ID: 960984631

View in Genome Browser
Species Human (GRCh38)
Location 3:123268035-123268057
Sequence GGGATTCATTGCCATCTAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 98}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960984623_960984631 18 Left 960984623 3:123267994-123268016 CCACGTGTTCTCCACTGATATCA 0: 1
1: 0
2: 3
3: 18
4: 134
Right 960984631 3:123268035-123268057 GGGATTCATTGCCATCTAGTGGG 0: 1
1: 0
2: 0
3: 10
4: 98
960984625_960984631 7 Left 960984625 3:123268005-123268027 CCACTGATATCACAATAAGAGGG 0: 1
1: 0
2: 0
3: 14
4: 89
Right 960984631 3:123268035-123268057 GGGATTCATTGCCATCTAGTGGG 0: 1
1: 0
2: 0
3: 10
4: 98
960984622_960984631 19 Left 960984622 3:123267993-123268015 CCCACGTGTTCTCCACTGATATC 0: 1
1: 0
2: 1
3: 17
4: 173
Right 960984631 3:123268035-123268057 GGGATTCATTGCCATCTAGTGGG 0: 1
1: 0
2: 0
3: 10
4: 98
960984621_960984631 26 Left 960984621 3:123267986-123268008 CCAGAGTCCCACGTGTTCTCCAC 0: 1
1: 0
2: 1
3: 10
4: 103
Right 960984631 3:123268035-123268057 GGGATTCATTGCCATCTAGTGGG 0: 1
1: 0
2: 0
3: 10
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960984631 Original CRISPR GGGATTCATTGCCATCTAGT GGG Intronic
901169956 1:7249851-7249873 GGGAGTCATTGCTATATAGATGG + Intronic
902393830 1:16121428-16121450 TGGATTCTTTTCCCTCTAGTGGG - Intergenic
904994211 1:34618301-34618323 GGGTTGCACTGGCATCTAGTGGG + Intergenic
905539855 1:38751769-38751791 GGGCTTCATTACCATCTCTTGGG + Intergenic
908549322 1:65193171-65193193 GGCATTCATTGAAATCTAGGTGG + Intronic
916664046 1:166949199-166949221 GGGATGCTGTGGCATCTAGTGGG - Intronic
918109701 1:181444644-181444666 GGGCTTCCTTGCTATCTACTTGG + Intronic
918273453 1:182926132-182926154 GATATTCATTGACATTTAGTAGG - Intronic
924599887 1:245479148-245479170 GGGAATCATTGGCATCTAGATGG + Intronic
1063784446 10:9364931-9364953 GGGATTAATTGGCATTTAGGAGG - Intergenic
1064997505 10:21309655-21309677 GGGATTCATAGCCAGGAAGTAGG - Intergenic
1065376541 10:25048966-25048988 GGCATTCAGTGCCTTCTAGGAGG + Intronic
1065817581 10:29496035-29496057 GGGATGCATTGTCATCTAAGTGG - Intronic
1068130800 10:52892930-52892952 GGGAATCATTGAAAACTAGTTGG + Intergenic
1069236933 10:66087412-66087434 GTGCTTCATTGGCATCTACTGGG + Intronic
1074071494 10:110074257-110074279 GGGATTCATAGCACTTTAGTTGG + Intronic
1074212851 10:111353601-111353623 GGGATTCATTCTCATTAAGTAGG + Intergenic
1080410745 11:32022704-32022726 GGGATTCCTGGCCAACTGGTAGG - Intronic
1084873637 11:72114756-72114778 GGGAGTCATTGGCATGTAGATGG + Intergenic
1086489760 11:87347549-87347571 GGGACTGACTGCCTTCTAGTTGG + Intergenic
1088189570 11:107212960-107212982 GGAATACATTGGCATTTAGTAGG - Intergenic
1090772989 11:129938225-129938247 GGGATTCATTAGCATAGAGTTGG - Intronic
1092532221 12:9354026-9354048 GGGAGGCATTGCCCTGTAGTGGG + Intergenic
1094750732 12:33404242-33404264 GGCATTCATTGCCTTATATTGGG - Intronic
1098834629 12:75407160-75407182 GGGATTTATAGCCATGGAGTAGG - Intronic
1099951477 12:89309125-89309147 GGGATTCATTGACATTCACTTGG - Intergenic
1101134641 12:101729841-101729863 GGGATTAATTCCAATTTAGTGGG + Intronic
1101709126 12:107248671-107248693 GGGAGTCATTGGCATAGAGTTGG - Intergenic
1101978883 12:109387974-109387996 GAGATTCTTTGCCATCCAATGGG + Intronic
1104617848 12:130285286-130285308 GGGTTCCACTGGCATCTAGTAGG + Intergenic
1106557013 13:30818523-30818545 GGAATTCATCACCATCTAGATGG - Intergenic
1106916378 13:34519826-34519848 GAGAATGATTGGCATCTAGTGGG - Intergenic
1107136899 13:36954825-36954847 GGGGTTCATGTCCATCTGGTGGG - Intronic
1108997976 13:56759465-56759487 GAGATTCATTAACATCTAATTGG + Intergenic
1110642895 13:77846708-77846730 GGTCTTTATTACCATCTAGTTGG + Intergenic
1119869563 14:78004539-78004561 GGGATTCATTGCATTCTCTTAGG + Intergenic
1127641279 15:60918071-60918093 GGTATGCATTGCCATCAAGTTGG + Intronic
1129460414 15:75697562-75697584 GGGATCCATTGCCAGAGAGTGGG - Intronic
1136083072 16:27865423-27865445 GGGATTCACTGCCACCTGGTGGG + Intronic
1138134874 16:54512816-54512838 GATTTTCATTGCCATCTCGTTGG + Intergenic
1140273926 16:73491781-73491803 GGGTGTCACTGACATCTAGTAGG + Intergenic
1144827571 17:18114923-18114945 GGGAGTCATTGGCATCTAGATGG - Intronic
1150966027 17:69969756-69969778 GGCATTCATAGCCAGCTAGTTGG - Intergenic
1158215958 18:55101143-55101165 GGGGTTCCTTGCTATCTTGTAGG + Intergenic
1162339699 19:10085267-10085289 GGGAACCACTGGCATCTAGTGGG + Intergenic
1162438706 19:10679698-10679720 GGGACTCATAGCCAACCAGTCGG - Intronic
1168624138 19:57903521-57903543 GAAATTAAATGCCATCTAGTGGG + Intronic
931408980 2:62010453-62010475 GGGAGTCATTACCATATAGATGG - Intronic
933351618 2:81159666-81159688 GGGCATCATTGTTATCTAGTAGG - Intergenic
935093217 2:99916907-99916929 GGGATTCCTTGGCATCTCCTTGG + Intronic
935401320 2:102663359-102663381 GATATTTATTGCCATCTACTAGG + Intronic
935411909 2:102772791-102772813 CGGAGTCGTTGCCATGTAGTTGG + Intronic
939100631 2:137891086-137891108 GGTATTTATTGCCATTTAGCTGG - Intergenic
940202491 2:151166859-151166881 GAGAATCATTGCCTTCTGGTTGG - Intergenic
940587250 2:155669033-155669055 TGGATTCATTGCCATCAAGGTGG + Intergenic
944651850 2:201838267-201838289 GGGTATCACTGGCATCTAGTGGG + Intronic
1169645518 20:7805056-7805078 GGGATTCACTGACATATAGAGGG + Intergenic
1171025559 20:21627162-21627184 ATGCTTCATTGCCTTCTAGTTGG - Intergenic
1172935442 20:38616809-38616831 GGGATGCTTTGGCGTCTAGTGGG + Intronic
1181674066 22:24440616-24440638 GGGCATCATTGCCATCTGCTGGG + Exonic
951481437 3:23166367-23166389 GGGAGTTGTTGCCATCTAGATGG - Intergenic
951610423 3:24486133-24486155 GGGAGCTATTGGCATCTAGTGGG + Intronic
958813130 3:98885886-98885908 GGGTGTTATTGGCATCTAGTAGG + Intronic
960700027 3:120430237-120430259 GGGAATCACAGCCATCTGGTAGG + Intronic
960840891 3:121957474-121957496 GGGATGAATAACCATCTAGTGGG + Intergenic
960984631 3:123268035-123268057 GGGATTCATTGCCATCTAGTGGG + Intronic
961234619 3:125355391-125355413 GGGTTCCACTGGCATCTAGTGGG - Intronic
962616128 3:137128446-137128468 TGGACTCAGTGCCATCTAGCTGG + Intergenic
962648483 3:137464127-137464149 AGGCTTCTTTGCCATCCAGTTGG - Intergenic
966293226 3:178385519-178385541 TGGAAACATTGACATCTAGTGGG + Intergenic
966656536 3:182364761-182364783 GGAATTCATTGCGGTCGAGTGGG - Intergenic
967958238 3:194895364-194895386 GGGATTCATAGCAATCTGGATGG - Intergenic
972193826 4:36628188-36628210 TAAATTCATTGCCATCTATTTGG - Intergenic
975885485 4:78959584-78959606 GGGTTTTATTGACATCTAGTGGG + Intergenic
978232382 4:106415677-106415699 GGGAGTCATTGACATATAGATGG + Intergenic
981710928 4:147708284-147708306 GGGATTTAGTGGCATTTAGTAGG - Intergenic
984596694 4:181677047-181677069 CAGATTCATTGACATCTACTTGG + Intergenic
986130803 5:4928218-4928240 GGGTGTTATTGACATCTAGTAGG - Intergenic
988320334 5:29686510-29686532 GGCATTCTTTGAAATCTAGTTGG + Intergenic
995804122 5:116032312-116032334 GTGACTCATTGCCATCCAGTGGG + Intronic
997113431 5:131100362-131100384 AGGTTTTATTGGCATCTAGTGGG - Intergenic
997409267 5:133678720-133678742 GAGAATCATTGCCGTCTAGCTGG + Intergenic
1006370757 6:33642347-33642369 AGGCTAGATTGCCATCTAGTAGG + Intronic
1016961564 6:149677676-149677698 GGAATTCATTGACATATAGATGG + Intronic
1017268177 6:152476131-152476153 CGGAGTCATTGGCATCTAGAGGG - Intronic
1018310616 6:162504369-162504391 GGGCTTCATTGCCACTTATTTGG - Intronic
1020915657 7:14188994-14189016 GGAATTCATTACCATAAAGTTGG + Intronic
1020959194 7:14781059-14781081 GGTACTTATTGCCATCAAGTTGG - Intronic
1022802483 7:33789416-33789438 AGGATTCCTTGGCATATAGTAGG + Intergenic
1025875690 7:65478221-65478243 GGTATTTATTACCATCTCGTTGG - Intergenic
1032990027 7:137383428-137383450 TGCCTTCATTGCTATCTAGTTGG + Intronic
1033405820 7:141071423-141071445 GCGTTTCAGTGCCATCTAGTGGG - Intergenic
1034002601 7:147432248-147432270 GGGGTGCTATGCCATCTAGTGGG - Intronic
1035120081 7:156559621-156559643 GGGCTTTATTGGCATCCAGTGGG - Intergenic
1037530428 8:19767323-19767345 TGCATTCATCGCCATCTTGTTGG - Intergenic
1039770195 8:40678501-40678523 GGGATTCAGTAGCATCTTGTGGG - Intronic
1042267959 8:66927574-66927596 GGCATTCATTGACCTCTACTGGG + Intergenic
1045447868 8:102286090-102286112 GGGTTTCACTGGCATCTAGTGGG + Intronic
1058162531 9:101585384-101585406 GGGAGTCATTGACATCTGGGTGG - Intronic
1186323399 X:8453404-8453426 GGGGTGGATTGGCATCTAGTGGG - Intergenic
1186989582 X:15052951-15052973 GGGTGTCATTGGCATCTTGTGGG - Intergenic
1190450149 X:50571298-50571320 GGGAGTCATTGGCATGTAGACGG + Intergenic
1192205416 X:69092725-69092747 GGGAGTCATTGGCATATAGATGG + Intergenic
1195725631 X:107912705-107912727 GGGAATCATAACCATCTAGATGG - Intronic
1196689400 X:118543333-118543355 GGGATTTATTGCCACCAACTGGG + Intronic
1199675471 X:150185565-150185587 TGCATTCCTTGCCAACTAGTAGG + Intergenic
1199941150 X:152629095-152629117 GGGATTAAGTGCAATCAAGTTGG - Intergenic
1201579481 Y:15495712-15495734 GGGATTCATATCCATGGAGTAGG + Intergenic
1201722698 Y:17118861-17118883 GGGACTCATTGCCATCTTAATGG - Intergenic