927852 1:202201740-202201762 CTGGTGGATGGGAGGGAAATGGG - Intronic
920358797 1:205397314-205397336 ATAGAGGATTAGAGGAAAATTGG - Intronic
921078726 1:211721694-211721716 CTAGCCCAATGGAGGGATATAGG - Intergenic
922089129 1:222378803-222378825 CTAGAGGAATGACTGGAAAGTGG - Intergenic
923062760 1:230490921-230490943 CTTGACAATTGGAGGGAAATGGG - Intergenic
924150603 1:241125380-241125402 CTAGATGATTGGAGGAAAAAGGG - Intronic
1064704674 10:18059547-18059569 TCAGAGGAAAGGAGGGAAAGAGG - Intergenic
1064994189 10:21282033-21282055 CTATAGGAATGGGAAGAAATTGG - Intergenic
1066093500 10:32050077-32050099 CTAAAGGAAAGGAAGGAAGTTGG + Intronic
1067237308 10:44461764-44461786 GCAGAGGAATGGAGGCACATAGG + Intergenic
1068573457 10:58657039-58657061 ATAGAGGAATGGAGAAAGATGGG - Intronic
1068598198 10:58926895-58926917 GTAGAAGAAATGAGGGAAATAGG + Intergenic
1068950224 10:62769414-62769436 GTAGAGGAATGGCAGGAAAAAGG + Intergenic
1070127158 10:73631811-73631833 TTATGGGAATGGAGGGAAAAAGG - Exonic
1070890077 10:79936643-79936665 GAAGAGGATTGGAGGTAAATCGG + Intergenic
1071364915 10:84889720-84889742 CAGGAGAAATGGAGGAAAATAGG + Intergenic
1072041972 10:91615263-91615285 GTAGAGGGATGGAGGAAATTGGG - Intergenic
1073344331 10:102770994-102771016 TTACAGAAATGGAGGCAAATGGG - Intronic
1073698936 10:105903068-105903090 TTAGAGAAATGGAAAGAAATAGG + Intergenic
1074793706 10:116919611-116919633 TTAGAGGGTTGGGGGGAAATTGG - Intronic
1076378900 10:130011674-130011696 TTAAAAGAATGGAAGGAAATAGG - Intergenic
1078050486 11:7961265-7961287 CTAGAGGAATGGCAGGAAGCAGG - Exonic
1078072638 11:8127354-8127376 CTAGAGAAATTGAGGAAACTGGG + Intronic
1079151360 11:17902564-17902586 CCAGAAGAATGGAGGGATTTGGG + Intronic
1079312318 11:19377827-19377849 CTAAAGGAATGAAATGAAATTGG - Intronic
1079874963 11:25845043-25845065 GTCAATGAATGGAGGGAAATTGG - Intergenic
1080348006 11:31347228-31347250 CTAGAGGAAGGGTGAGAAACAGG + Intronic
1080528521 11:33151085-33151107 CTTAGGGATTGGAGGGAAATGGG - Intronic
1081239470 11:40686364-40686386 CTAGTGGAATGTAGAGAATTAGG + Intronic
1081685593 11:45040918-45040940 GTAGAGGCATGCAGGGAAAAGGG + Intergenic
1083392174 11:62360816-62360838 TTACAGGAATTGAGGGAAAGAGG + Intronic
1085145485 11:74191968-74191990 CTAGTGGAATTGTGGGAAAGGGG + Intronic
1085835430 11:79950820-79950842 GTTGAGGAAGTGAGGGAAATCGG + Intergenic
1086329397 11:85738436-85738458 ATAGAGGATGGGAGGGAAAGGGG + Intronic
1086829085 11:91536913-91536935 ATAGAGGAATGAGGGGAACTAGG + Intergenic
1086925751 11:92639003-92639025 CTAGAGAAATGTGGGTAAATGGG - Intronic
1087259802 11:95998485-95998507 CTAGAGAAATGGAGATAATTTGG + Intronic
1087490922 11:98826217-98826239 CAAGAGGAAAGGAGGTAAAGTGG + Intergenic
1089098363 11:115938589-115938611 GGAGAGGAATGGAAGGAAATGGG + Intergenic
1091021229 11:132101971-132101993 CTGTAGGAATGGTGGGAAATGGG - Intronic
1091639698 12:2226755-2226777 CTCGAGAACTGGAGGGAGATGGG - Intronic
1091736557 12:2927025-2927047 TGAGGGGATTGGAGGGAAATGGG - Intronic
1091890645 12:4051549-4051571 CATGAGAAATGGAGGGCAATAGG - Intergenic
1092145627 12:6212650-6212672 CTCAAGGAATCCAGGGAAATAGG + Intronic
1092845691 12:12582880-12582902 CTACAGGAGTGCAGAGAAATGGG + Intergenic
1094672896 12:32588077-32588099 CCACAGGGATGGAGGGGAATGGG + Intronic
1095203322 12:39410899-39410921 CTGGAGGAATGGAGGGAGGGAGG + Intronic
1095634050 12:44410341-44410363 CAATAGGAACTGAGGGAAATAGG - Intergenic
1095810443 12:46368948-46368970 TTAGAGGTATAGAGGAAAATGGG - Intronic
1096240610 12:49958024-49958046 CTCCAGGGGTGGAGGGAAATTGG + Exonic
1097485360 12:60191299-60191321 GTAGGGGAAAGGAAGGAAATAGG + Intergenic
1098392189 12:69981228-69981250 GTAGAGGAAGGGAGGGAGACAGG - Intergenic
1098443641 12:70544370-70544392 CTAGAAGAATGGATTGAAAGGGG - Intronic
1099568788 12:84286244-84286266 ATAAGGGAATGGAGAGAAATAGG - Intergenic
1101030695 12:100655846-100655868 CTTGAGGAAGTGAAGGAAATGGG + Intergenic
1101225353 12:102682694-102682716 TTATAGGAATCTAGGGAAATGGG - Intergenic
1102007404 12:109597334-109597356 CTTCAGCAATGGAGGGAAATAGG + Exonic
1102216249 12:111163504-111163526 CTCCAGGAATGGAGGGACAATGG - Intronic
1102291978 12:111708327-111708349 CTAGGAGAGTGGAGGGAATTGGG - Intronic
1103149679 12:118626216-118626238 ATAGAGGAAGGGAGGAAAAGAGG - Intergenic
1104744888 12:131204431-131204453 CCAGTGGGATGGTGGGAAATGGG - Intergenic
1104789511 12:131472970-131472992 CCAGTGGAATGGTGGGAAATGGG + Intergenic
1106126022 13:26900591-26900613 CTAGAGCATTGGAGAGAGATTGG - Intergenic
1106349065 13:28910158-28910180 CGGGTGGGATGGAGGGAAATGGG - Intronic
1106628817 13:31448158-31448180 CTAAAATAAAGGAGGGAAATTGG + Intergenic
1106754129 13:32804766-32804788 CTAGATGGATGGAGGGAGATGGG - Intergenic
1107355983 13:39567572-39567594 GGAGAGGAAGGGAGAGAAATAGG - Intronic
1108514818 13:51191120-51191142 GAATAGGAATGGAGGGAAAGGGG - Intergenic
1109759117 13:66803630-66803652 CTAGAGTAATGGAGAGGAAAGGG - Intronic
1109993676 13:70093225-70093247 CAAGATGAAGTGAGGGAAATAGG + Intronic
1110354374 13:74550233-74550255 CTAGAGGAAGGGAAGGATGTGGG + Intergenic
1110832306 13:80045434-80045456 CTGGAGGAATGGAGGATGATGGG - Intergenic
1111140414 13:84111182-84111204 CTATATGTATGGAGTGAAATTGG + Intergenic
1112214898 13:97420021-97420043 CTTGAGGAATGGAGGCAAGTTGG + Intergenic
1112834700 13:103500109-103500131 CAAAAGAAATGGAGAGAAATGGG + Intergenic
1116266003 14:42691153-42691175 TTTGAGGAATGGAGGAACATTGG - Intergenic
1116307197 14:43272746-43272768 TGAGAAGAATGGATGGAAATTGG + Intergenic
1117171927 14:53109162-53109184 CAAGAGGAAAGGAAGGAAGTGGG - Intronic
1119499527 14:75112357-75112379 CTAGAGGAACAGAGGGATAAAGG + Intronic
1120244994 14:81995842-81995864 CTACAGAAAAGGAAGGAAATGGG - Intergenic
1120702548 14:87713842-87713864 ATAAAGGAAGGGAGGAAAATGGG + Intergenic
1121991133 14:98558692-98558714 CTAGAGAAATGGAGAGAACTTGG - Intergenic
1122574550 14:102733400-102733422 CAAGAGGAATGGTGGGGATTAGG - Intergenic
1122734069 14:103825224-103825246 CTCGAGAAAGGGAGAGAAATGGG - Intronic
1126164128 15:45639504-45639526 CTACATGAATGGAGAGAAAATGG + Intronic
1126345877 15:47693491-47693513 ATAGGGGAATGGAGGGTGATAGG - Intronic
1126430314 15:48576549-48576571 CTGGAGGAATGAAGGGAAGGTGG + Intronic
1127174963 15:56344501-56344523 CTAGGTGGGTGGAGGGAAATGGG + Intronic
1127300860 15:57652159-57652181 ATGAAGGAATGGAGGGAAAAAGG - Intronic
1129750004 15:78056065-78056087 CTAGAGAAATGGAGACAACTTGG - Intronic
1129765577 15:78164244-78164266 GAAGAGGAAGGGAGGGAAAGTGG - Intronic
1130235881 15:82132985-82133007 CAGGAGGAAGGGAGGGAAAGTGG + Intronic
1131315110 15:91328997-91329019 CTAGAGGAAAGGAGTGAAAAGGG - Intergenic
1131727155 15:95239283-95239305 AAAGAGGAAAGGAGGGAAAGAGG + Intergenic
1135004477 16:18806741-18806763 ACAGAGGAATGGAGGGAAAGGGG + Exonic
1135099644 16:19594807-19594829 GAAGAGGAATGGAGGGAATTAGG + Intronic
1136248452 16:28988667-28988689 CTAGAGGGCTGGAGGGCAGTGGG - Intronic
1136903080 16:34062548-34062570 ATAGTGGAATGGAGAGGAATAGG + Intergenic
1140557453 16:75938082-75938104 CTAGAGGAAGGGAGGGAAGAGGG - Intergenic
1141343855 16:83227714-83227736 CTAGAGAAGTGGAGGAAAACAGG + Intronic
1141747893 16:85938285-85938307 CCAGAGGATGGGATGGAAATGGG + Intergenic
1142590954 17:1005849-1005871 CTAGAGGTATGGAGGGCAGGAGG + Exonic
1142819254 17:2451706-2451728 CAAGAGGAAGGAAGAGAAATCGG + Intronic
1143411468 17:6712186-6712208 CTAGAGGAAGGGAGTGCACTGGG - Intronic
1144131378 17:12250544-12250566 AAAGAGAAGTGGAGGGAAATGGG - Intergenic
1144431871 17:15199405-15199427 CAAGAGGAATCCAGGCAAATAGG + Intergenic
1144482405 17:15638812-15638834 CTAGAGGTTTGGAGGGAGATGGG + Intronic
1144916278 17:18726220-18726242 CTAGAGGTTTGGAGGGAGATGGG - Intronic
1145888783 17:28400328-28400350 AAATGGGAATGGAGGGAAATAGG + Exonic
1146103522 17:30009386-30009408 CTGGAGGTTTGGAAGGAAATGGG - Intronic
1146555095 17:33816292-33816314 GAAGATGAATGGAGGGAAAAAGG + Intronic
1146762549 17:35491047-35491069 CTAGAGGATTAGAAGGAATTTGG - Intronic
1148147725 17:45376584-45376606 GTAGAGGAAGGGAGTGAACTGGG + Intergenic
1148210642 17:45806539-45806561 CTGGAGGAAGGGAGGGAAGTGGG + Intronic
1148498855 17:48073330-48073352 CAAGAGAATGGGAGGGAAATGGG + Intronic
1148565416 17:48629717-48629739 CTAGAGGAAGGGAAGGAAATGGG + Intronic
1149092221 17:52797472-52797494 CTAGAGGAGGGGAGGGGAATGGG + Intergenic
1149670359 17:58402891-58402913 GTAGAGGAATGCAGGGAATGTGG + Intronic
1152977092 18:231711-231733 GTAGAGGGAGGGAGGGAAATAGG - Intronic
1155293282 18:24362876-24362898 CCAGAGGAATGGCAGGAACTTGG + Intronic
1155572115 18:27206320-27206342 CTGGAGGAAAGCAGGGAAATTGG - Intergenic
1155910706 18:31501530-31501552 GAAGAGGAAAGGAGGGAAACTGG - Intronic
1156809854 18:41234552-41234574 CTAGAGGCAGTGAGGGACATTGG + Intergenic
1161419882 19:4170978-4171000 CTTGAAGAATGGATGGAATTTGG + Intronic
1162158464 19:8695735-8695757 TTAATGGAATGGAGGGAGATGGG + Intergenic
1162954986 19:14092482-14092504 TTTGAGGAATGGGGGGACATGGG + Exonic
1164023766 19:21331578-21331600 CTAGAAGGAAGGAGGGCAATAGG - Intergenic
1164307745 19:24019737-24019759 CTGGAGGAATGGGGAGAAAGGGG + Intergenic
1164926847 19:32137379-32137401 CTAGAGGACTGGAGGGAGGAAGG + Intergenic
1165865534 19:38934878-38934900 ATAGAGAAGTGGAGGGAGATGGG + Intronic
1167019597 19:46863382-46863404 CTAGTGGAAGTGGGGGAAATGGG - Intergenic
1167277644 19:48548535-48548557 CTAGATGAATGGATGGAAAATGG + Intergenic
1167574087 19:50309473-50309495 CAAGAGAAATGGAGGGAGACGGG - Intronic
1168176317 19:54630473-54630495 GAAGAGAAATGCAGGGAAATAGG - Intronic
1168420671 19:56200855-56200877 GGAGAGGATTGGAGGGAATTGGG + Intergenic
1168425948 19:56238875-56238897 GGAGAGGACTGGAGGGAATTGGG + Intronic
925212457 2:2061561-2061583 CCAGAGGGATGGAGGGAAGAGGG + Intronic
925606132 2:5662019-5662041 CCAAGGGAAGGGAGGGAAATGGG + Intergenic
926467604 2:13210691-13210713 CTTGAGGAAAGGAGTGAAATGGG - Intergenic
926494983 2:13575202-13575224 CTAAAGGAATGGAGCCATATTGG + Intergenic
926997147 2:18748265-18748287 ATATAGTAATGGAGGGAAAAAGG - Intergenic
929223925 2:39493740-39493762 ATAGAGGAATGGGGAGATATTGG - Intergenic
929771736 2:44898034-44898056 CCAGAGAAATGCAGAGAAATGGG + Intergenic
930544637 2:52750893-52750915 CTAGAGGAGTGGATAAAAATTGG + Intergenic
930934380 2:56929725-56929747 CTACAGGGAGGGAGAGAAATGGG + Intergenic
931345322 2:61440476-61440498 CAAGAAGAATGGAGGGGAAAAGG - Intronic
932123758 2:69125036-69125058 CTAAAGGGATGCAGGAAAATGGG + Intronic
932495978 2:72146016-72146038 CTGGAGGTGAGGAGGGAAATAGG - Intronic
932693073 2:73929975-73929997 CTAGTGGAAAGGAGGAAAATTGG + Intronic
933408016 2:81887594-81887616 GTTAAGGACTGGAGGGAAATGGG - Intergenic
933654003 2:84872533-84872555 CTAGAGGGAGGGAGGGAAGAAGG + Intronic
934089594 2:88539568-88539590 CAAGAGGAATGAAGGCAGATGGG - Intergenic
934621093 2:95807552-95807574 ACAGAAGAATGGAGGGAAAAAGG + Intergenic
934825343 2:97416654-97416676 ACAGAGGAATGGAGGGAAGAAGG + Intergenic
934851208 2:97702368-97702390 CAAGGGGCATGGAGGGAAAATGG - Intergenic
935461932 2:103347062-103347084 CTACAGCCATGGAAGGAAATGGG - Intergenic
935947814 2:108301902-108301924 CTAGGGGACTGGAGTGAAGTTGG + Intronic
937179307 2:119975930-119975952 ATAAAGGGATGGAGGGAAATGGG - Intronic
937358124 2:121211240-121211262 CAGGAGGAAGGGAGGGAAGTTGG + Intergenic
940187320 2:151001372-151001394 CTAGATGAGTGGAGAGAAAATGG - Exonic
942763144 2:179424043-179424065 CTTGAGAAATGGAGAGAATTAGG - Intergenic
942834768 2:180280786-180280808 CTAGAGGAAGAGAGAGAACTTGG + Intergenic
944894156 2:204146793-204146815 CTTTAGGAAGGAAGGGAAATTGG + Intergenic
945268383 2:207913665-207913687 TTAAAGAAAAGGAGGGAAATTGG + Intronic
947664112 2:231892508-231892530 CTAGAGGAAGGGAAAGAGATTGG - Intergenic
947689274 2:232119894-232119916 TTAGAACAATGAAGGGAAATGGG + Intronic
947766728 2:232642583-232642605 CTACTGGTTTGGAGGGAAATGGG + Intronic
947807872 2:232981061-232981083 CTAGGGGAATGGAGGGGTAAGGG + Intronic
948059734 2:235033885-235033907 ATAGAGGAATTGAGGAAAAAGGG + Intronic
948559480 2:238842039-238842061 CTAGGGATATGTAGGGAAATGGG - Intergenic
1168729459 20:64432-64454 AGAGAGGAATGGAGTGGAATGGG - Intergenic
1168806773 20:676309-676331 CGAGGGGAACGGAGGGAAAGCGG + Intergenic
1169773479 20:9226632-9226654 CTATAGGAAAGGAAGGAAAATGG - Intronic
1170182615 20:13549208-13549230 CTTGAGGAGTGGAGGGAATAGGG - Intronic
1170803678 20:19611491-19611513 CTGGACAAATGGATGGAAATGGG + Intronic
1172590781 20:36116457-36116479 CAGGAGGAAAGGAAGGAAATGGG - Intronic
1173209675 20:41022431-41022453 CCTGAGGAATGAAGGCAAATAGG - Intergenic
1173451652 20:43169700-43169722 CTAGAGAAGAGGAGGGATATTGG - Intronic
1173573537 20:44094624-44094646 CTTGGGGGATGGAGGGATATTGG - Intergenic
1175019310 20:55827450-55827472 CTAAAGGAAGGGAAGGAAAGGGG - Intergenic
1175532492 20:59683753-59683775 TTGGAAGATTGGAGGGAAATTGG + Intronic
1175888797 20:62306985-62307007 CTGGAGGACTGGAGGGAGCTGGG + Intronic
1177532047 21:22373216-22373238 CTAGTGGAATTGTGGGAATTGGG + Intergenic
1177631771 21:23738112-23738134 CTACAGGAATGGATTGAAAATGG + Intergenic
1178040247 21:28632980-28633002 CCATAGGAATGGGAGGAAATAGG - Intergenic
1182060714 22:27395190-27395212 GTAGACGAATGGATGGATATTGG + Intergenic
1182161075 22:28122292-28122314 CAAGAGGACTGCAGAGAAATTGG + Intronic
1183022045 22:35035057-35035079 CAAGAGCCATGGAGGGAACTGGG + Intergenic
1183246853 22:36700497-36700519 TTAGATGGATGGAGGGAGATAGG - Intronic
1184253749 22:43275677-43275699 CTCCAGGAAGGGAGGGGAATGGG + Intronic
1184456265 22:44611428-44611450 CTGGAGGAATCCAGGGAATTAGG + Intergenic
1185007662 22:48291927-48291949 TGATAGGAATGGAGGTAAATTGG - Intergenic
1203312815 22_KI270736v1_random:154657-154679 GTACTGGAGTGGAGGGAAATGGG + Intergenic
949720978 3:6990049-6990071 CTTCAGGAAGGGAGGGATATAGG - Intronic
950526863 3:13529348-13529370 CAGGAGGGATGGAGGGAAAAGGG - Intergenic
951383505 3:22015535-22015557 CTAGATGAATGGACAGAAATGGG - Intronic
951774089 3:26289136-26289158 CTAAAGGAAAGGAGAGAAATGGG + Intergenic
952050551 3:29379129-29379151 ATACAGGAATGCAGGGACATAGG + Intronic
952609954 3:35196701-35196723 ACAGAGGAAAGGAGGGAGATGGG - Intergenic
952815879 3:37447500-37447522 ATAAAGGAATGGAGGGCATTTGG + Intergenic
953081853 3:39628242-39628264 CTAGAGGAAAGGACGGGTATGGG + Intergenic
954144855 3:48629459-48629481 CTAGAGGTATGAAGGGACAGAGG - Intronic
955702497 3:61695955-61695977 CAAGAGGGATGGAGTGAGATAGG + Intronic
956746200 3:72312687-72312709 CTGGAGGATGGGAGGGAAGTAGG + Intergenic
959760072 3:109951484-109951506 CTAGAGGTTTGGAGGGAAATAGG + Intergenic
960232031 3:115239576-115239598 CCAGAGGAATTGAGGAAAAATGG + Intergenic
960446054 3:117749987-117750009 CAAGAGGAATGGACAGAAACAGG - Intergenic
960899209 3:122537782-122537804 GGAGAGGGAGGGAGGGAAATGGG - Intronic
960981828 3:123236037-123236059 CTAGAGGAATGGAGGGAAATAGG + Intronic
961185601 3:124912438-124912460 CAAGAGGCATGGAGGGTAGTGGG + Intronic
962024398 3:131531996-131532018 TAAGAAGAATGGAGGGAAACTGG - Intergenic
962338872 3:134564017-134564039 CTAGAGAAATGGGGAGAAACAGG - Exonic
962810134 3:138952374-138952396 CCAGAGGAAGGGAGGGAGAAGGG + Exonic
962999936 3:140670644-140670666 GTAGTGGAGTGGGGGGAAATGGG + Intergenic
965377360 3:167941933-167941955 CTAGAGCAGGGGAGGGAAGTAGG - Intergenic
965644848 3:170869781-170869803 GTAGGGGAATGGTGGGTAATCGG - Intronic
965920481 3:173907448-173907470 CTACAGAAATGTAGGGAAATAGG - Intronic
966288531 3:178326686-178326708 CTGAAGGAAGGGTGGGAAATAGG - Intergenic
966830933 3:184007989-184008011 CTTGAGGAATGGATAGAATTTGG - Intronic
966984244 3:185165106-185165128 TTAGTGGTATGAAGGGAAATTGG + Intergenic
967025525 3:185560981-185561003 GTGGAGGAAAGGAGGGCAATGGG - Intergenic
967968378 3:194981726-194981748 GGAAAGGAAAGGAGGGAAATAGG + Intergenic
969424876 4:7118310-7118332 ATGGAGGGATGGAGGGATATTGG + Intergenic
969424912 4:7118492-7118514 ATGGAGGGATGGAGGGATATTGG + Intergenic
969958448 4:10917169-10917191 GCAGAAGAATGGAGAGAAATGGG + Intergenic
971932853 4:33107444-33107466 CTAGACTAATGGAAGGAATTGGG - Intergenic
972934016 4:44109074-44109096 CTAGAGGCTGGGAGGGATATTGG - Intergenic
974095496 4:57359467-57359489 AGAGAGGGATGGAGGGAAGTTGG + Intergenic
974366460 4:60955896-60955918 CAAGAGGAATGGAGAAAAACAGG + Intergenic
974682709 4:65183771-65183793 CTAAAGGAAGGGAGGGAGAGAGG - Intergenic
976798589 4:88961992-88962014 TTAGGGAAATGGAGGGAAAGAGG + Intronic
977228904 4:94428133-94428155 CCAGAAGAATGCAGGAAAATAGG + Intergenic
977247493 4:94650266-94650288 CCACAGGAATAGAGTGAAATAGG - Intronic
977320425 4:95507973-95507995 CAAGAGGAATGGAAAGAAAAGGG - Intronic
977586618 4:98781552-98781574 CTATGGGAATGGATGGGAATTGG + Intergenic
978094661 4:104761404-104761426 CAGCAGGAATGAAGGGAAATGGG - Intergenic
978334163 4:107647973-107647995 GTAGAAGAATTGAGGGAAAGAGG - Intronic
980370594 4:131864469-131864491 CTTGGGGCATGGAGGGAAAGGGG + Intergenic
981119421 4:141032276-141032298 CTAGGGAACTTGAGGGAAATGGG + Intronic
981730435 4:147891441-147891463 CTAGAGGTTTGGAAAGAAATGGG + Intronic
981756655 4:148147202-148147224 ATGGAGGAAAGGTGGGAAATAGG - Intronic
982099911 4:151957759-151957781 CTTGCAGAATGGAGGGAAAAGGG - Intergenic
982729898 4:158944823-158944845 CTAGAGGAGTGGAGTCAAAGTGG - Intronic
984070669 4:175108225-175108247 ATAGTGGATTTGAGGGAAATAGG + Intergenic
984409617 4:179379657-179379679 CTAAAGGGTTGGAAGGAAATGGG - Intergenic
985205707 4:187533610-187533632 CTAGAGGAATTGAGGAAAGGTGG + Intergenic
985238303 4:187901317-187901339 CTAGAGAAAAGTAAGGAAATGGG + Intergenic
985268903 4:188176191-188176213 CTACTGGACTGGAAGGAAATAGG - Intergenic
985637998 5:1049345-1049367 CAAGGGGAATGGGGGGAGATGGG - Intergenic
985824853 5:2184622-2184644 TTATAGGAATGGATGGAAAAGGG + Intergenic
986862482 5:11943581-11943603 TTGGAGGTATGGAGGGCAATGGG + Intergenic
987423213 5:17745347-17745369 TCAGAGGAATGGAGAGATATTGG - Intergenic
990200430 5:53366705-53366727 CATGGGGAATGGAGGAAAATGGG + Intergenic
990477901 5:56179412-56179434 TTAGAGGAATGAAGGGAAAAGGG + Intronic
992395564 5:76366332-76366354 AGAGAGGAAGGGAGGGAAAGAGG - Intergenic
992488023 5:77214378-77214400 CTGTATGAATGGAGGGAAAACGG - Intronic
993078109 5:83261282-83261304 CTTCAGGAAGGGAGGAAAATAGG - Intronic
993410780 5:87570705-87570727 TTAGAGGTATGGAGAGAATTTGG + Intergenic
993588217 5:89759341-89759363 CTAGAAGAAAGGAGGCATATTGG + Intergenic
993809987 5:92464167-92464189 CTAGAGGAAAGGAGGAGGATGGG + Intergenic
995173460 5:109144678-109144700 CTCCAAGAATGGAGGGAAACTGG - Intronic
995207446 5:109497433-109497455 CAAGAGGGATGGAGGGAAGAAGG + Intergenic
995425535 5:112017948-112017970 CTAGACCAATGGAGGGACACAGG - Intergenic
996340573 5:122434498-122434520 CTAGAGGAAAATATGGAAATTGG + Intronic
997710282 5:135998374-135998396 CCAGAGGAAGGGAGGCAAACAGG + Intergenic
997710536 5:136000571-136000593 CCAGAGGAAGGGAGGCAAACAGG - Intergenic
999114218 5:149148416-149148438 TCAGAGGAAAGGAGGGAAACTGG + Intronic
999132555 5:149295612-149295634 AAAGAGGAAGGGAGGGAAGTGGG + Intronic
999196341 5:149784118-149784140 GTAGAAGAAAGAAGGGAAATAGG - Intronic
999207405 5:149859467-149859489 CTTGGGGAAGGGAAGGAAATAGG + Exonic
999375847 5:151085956-151085978 ACAGAGGAATGGAGGGAGAGCGG - Intronic
999645317 5:153711836-153711858 CTAGGAGAATGGAGGAAAATGGG + Intronic
1000561203 5:162791725-162791747 CTAGGGGAATAGAGAGAACTGGG - Intergenic
1000932626 5:167270490-167270512 AAAGAAGAATTGAGGGAAATAGG - Intergenic
1001108476 5:168875717-168875739 AGAGAGGAAGGGAGGGAAACAGG + Intronic
1003146134 6:3512104-3512126 CTCTAGGAATGGAGGCAAAGTGG - Intergenic
1003885246 6:10515785-10515807 GTAGGGGTATGGAGGGAAAGGGG - Intronic
1004209701 6:13626806-13626828 CTAGAGAAATGATGGAAAATGGG - Intronic
1004285985 6:14321404-14321426 CAGGAGGAAAGGGGGGAAATTGG - Intergenic
1004542539 6:16564703-16564725 GTAGAGGATTGGGGGAAAATGGG + Intronic
1004632414 6:17434633-17434655 TCAGGGGTATGGAGGGAAATGGG - Intronic
1005766518 6:29016604-29016626 CGAGAGGAGTGGAGGCAAATGGG + Intergenic
1005825854 6:29631626-29631648 AGAGAGGAATGGTGGGAAAGAGG + Intronic
1005864111 6:29925983-29926005 CTAGAAGAGTTCAGGGAAATAGG + Intergenic
1006168569 6:32080076-32080098 CCAGAGGAAGGGAGGGAGGTGGG + Intronic
1007218469 6:40259919-40259941 ATTGAGGAATGGTGGCAAATGGG - Intergenic
1007322709 6:41039017-41039039 CTGGAGGAGGGGAGGAAAATGGG - Intronic
1010360205 6:74984728-74984750 CAAAAGAATTGGAGGGAAATTGG + Intergenic
1010766859 6:79784947-79784969 CCAAAGGAAGGGGGGGAAATAGG + Intergenic
1012595714 6:101036227-101036249 GTAGAGGAAGGAAGGGAAAGAGG - Intergenic
1013026115 6:106273571-106273593 CTAGGGGAAGGGAAGGGAATTGG + Intronic
1013219735 6:108067503-108067525 ACAGAGGAATGGAGGGACAGGGG + Intronic
1013256805 6:108395759-108395781 CTTGAGGGAGGGAGGGAGATAGG + Intronic
1014157862 6:118132949-118132971 CTAGAGGAAGGCATGGAGATGGG + Intronic
1015469472 6:133587415-133587437 CTAGAGAAATAGAGGCATATCGG + Intergenic
1017215587 6:151902208-151902230 CTTGAGGAATGGAGGAAGTTTGG - Intronic
1020613936 7:10435236-10435258 TTAGAGGAATGGAAAGTAATGGG - Intergenic
1022602229 7:31772250-31772272 CTAGAGAGATGGAAGGACATTGG - Intronic
1022754667 7:33273912-33273934 CTACAGGAATGTGGGGAAGTTGG - Exonic
1023051024 7:36251269-36251291 GTAGAGGAAAGAAGAGAAATAGG - Intronic
1023870347 7:44260045-44260067 CTTGAGGACTGGAGGGAATAAGG - Intronic
1024033372 7:45484099-45484121 CAAGAGGAATGGCAGGAAAGAGG + Intergenic
1025249048 7:57339519-57339541 CTAGAGGAGTGGGGAGAAAGGGG + Intergenic
1026540974 7:71279757-71279779 CTGGAGGAACGAAGCGAAATGGG + Intronic
1027228250 7:76258272-76258294 CTGGAGGAAAGGAGGGGAAGCGG + Intronic
1027769996 7:82394314-82394336 CTAGATGAAGGGAGGGAAGAAGG + Intronic
1027870649 7:83702583-83702605 CTGGTAGACTGGAGGGAAATGGG - Intergenic
1028069922 7:86438948-86438970 CTAGAGTACTGGAGGAAAAATGG - Intergenic
1028097864 7:86784707-86784729 CCAGGGGAATGGAGGTGAATGGG - Intronic
1029793701 7:102871907-102871929 CTGGGGGCAGGGAGGGAAATAGG - Intronic
1030499088 7:110336442-110336464 CTAGAGGTATGGAATAAAATGGG + Intergenic
1030658206 7:112191369-112191391 CTAGAGGGGTGGGGAGAAATAGG - Intronic
1031116987 7:117679719-117679741 CTAAAGGAAAGGAGAGAAAGGGG + Intronic
1032442857 7:131955389-131955411 ATAGAGGAAAGGAGGGGAAAGGG + Intergenic
1032630160 7:133642423-133642445 CAAAGGGGATGGAGGGAAATAGG - Intronic
1032956343 7:136976055-136976077 CTTGAAGAATGGATAGAAATTGG + Intronic
1033630194 7:143150105-143150127 CTAGAGGGAGGGAGGGCAAAAGG + Intergenic
1034468729 7:151244865-151244887 CTGGAGGAAAGCAAGGAAATGGG + Intronic
1036123596 8:6043879-6043901 GGAGAGGAAGGGAGGGAAAGGGG - Intergenic
1038125258 8:24666424-24666446 GAAGAGGAATAGAGGGAAATGGG - Intergenic
1038459526 8:27704104-27704126 CTAAAGGAAAGGAGTGAAAGAGG + Intergenic
1038519414 8:28217017-28217039 CTGGAGGAATGGAAGCAGATGGG + Intergenic
1038528298 8:28295993-28296015 CTTGAGGAATGGAGGGGAGTAGG - Intergenic
1042666786 8:71215924-71215946 TTAGAGGAATGTAGGAAAGTAGG - Intronic
1042947276 8:74167886-74167908 CTAGAAGAAAGGAGGGTGATGGG - Intergenic
1045272025 8:100670276-100670298 CTAGAGGAATGAATGGATAGTGG + Intergenic
1045795052 8:106032751-106032773 CTAGAGAAATTGAGTGAAATAGG - Intergenic
1046037977 8:108867102-108867124 CTATAGGAATTGAGGGAACATGG - Intergenic
1046588387 8:116175901-116175923 AGAGAGGAATGGAGGGAGGTGGG + Intergenic
1046847907 8:118939244-118939266 TTTGAGGAATGGAGGAAAAGGGG - Intronic
1047056656 8:121172295-121172317 ATAGAGGAAGGGAGGGAAAAAGG + Intergenic
1047663500 8:127064641-127064663 CTAGAGAAATGAAGGAAAAGGGG - Intergenic
1049349031 8:142154265-142154287 ATAAAGGAAGGGAGGGAAAGAGG - Intergenic
1050044577 9:1529579-1529601 CCAGTGGAATGGAGGCTAATGGG - Intergenic
1052068261 9:24049651-24049673 ATAGAGGAATAAATGGAAATAGG + Intergenic
1052120221 9:24705612-24705634 CTGGAGAATTGGGGGGAAATGGG + Intergenic
1053164139 9:35832873-35832895 CGAGAGGGATAAAGGGAAATGGG - Intronic
1053257126 9:36627111-36627133 CTAGAAGGATGGAGGCAGATAGG + Intronic
1055033479 9:71793727-71793749 CCTGAGTACTGGAGGGAAATGGG + Intronic
1055307682 9:74947151-74947173 TGAGAGGAATGGAGGGAAACAGG + Exonic
1055611021 9:78024378-78024400 CAAAAAGAATGGAGGGTAATCGG - Intronic
1055646008 9:78362059-78362081 CTGGAGGAATGTAGGAACATGGG - Intergenic
1056547025 9:87621429-87621451 CTACAGGAATGGAGGAAATCTGG - Intronic
1057133951 9:92673483-92673505 ATAGAGGAAGGGAGGGAAGAAGG + Intergenic
1057412008 9:94825127-94825149 ATGGAGGAGAGGAGGGAAATTGG + Intronic
1058615160 9:106818369-106818391 CTAATGGCATGGAGGGAGATTGG - Intergenic
1061695515 9:132370340-132370362 CTGGAGGAAAGGATGGAAACAGG + Intergenic
1203353015 Un_KI270442v1:96814-96836 CGAGTGGAATGGAGTGAAAAAGG + Intergenic
1186045561 X:5532860-5532882 AGAGAGGGAAGGAGGGAAATAGG + Intergenic
1186687895 X:11944720-11944742 CTCGAGCAATGGTGGCAAATAGG + Intergenic
1186777913 X:12883956-12883978 TTAGAGGAATTAAGGGAAGTAGG + Intronic
1188165987 X:26865026-26865048 TTAGAGGGACAGAGGGAAATTGG - Intergenic
1188234230 X:27707113-27707135 CTAGGTGAATGGGGGGAAATGGG + Intronic
1189640239 X:43061146-43061168 CTAGAGGAAGAGGGGGCAATGGG + Intergenic
1189701586 X:43719224-43719246 CCAGAGGGGTAGAGGGAAATAGG + Intronic
1189729883 X:44008581-44008603 GAAGAGGGAGGGAGGGAAATGGG + Intergenic
1190128617 X:47726464-47726486 ATGGAGGAATGGATGGGAATGGG - Intergenic
1190327044 X:49212905-49212927 CTGGAGGGATGGAGGGACAGAGG + Intronic
1192161738 X:68793417-68793439 ATAGAGGAAGGGAGGGAGAGAGG + Intergenic
1192430341 X:71107469-71107491 AAAGAGGAAGGGAGGGAAAGAGG + Exonic
1192547800 X:72028024-72028046 CTAGAGGAATGGAGGCCAGAGGG + Intergenic
1192711008 X:73588270-73588292 TGGGAGGATTGGAGGGAAATTGG - Intronic
1193872713 X:86821303-86821325 CCAGAGGAATTGTGGGAAGTAGG + Intronic
1194453893 X:94079076-94079098 CTAGAGGAGGGGAAGGGAATGGG + Intergenic
1194670194 X:96722430-96722452 GTAGAGGAAGGGAAGGAAACAGG - Intronic
1195950842 X:110271005-110271027 TGAGAGGAATGGAGAGAAATGGG + Intronic
1196339974 X:114584486-114584508 GGAGAGGAATGGAGGGAGCTCGG - Exonic
1197590009 X:128397061-128397083 CAAGAGGAGGGGAGGGAAGTGGG - Intergenic
1197668520 X:129249519-129249541 CTAGAGGAATGCAGAGAAGGAGG + Intergenic
1197750777 X:129962109-129962131 TTAGAGGAATGGAGGTAGAAGGG + Intergenic
1197788163 X:130221791-130221813 CTAGGAGAAAGGATGGAAATAGG - Intronic
1198310366 X:135423000-135423022 CCTGAGGAATGGAGGGTAATGGG + Intergenic
1198502291 X:137263305-137263327 CTGTAGGAATGGAAAGAAATTGG + Intergenic
1199540327 X:148951768-148951790 ACAAAGGAATGCAGGGAAATAGG + Intronic
1201099100 Y:10657925-10657947 AGAGTGGAATGGAGTGAAATGGG - Intergenic
1201099988 Y:10664192-10664214 GGAGTGGAATGGAGTGAAATGGG - Intergenic
1201100329 Y:10666832-10666854 GGAGTGGAATGGAGTGAAATAGG - Intergenic
1201102488 Y:10688585-10688607 GGAGTGGAATGGAGTGAAATGGG - Intergenic
1201105995 Y:10763699-10763721 GCAGAGGAATGGAGTGGAATGGG - Intergenic
1201108912 Y:10784454-10784476 AGAGAGGAATGGAGTGGAATGGG - Intergenic
1201109952 Y:10791968-10791990 GGAGTGGAATGGAGTGAAATAGG - Intergenic
1201110257 Y:10793974-10793996 GTAGTGGAATGGAGTGGAATGGG - Intergenic
1201110375 Y:10794842-10794864 GTAGTGGAATGCAGTGAAATGGG - Intergenic
1201114485 Y:10825013-10825035 GGAGTGGAATGGAGTGAAATGGG - Intergenic
1201118020 Y:10849349-10849371 ATAAAGGAATGGAAGGGAATAGG - Intergenic
1201458958 Y:14201452-14201474 CTGGAGGAGAGGAGGGAAATGGG + Intergenic