ID: 960982777

View in Genome Browser
Species Human (GRCh38)
Location 3:123247047-123247069
Sequence CCTTTTATGCACAGGACAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 143}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960982769_960982777 7 Left 960982769 3:123247017-123247039 CCCTTTGCCCTCAGGTTAAAGCT 0: 1
1: 0
2: 2
3: 18
4: 201
Right 960982777 3:123247047-123247069 CCTTTTATGCACAGGACAGCTGG 0: 1
1: 0
2: 2
3: 7
4: 143
960982766_960982777 20 Left 960982766 3:123247004-123247026 CCTCTTCCAAACACCCTTTGCCC 0: 1
1: 1
2: 4
3: 23
4: 299
Right 960982777 3:123247047-123247069 CCTTTTATGCACAGGACAGCTGG 0: 1
1: 0
2: 2
3: 7
4: 143
960982771_960982777 0 Left 960982771 3:123247024-123247046 CCCTCAGGTTAAAGCTCGTCTCC 0: 1
1: 0
2: 0
3: 8
4: 224
Right 960982777 3:123247047-123247069 CCTTTTATGCACAGGACAGCTGG 0: 1
1: 0
2: 2
3: 7
4: 143
960982770_960982777 6 Left 960982770 3:123247018-123247040 CCTTTGCCCTCAGGTTAAAGCTC 0: 1
1: 1
2: 3
3: 35
4: 257
Right 960982777 3:123247047-123247069 CCTTTTATGCACAGGACAGCTGG 0: 1
1: 0
2: 2
3: 7
4: 143
960982768_960982777 14 Left 960982768 3:123247010-123247032 CCAAACACCCTTTGCCCTCAGGT 0: 1
1: 0
2: 1
3: 27
4: 254
Right 960982777 3:123247047-123247069 CCTTTTATGCACAGGACAGCTGG 0: 1
1: 0
2: 2
3: 7
4: 143
960982772_960982777 -1 Left 960982772 3:123247025-123247047 CCTCAGGTTAAAGCTCGTCTCCC 0: 1
1: 0
2: 0
3: 15
4: 193
Right 960982777 3:123247047-123247069 CCTTTTATGCACAGGACAGCTGG 0: 1
1: 0
2: 2
3: 7
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960982777 Original CRISPR CCTTTTATGCACAGGACAGC TGG Intronic
900089305 1:912801-912823 CCTTTTCTGCACTCCACAGCAGG + Intergenic
903646391 1:24898652-24898674 CCTTTTACCCAAAAGACAGCAGG - Intergenic
905689916 1:39935466-39935488 CATTTTTTGCACAGGATAGGTGG + Intergenic
906639181 1:47431441-47431463 CCTTGTCTGCACAGGATACCTGG - Intergenic
906761212 1:48381044-48381066 CCTCATATGCACAGCACAGTAGG + Intronic
910060621 1:83087434-83087456 CTTTTTATGTACAGAAAAGCTGG + Intergenic
911804965 1:102194556-102194578 CCTTATCTGCACAAGACATCTGG - Intergenic
912056098 1:105599711-105599733 CCTTTTGGGCAAAGGACAGACGG - Intergenic
912519065 1:110233078-110233100 CCTTGTTTGCACAGGACTGGTGG + Exonic
912576549 1:110676528-110676550 CCTGTTGTGCCCAGGAGAGCCGG - Intergenic
915410075 1:155694183-155694205 CCTTTTAGGCAACCGACAGCTGG + Intronic
915676796 1:157539405-157539427 CCTTTTATGAAAACTACAGCAGG - Intronic
916782048 1:168044199-168044221 CCATTTATCCATAGGAAAGCTGG + Intronic
917147743 1:171911035-171911057 CTTTTTATTCCCAGAACAGCTGG - Intronic
918127566 1:181597776-181597798 CATTTTATGCAGATGGCAGCAGG + Intronic
920532872 1:206717132-206717154 CCTTTTATTCACAGCAAAGGAGG - Intronic
920600827 1:207321988-207322010 CCTTAAAGGCACAGGACGGCGGG - Intronic
924126199 1:240854658-240854680 CCTTTTATCCAAAGCAAAGCAGG + Intronic
1064318273 10:14277888-14277910 CCTTTAATGCACACTACAGTTGG + Intronic
1070457230 10:76629360-76629382 TCTTCTTGGCACAGGACAGCAGG - Intergenic
1073917799 10:108426853-108426875 CCTTGTCTGCACAGGACACAGGG - Intergenic
1076102871 10:127797269-127797291 CCTTTCTTCCACAGGACAGAGGG - Intergenic
1076627897 10:131833141-131833163 CGTGCTATGCACTGGACAGCGGG + Intergenic
1076873680 10:133205623-133205645 CCTCGTCTGCACAGGCCAGCTGG + Intronic
1077416825 11:2427852-2427874 CCTGTCCTCCACAGGACAGCTGG - Intergenic
1077843436 11:5999279-5999301 CCTATTATTCAGAGGGCAGCAGG + Intergenic
1078753242 11:14185022-14185044 CCTTTCTTACACAGGAGAGCTGG - Intronic
1080272576 11:30466556-30466578 CCTTTGATGCAGAGGGGAGCAGG + Intronic
1083161840 11:60859099-60859121 CCTGGTGTGCACAGGACAGGAGG - Intergenic
1084891343 11:72238551-72238573 CCTTTTAGGCTCAGGACGGAAGG + Exonic
1087562061 11:99802883-99802905 CCATCTATGCACAGGAAAGGTGG + Intronic
1088999499 11:115039582-115039604 CCTTTTATTTCCAGGACATCTGG - Intergenic
1089564359 11:119363285-119363307 CCATTTATGCAGCGGGCAGCGGG - Intronic
1090498152 11:127234619-127234641 CCTTTTATGCCCAGGGCTGGTGG + Intergenic
1090656001 11:128846049-128846071 CCTTTTGTGCACAGGGGATCAGG + Intronic
1094300069 12:28954507-28954529 CCTTTTTTCCATAGAACAGCAGG + Intergenic
1095626270 12:44318579-44318601 CAATTTATGCACAGGAAAGGTGG + Intronic
1096143313 12:49260670-49260692 CCTTGTATGTACAGAATAGCAGG - Intronic
1099632622 12:85169446-85169468 GCTTTTATTCAAAGGACAACAGG - Intronic
1102105493 12:110318388-110318410 CATTTTATGCACAGGAACTCAGG - Intronic
1102481581 12:113227407-113227429 CCCTTCTTGCCCAGGACAGCGGG + Intronic
1102871285 12:116416223-116416245 CCTTTTAGACACAGGAAAACTGG + Intergenic
1102967516 12:117139724-117139746 CCTTTTCCACACAGGACACCTGG - Intergenic
1103082391 12:118035506-118035528 CCCTTCATCCACAGGACACCTGG - Intronic
1103225508 12:119284026-119284048 AGGTTTATTCACAGGACAGCAGG + Intergenic
1103322928 12:120102181-120102203 CATTTTATGGACAGGAAAACAGG - Intronic
1107365584 13:39670162-39670184 AATTTTATTCACAGGACTGCAGG + Intronic
1107921303 13:45211117-45211139 CTTGCAATGCACAGGACAGCAGG - Intronic
1111883311 13:93985971-93985993 CCTTTTATGCAAATGACTGAAGG + Intronic
1112656849 13:101460823-101460845 CTATTTGTTCACAGGACAGCTGG - Intronic
1115581952 14:34769235-34769257 TCTGTTTTGCACAGGACAGCAGG - Intronic
1118738699 14:68722327-68722349 CCGTTCAAGCAGAGGACAGCAGG - Intronic
1125024191 15:35013926-35013948 CCTTCTATGAACAAGAAAGCAGG + Intergenic
1129358040 15:75005686-75005708 CCTTCTGTGCACAGCATAGCAGG + Intronic
1132942878 16:2516976-2516998 CCTTTTCTACAGAGGGCAGCAGG - Intronic
1133496487 16:6323030-6323052 CCTTATATGCAGAGGGAAGCTGG - Intronic
1133729479 16:8567543-8567565 CCTATGATGCTCAGGACATCTGG - Intergenic
1133880469 16:9776975-9776997 CCTTTCATCTACAGGACAACTGG - Intronic
1135147543 16:19975794-19975816 CCTTTTCTTCACAAGACAGCAGG + Intergenic
1141019751 16:80484111-80484133 TTTTTTTTGCTCAGGACAGCAGG - Intergenic
1144950452 17:18990888-18990910 CATTTTATAGACAGGAAAGCTGG + Intronic
1147843416 17:43388623-43388645 CCTTGTACCCACTGGACAGCGGG + Intergenic
1148744537 17:49911035-49911057 CCTTTTATACACAGGTGTGCTGG + Intergenic
1149368537 17:55969637-55969659 CCTTGACTCCACAGGACAGCTGG - Intergenic
1149582033 17:57757343-57757365 CCTTTGAGTCACAGGAAAGCTGG + Intergenic
1152690524 17:81715856-81715878 CCTCCTATGCCCAGGACACCAGG - Intronic
1157951826 18:52047027-52047049 CCTTTCAGGCTCCGGACAGCTGG - Intergenic
1160546182 18:79657471-79657493 CCTTTTGTGGACAGAGCAGCAGG - Intergenic
1162719271 19:12652452-12652474 CCTTTTCTGCCCAGCACATCCGG - Exonic
1162852227 19:13439746-13439768 CCTTTTATGCCTAAGATAGCCGG - Intronic
1163729992 19:18943384-18943406 CATTTTTTGCACAGAACAGACGG - Intergenic
1164589423 19:29498196-29498218 CCATTATAGCACAGGACAGCTGG - Intergenic
1164772275 19:30818824-30818846 CCTTTTAGGAAAAGCACAGCTGG - Intergenic
1166323274 19:42032985-42033007 CATTGTATGCATAGGCCAGCAGG - Intronic
1167314174 19:48754295-48754317 CCATTGAAGCACAGCACAGCAGG + Intronic
1167757741 19:51423160-51423182 CCTGTTATTTACAGAACAGCAGG + Intergenic
1168560202 19:57375805-57375827 CATCTTCTTCACAGGACAGCAGG + Intronic
926927466 2:18002016-18002038 CCTTTTCTGCAAAAGACATCTGG - Intronic
926974280 2:18497639-18497661 CCTACAATGCACAGGTCAGCAGG - Intergenic
931431114 2:62209697-62209719 CCTTTCCTTCACAGGAGAGCTGG + Intronic
932264704 2:70357706-70357728 CTTTTTATGGAAAGGTCAGCCGG + Intergenic
935602435 2:104936757-104936779 CCTTTTTTTCACAGGGCAGAAGG - Intergenic
936878276 2:117218826-117218848 CCTTATGGGCCCAGGACAGCAGG + Intergenic
937481265 2:122262063-122262085 CCTTTAATGCAGAGAACAGATGG + Intergenic
938679618 2:133676391-133676413 CCTTTTAAGCACAGGACTGTGGG - Intergenic
939511692 2:143114445-143114467 ACTTTTACTCACAGCACAGCTGG + Intronic
939687718 2:145220279-145220301 CCTTGTATGCACAGGAGAAATGG + Intergenic
940255102 2:151719922-151719944 CATTTTAGGCATAGGACAACAGG + Intronic
944084925 2:195834781-195834803 CCTATTATACAAATGACAGCAGG - Intronic
944410543 2:199437900-199437922 CCTATTATGCAAATGACAACTGG + Intronic
945044385 2:205769081-205769103 CCTCTTATGGTCAGGACAGCAGG + Intronic
1175326864 20:58135671-58135693 TCTACTATGCACAGGACTGCAGG + Intergenic
1179963002 21:44781415-44781437 CCACTAATGCCCAGGACAGCAGG + Intronic
1183831495 22:40420568-40420590 CCTTTTCTTCCCAGGTCAGCAGG - Exonic
1185029634 22:48434898-48434920 CCTGTGATGCTCTGGACAGCAGG + Intergenic
955216396 3:56987937-56987959 CCATTTATGCTCTGGACATCAGG - Intronic
956152673 3:66259745-66259767 GCTGCAATGCACAGGACAGCTGG - Intronic
956482223 3:69684559-69684581 CCTTTTTTGCTCAGGACTGGGGG - Intergenic
956759652 3:72429105-72429127 CCTGTTATGAACAGAAAAGCAGG + Intronic
957643258 3:82886175-82886197 AGTTTTCTGCACAGGAAAGCAGG + Intergenic
960982777 3:123247047-123247069 CCTTTTATGCACAGGACAGCTGG + Intronic
964501698 3:157355036-157355058 CCTTCTTTCCACAGGACAGACGG + Intronic
965520578 3:169665318-169665340 ACCTTTATGCACAGGACAGCGGG - Intergenic
966058369 3:175725423-175725445 CTTTTTAGGCTCAGGAAAGCAGG + Intronic
968662831 4:1805883-1805905 CCTGGTAGGCACAGGACACCAGG - Exonic
969709451 4:8834437-8834459 CCTTTTGTGCACTGCACAGGAGG + Intergenic
970211180 4:13711348-13711370 CCTCTTATGAACATGTCAGCTGG - Intergenic
974822945 4:67091238-67091260 CCCTTTAGGCACAGTACAGGAGG - Intergenic
985542465 5:493308-493330 CCATTTAAGCACAGAGCAGCGGG + Intronic
987088537 5:14490590-14490612 CCTTTCTTGCACAGGCCAGGTGG + Intronic
988225472 5:28406704-28406726 CCTTTTCTGAACAGGGGAGCGGG + Intergenic
988396581 5:30704021-30704043 ACTTTCATTCACAGGGCAGCAGG + Intergenic
995388691 5:111615658-111615680 TGTTTTATGCACAGGAAGGCTGG + Intergenic
995784986 5:115818276-115818298 CTCTTTAAGCACAGGACAGATGG - Intergenic
996885531 5:128349702-128349724 CCTTTAAGGCCCAGAACAGCTGG - Intronic
999392406 5:151203198-151203220 CCTTTTGTGCACAAGCAAGCAGG - Intronic
999401258 5:151266027-151266049 CCTTTTCTGCATAGGACTTCAGG - Intronic
1003340102 6:5212503-5212525 CCTTTTATGTCCAGACCAGCTGG - Intronic
1003914377 6:10772032-10772054 CGTTTTATGGACGGGAAAGCTGG + Intronic
1005460267 6:26062270-26062292 CTTGTTAAGCACAGGACACCAGG + Intergenic
1006435514 6:34023989-34024011 GCTTTTAGACAAAGGACAGCTGG - Intronic
1006719256 6:36139461-36139483 CCTTTCAAGCAGAGGACAGAAGG + Exonic
1008854215 6:56062181-56062203 TGGTTTAAGCACAGGACAGCTGG - Intronic
1009767905 6:68105730-68105752 CCTTTTAAGCTCTGGAGAGCTGG - Intergenic
1009951052 6:70396470-70396492 CCTTTTAGACATAGGACACCTGG - Intergenic
1009960238 6:70511254-70511276 TCTTTGGTGCACAGGACATCAGG + Intronic
1010399460 6:75431698-75431720 CCTTCTCTGCCTAGGACAGCTGG - Intronic
1012485787 6:99721600-99721622 CATTTTATTCACAAGGCAGCAGG - Intergenic
1016716602 6:147239533-147239555 CCTTTTATGCAAAAAAAAGCAGG - Intronic
1017118626 6:151002908-151002930 CCTATAATGCACAGGACAGCTGG - Intronic
1018251031 6:161870667-161870689 CCTTTCCTTCACAGGCCAGCAGG - Intronic
1018904665 6:168068700-168068722 GCTTTTATTCTCAGGACTGCAGG - Intronic
1022746492 7:33178157-33178179 TCGTTTCTGCACAGGGCAGCTGG + Intronic
1033544390 7:142386663-142386685 CTTTTTGTGCAGAGGGCAGCTGG - Intergenic
1034514758 7:151567173-151567195 CCTTGCATACACAGGACACCTGG - Intronic
1039018134 8:33175615-33175637 CCCTTTCTGCAAAGGACAGTGGG + Intergenic
1039193699 8:35006075-35006097 ACTGTCATGCACAGGCCAGCCGG + Intergenic
1042813539 8:72852629-72852651 CATTTTTTGCACAGGATGGCAGG + Intronic
1043370468 8:79584741-79584763 CCTTTTTTTCACAGGGCAGCAGG - Intergenic
1043614295 8:82106256-82106278 CATTTTATACCCAAGACAGCAGG - Intergenic
1045204560 8:100024502-100024524 CCTTGTATGCTCAGGACTGAAGG - Intronic
1047515143 8:125547371-125547393 CCCTTTATGCACAGCAAAGGTGG + Intergenic
1047543290 8:125791507-125791529 CCATTTATGAACAAGAAAGCAGG + Intergenic
1049946745 9:604484-604506 CCTCTTCTTCACATGACAGCAGG - Intronic
1054938825 9:70717650-70717672 ACTGTAATGCACAGGAAAGCAGG - Intronic
1054940516 9:70735643-70735665 ACTGTAATGCACAGGAAAGCAGG - Intronic
1056476092 9:86952508-86952530 CCTTTCATGCACAGTAAAGCAGG + Intergenic
1056724056 9:89096805-89096827 CCTAAAATGCACAGGACAGCTGG + Intronic
1060144755 9:121242437-121242459 CCCTTTTTCCAGAGGACAGCAGG - Intronic
1061372617 9:130206269-130206291 CCTTCTGTGCAAAGGACAGAGGG - Intronic
1185543813 X:925873-925895 CCTTTTGTGCATAAGCCAGCTGG + Intergenic
1197266300 X:124376114-124376136 ACTTTTCAGCACAGGAGAGCAGG + Exonic
1200796464 Y:7345602-7345624 CATAAAATGCACAGGACAGCAGG - Intergenic