ID: 960983659

View in Genome Browser
Species Human (GRCh38)
Location 3:123256604-123256626
Sequence GAATTAGATGTGTCTCCATT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 147}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960983657_960983659 -2 Left 960983657 3:123256583-123256605 CCTTTCTTTTTTCTCTATGCAGA 0: 1
1: 0
2: 6
3: 62
4: 783
Right 960983659 3:123256604-123256626 GAATTAGATGTGTCTCCATTGGG 0: 1
1: 0
2: 1
3: 10
4: 147
960983654_960983659 20 Left 960983654 3:123256561-123256583 CCATCTAGGAAGTCTTCCCTGGC 0: 1
1: 0
2: 7
3: 59
4: 292
Right 960983659 3:123256604-123256626 GAATTAGATGTGTCTCCATTGGG 0: 1
1: 0
2: 1
3: 10
4: 147
960983656_960983659 3 Left 960983656 3:123256578-123256600 CCTGGCCTTTCTTTTTTCTCTAT 0: 1
1: 0
2: 18
3: 294
4: 4604
Right 960983659 3:123256604-123256626 GAATTAGATGTGTCTCCATTGGG 0: 1
1: 0
2: 1
3: 10
4: 147
960983655_960983659 4 Left 960983655 3:123256577-123256599 CCCTGGCCTTTCTTTTTTCTCTA 0: 1
1: 0
2: 9
3: 109
4: 1145
Right 960983659 3:123256604-123256626 GAATTAGATGTGTCTCCATTGGG 0: 1
1: 0
2: 1
3: 10
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960983659 Original CRISPR GAATTAGATGTGTCTCCATT GGG Intronic
902837959 1:19058782-19058804 GAATTAGACATGTCCCCCTTGGG - Intergenic
907374445 1:54024301-54024323 AAATTAGATAGGTCTCAATTTGG - Intergenic
911329208 1:96507579-96507601 CATTTAGATGTGGCTGCATTGGG - Intergenic
911334013 1:96559682-96559704 GAATTAGATAGATCTGCATTTGG - Intergenic
914387720 1:147187767-147187789 TAATTTCATTTGTCTCCATTTGG - Intronic
915985535 1:160460607-160460629 GCTTTAAATGTTTCTCCATTGGG - Intergenic
921692755 1:218170037-218170059 GAATTTGATGTCTCTCAACTGGG + Intergenic
921784257 1:219209087-219209109 TAATTAGATGTATCTACATCTGG + Intronic
923142314 1:231171123-231171145 GAAGTGGATGTGTCTCCTCTAGG + Intronic
923817145 1:237393427-237393449 GAATTAAATGCCTCTCCATCTGG + Intronic
923822492 1:237460474-237460496 GAAGTAGATGAGTCAACATTTGG - Intronic
1065517359 10:26537630-26537652 GAATTAAAAGTGTTTACATTTGG + Intronic
1067578087 10:47420340-47420362 GATGCAGATGTGGCTCCATTTGG + Intergenic
1071167719 10:82826278-82826300 GAATCAGCTATGACTCCATTTGG + Intronic
1074184768 10:111091311-111091333 GAAGTAAATGCATCTCCATTTGG + Intergenic
1074741310 10:116486922-116486944 GATTCAGGTGTGTCTTCATTAGG + Intergenic
1076216235 10:128695956-128695978 GAATTAGAAGAGTGTGCATTAGG + Intergenic
1081865770 11:46359458-46359480 AAATAAAATGTGTCACCATTTGG + Intronic
1082129237 11:48468063-48468085 GATTTATATGTGTATACATTGGG + Intergenic
1085229582 11:74953507-74953529 TAATTTGATGTGTCTTGATTTGG + Intronic
1086531322 11:87788898-87788920 GAATTATTTGTTTCTCCTTTCGG - Intergenic
1086756690 11:90572826-90572848 AATTCAGATGTGACTCCATTTGG + Intergenic
1086900241 11:92359365-92359387 GAAATAGATTTTTATCCATTCGG - Intronic
1087536386 11:99451918-99451940 AAATTAATTGTTTCTCCATTAGG - Intronic
1088486280 11:110343839-110343861 GAATTAGAAGAGGTTCCATTTGG + Intergenic
1088736932 11:112735465-112735487 GACTTAGATGCCTCTCCTTTGGG - Intergenic
1089031596 11:115335741-115335763 TAATGAAATGTGTCACCATTTGG - Intronic
1089067631 11:115674081-115674103 TATTTAGATGGGGCTCCATTCGG + Intergenic
1091865863 12:3836141-3836163 GACTTTGATGTGTCTGCATTTGG - Intronic
1093103860 12:15061532-15061554 GAATTGGATGTGTTCCCATTTGG + Intergenic
1093740656 12:22682132-22682154 TAATGAGATGTGTCAACATTTGG - Intronic
1097653798 12:62337026-62337048 GAATAAAATGTGTCAACATTTGG - Intronic
1097993406 12:65861002-65861024 GAAAAAGATGTGTCTACTTTGGG + Intronic
1098879272 12:75900415-75900437 GAATTGTATGACTCTCCATTTGG - Intergenic
1100700707 12:97144898-97144920 AAATTAGATGTTTCTGAATTTGG + Intergenic
1101193718 12:102361314-102361336 GAATTAGATCTGATTCCATTGGG - Intergenic
1101634904 12:106531404-106531426 GCATGGGATGTGTTTCCATTTGG + Intronic
1103958310 12:124592035-124592057 GAATTTGGGGTGTCTGCATTCGG + Intergenic
1108486487 13:50931932-50931954 AAATGAGATGTGTCAACATTTGG - Intronic
1108519352 13:51232426-51232448 CAATTAAGTGTCTCTCCATTTGG - Intronic
1111898283 13:94168896-94168918 GAATGTTATGTGTCTCCATATGG + Intronic
1111923661 13:94439924-94439946 TGCTTAAATGTGTCTCCATTAGG + Exonic
1113609748 13:111635710-111635732 AAATTAGAGGGGTCCCCATTCGG - Intronic
1115234778 14:31198566-31198588 GAATGAGATATGTCCACATTTGG + Intronic
1115469602 14:33754974-33754996 CAACAATATGTGTCTCCATTTGG - Intronic
1115934548 14:38536998-38537020 GCCTTAGCTGTGTCTCCACTTGG + Intergenic
1116695287 14:48167674-48167696 GCATGAGATGTGTTTCTATTTGG - Intergenic
1122894085 14:104746811-104746833 AAATTAGAACTGCCTCCATTTGG + Intronic
1123144241 14:106112542-106112564 GAGTCAGGTGTGTCTCCATGTGG - Intergenic
1123192224 14:106582423-106582445 GAGTCAGGTGTGTCTCCATGTGG - Intergenic
1128194199 15:65736122-65736144 TAATAAAATGTGTCTACATTTGG + Intronic
1131889700 15:96959432-96959454 GAATTAGATATGAAGCCATTTGG + Intergenic
1136274808 16:29173004-29173026 GCTTTAAATGTGTTTCCATTAGG - Intergenic
1141936224 16:87240298-87240320 GAATTAATTGTATCTCCATAGGG - Intronic
1142079102 16:88138761-88138783 GCTTTAAATGTGTTTCCATTAGG - Intergenic
1144358180 17:14465913-14465935 GAAATAGATGTCTCTCTATATGG - Intergenic
1145739807 17:27263889-27263911 GAATAAGATGAGCTTCCATTTGG + Intergenic
1150538541 17:66072504-66072526 TTATTAAATGTCTCTCCATTAGG + Intronic
1150860170 17:68793291-68793313 GAATTAAATGTTTCTCCACTTGG - Intergenic
1153451010 18:5228776-5228798 GCATGGGATGTGTTTCCATTTGG + Intergenic
1154378547 18:13828964-13828986 TATTTAGATGTGTCTTCATTTGG + Intergenic
1158617112 18:58998076-58998098 AAATCAGATGTGTTTTCATTGGG + Intergenic
1159233288 18:65636717-65636739 GAAATAGAAGGGTCTCCTTTGGG + Intergenic
1164539657 19:29113451-29113473 GAAGGAGATGAGTGTCCATTTGG - Intergenic
926539257 2:14154384-14154406 TAATTAGATGGGTCTCCAATGGG + Intergenic
928099344 2:28426501-28426523 GAATTAGTTGTCTCTCCTCTGGG + Intergenic
928221523 2:29407240-29407262 GAATCAAATTTGTCTCCTTTGGG + Intronic
928469842 2:31563314-31563336 GAAGCAGAAGTGTCTCCAATGGG - Intronic
928654855 2:33439948-33439970 TTCTCAGATGTGTCTCCATTGGG - Intronic
929758728 2:44788811-44788833 GAATCAGATGTGCCTGCATCTGG - Intergenic
931756234 2:65377023-65377045 GAATTAGTTGTGTTTCAATATGG - Intronic
931855019 2:66294009-66294031 GAATTAGATATGTCTGGCTTTGG - Intergenic
932104732 2:68932223-68932245 GAATTAGAAGTGGCACCATCGGG - Intergenic
937106293 2:119317069-119317091 GAATTATTTGTGTCTGCATCTGG + Intronic
937252251 2:120532301-120532323 GACCGAGATGTGTCTCCCTTTGG - Intergenic
939564491 2:143770876-143770898 GAGTTAGATGTGGCTTCATTGGG + Intergenic
942231532 2:173865000-173865022 GAATTAGATGTGTATGAACTTGG + Intergenic
943753422 2:191533683-191533705 GAATTAAATGTTTCTCTTTTTGG + Intergenic
944902260 2:204227476-204227498 GAAAAAGCTGTGTCTCCTTTGGG - Intergenic
948512651 2:238480367-238480389 GGATTAGTTTTGTCTGCATTTGG + Intergenic
1169390673 20:5188122-5188144 TAATGAAATGTGTCTACATTTGG + Intronic
1170350656 20:15437396-15437418 GAATTTGGTGTGTGTGCATTGGG - Intronic
1170767144 20:19299978-19300000 GAGTTGGATGTGTCCACATTTGG - Intronic
1170915364 20:20618800-20618822 GAAATAGAACTGACTCCATTTGG - Intronic
1178776423 21:35555503-35555525 GCATTAGCTGTGTAGCCATTGGG + Intronic
1179497286 21:41780689-41780711 GAACCAAATGTGTATCCATTTGG + Intergenic
1180236800 21:46466155-46466177 TAATTAAATGTGTCAGCATTTGG + Intronic
949691422 3:6644255-6644277 GAATTAGCTGTGCCTACAGTGGG - Intergenic
953459917 3:43073866-43073888 GAACTAGATGTGCCTTCATGTGG - Intergenic
955860583 3:63325645-63325667 GAATTTGCTCAGTCTCCATTTGG - Intronic
956028561 3:65010776-65010798 GCATGGGATGTATCTCCATTAGG + Intergenic
956714354 3:72065115-72065137 AACTTAGATGGGTCTGCATTTGG + Intergenic
957363308 3:79187220-79187242 GCATTAGATCTGTCCCCATATGG + Intronic
958143475 3:89593147-89593169 GAATTGTTTGTGTCTCCACTGGG - Intergenic
959121973 3:102243390-102243412 GAATTAGCTGTGTAACCATGTGG - Intronic
959384891 3:105691769-105691791 GAATTAGATCATTCTCCAGTGGG - Intronic
960983659 3:123256604-123256626 GAATTAGATGTGTCTCCATTGGG + Intronic
962909070 3:139831189-139831211 AAATTAAATGTGTCAACATTCGG + Intergenic
963261628 3:143197674-143197696 AAAGTAGATGTGACTCTATTAGG - Intergenic
963460165 3:145602328-145602350 GAATTAGATTTCTCTCAACTTGG + Intergenic
964604686 3:158547758-158547780 GAATAAGATAAGTCTTCATTTGG + Intergenic
966253868 3:177896060-177896082 GAATTAGAGATGTCTAGATTTGG - Intergenic
966567223 3:181396731-181396753 GACTTAGATTTAGCTCCATTTGG - Intergenic
970324667 4:14911084-14911106 GAATAAGATGTGACTCCAGGTGG + Intergenic
971560185 4:28069536-28069558 AACTTAGCTGTGACTCCATTTGG - Intergenic
974366675 4:60959004-60959026 TAATAAGATGTGTCTCTCTTTGG + Intergenic
978576894 4:110197499-110197521 GAATTAGAAGTGTGTCCAAAAGG + Intronic
978768245 4:112427182-112427204 GAAGTAGCTGTGTTTACATTAGG + Intronic
981583051 4:146270333-146270355 GAATTAGTTGTGTCATAATTAGG - Intronic
981619721 4:146680513-146680535 GCATTAGGTATTTCTCCATTAGG - Intergenic
982528063 4:156504781-156504803 GCATGGGATGTGTTTCCATTTGG - Intergenic
986072246 5:4296727-4296749 CAGTTAGCTGTGTCTCCTTTTGG + Intergenic
986851035 5:11814334-11814356 TAATTAGATGTTTGTCCACTGGG - Intronic
991236001 5:64398278-64398300 GGTTTAGCTGTGTCTCCATCTGG + Intergenic
995010963 5:107256855-107256877 AAATTAGATGTGTAAGCATTGGG + Intergenic
996698490 5:126424349-126424371 GAATTAGAAGTGACTTCAGTAGG - Intronic
999084569 5:148875903-148875925 GAATGAAATGTGTCAACATTTGG + Intergenic
1002766589 6:245363-245385 AAATTAATTGTGTCCCCATTGGG + Intergenic
1006824799 6:36926887-36926909 GACTCAGATGTGCCTCCGTTGGG + Intronic
1007920669 6:45606880-45606902 AAATTAGATGTGTGTTCAGTGGG + Intronic
1008677993 6:53842206-53842228 GAACTAGATGTGTCTCGAAATGG + Exonic
1010418155 6:75639110-75639132 GAATTGGAAGTGGCTACATTAGG + Intronic
1012828468 6:104177683-104177705 GAATTAGATTTTTCTACATACGG - Intergenic
1013264539 6:108482132-108482154 TAATTAAATGTGTCAACATTTGG + Intronic
1014006253 6:116422179-116422201 TAATTAAATGTGTCAACATTCGG - Intronic
1015160539 6:130148164-130148186 GAATTAGAAAAGTCACCATTTGG - Intronic
1016082118 6:139868802-139868824 GGAATAAATGTGTCTCCTTTGGG + Intergenic
1022487168 7:30788437-30788459 TAATGAGATGTGTCCACATTTGG - Intronic
1022702825 7:32777423-32777445 GACTTAGATGTGTTTCCAATGGG - Intergenic
1022907050 7:34867543-34867565 GACTTGGATGTGTTTCCAGTGGG - Intronic
1023774530 7:43591860-43591882 GAATTAGCTGTCTTTCCATTTGG + Intronic
1028244124 7:88455336-88455358 CAATTAGATGCATGTCCATTTGG - Intergenic
1030351198 7:108489903-108489925 CACTTAGATGTGTCTCAATGTGG - Intronic
1033852231 7:145511629-145511651 GAATTCCATGTCTCTTCATTTGG - Intergenic
1035586706 8:780978-781000 GAATTACATTTCTCTCCATGAGG + Intergenic
1036568131 8:9955788-9955810 GAATCAGATGTGTTTTCACTGGG + Intergenic
1037776396 8:21838632-21838654 GAAGAAGATCTCTCTCCATTAGG + Intergenic
1038181898 8:25236921-25236943 GAATGATATATGTCTCCAATGGG + Intronic
1041605917 8:59782175-59782197 TATTAAGATGTGTCTCCATTAGG - Intergenic
1043312626 8:78879979-78880001 AAATTAGAAATGTCTCAATTAGG + Intergenic
1043690398 8:83143807-83143829 GATTTATATTTTTCTCCATTAGG - Intergenic
1044404115 8:91807829-91807851 GAATTAGAAGTGTCTGCTTAGGG - Intergenic
1047658277 8:127003065-127003087 GAATCAGATGTTTCTGCTTTAGG - Intergenic
1050759264 9:9046429-9046451 GAATAAGTTCTGTTTCCATTTGG + Intronic
1050776128 9:9262970-9262992 GTATCAGATGTGTTTGCATTTGG - Intronic
1050992346 9:12170240-12170262 TAATTAGAGGTGTCTCTCTTTGG + Intergenic
1056671708 9:88634325-88634347 GCATGGGATGTGTTTCCATTTGG + Intergenic
1056895455 9:90543475-90543497 GAACTAAATGTGTCATCATTTGG + Intergenic
1057013222 9:91626900-91626922 AAATAAAATGTGTCTCCTTTAGG + Intronic
1057770414 9:97962656-97962678 TAATAAAATGTGTCCCCATTTGG + Intergenic
1058308971 9:103476946-103476968 TACTTACATTTGTCTCCATTTGG - Intergenic
1058721095 9:107764948-107764970 GCATGGGATGTGTTTCCATTTGG + Intergenic
1060162133 9:121373596-121373618 GAATTAGAAGTGTCTCCCTTTGG + Intergenic
1187026528 X:15441089-15441111 GGACTGGATGTGGCTCCATTAGG - Intronic
1190623818 X:52316460-52316482 AAATTAGATCTTGCTCCATTCGG + Intergenic
1196000215 X:110775276-110775298 GAAATAAATGTCTATCCATTGGG + Intronic
1196960040 X:120991377-120991399 GAATTGGATGAGCCTCCAATGGG + Intergenic
1200374923 X:155769600-155769622 GGATTAGATGTGAATTCATTTGG + Intronic
1201362250 Y:13165251-13165273 TAATTAGATGTGTTTTCCTTTGG - Intergenic