ID: 960987979

View in Genome Browser
Species Human (GRCh38)
Location 3:123292734-123292756
Sequence ATCCCTGTGCTTCTTCTCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 212}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960987969_960987979 12 Left 960987969 3:123292699-123292721 CCACGGGAGAAGGCTGGGGGTGG 0: 1
1: 0
2: 3
3: 62
4: 349
Right 960987979 3:123292734-123292756 ATCCCTGTGCTTCTTCTCACAGG 0: 1
1: 0
2: 1
3: 24
4: 212
960987968_960987979 13 Left 960987968 3:123292698-123292720 CCCACGGGAGAAGGCTGGGGGTG 0: 1
1: 0
2: 1
3: 12
4: 171
Right 960987979 3:123292734-123292756 ATCCCTGTGCTTCTTCTCACAGG 0: 1
1: 0
2: 1
3: 24
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960987979 Original CRISPR ATCCCTGTGCTTCTTCTCAC AGG Intronic
901890269 1:12257411-12257433 TTCCCTGTGTTTTTTCTCCCAGG + Intronic
902361491 1:15944693-15944715 GTACCTGTGCGTCTTCTCATGGG + Exonic
906661801 1:47588216-47588238 ATCCCTGCGCCTTATCTCACAGG - Intergenic
912158636 1:106953352-106953374 CTCACTTTGCTTCTTCTCACTGG + Intergenic
915555319 1:156657878-156657900 TGCCCTGTGCCTCTTCTCCCTGG + Intronic
915963984 1:160290645-160290667 ATCTGTGGGATTCTTCTCACAGG + Exonic
917966131 1:180179822-180179844 ACCCCTGTGCCTCCTCTCTCAGG - Intronic
919405038 1:197168964-197168986 ATACCTGTTCTTGTGCTCACTGG - Intronic
920221390 1:204404753-204404775 TTCCGTGTGCTTCCTGTCACAGG - Exonic
921253777 1:213321356-213321378 ATCACAGTGGTTCTTCTCATGGG - Intergenic
921390975 1:214613250-214613272 ATCCCTGTCCATCTTGTCCCAGG + Intronic
922043361 1:221918965-221918987 AACGCTGTGCTTCTTCTAAGAGG - Intergenic
922952175 1:229568311-229568333 GTTCCTGTGCTTCGTCTCCCCGG - Intergenic
924284859 1:242475845-242475867 CTCCCCGTGCCTCTTCTCATGGG - Intronic
1063965754 10:11344633-11344655 GTCCTTGTGCTGCTTCTCAGTGG + Intergenic
1064935153 10:20671093-20671115 ATCACTGAGCAGCTTCTCACTGG + Intergenic
1067103196 10:43348124-43348146 ATCCCTTCCCTTCTCCTCACTGG - Intergenic
1067272306 10:44803069-44803091 CACCCTGTGCTTCTGCCCACTGG + Intergenic
1068402123 10:56542105-56542127 ATCCCTCTGTTTCTTCTCAGAGG + Intergenic
1070608239 10:77914650-77914672 ATCCATGTCCTTCTCCTCCCAGG + Intronic
1071176465 10:82932044-82932066 ATCCCTGTGGTCCTTCCCATGGG - Intronic
1072468966 10:95693996-95694018 ATCCGCGTGCCTCTTCTCATTGG + Exonic
1073777627 10:106803788-106803810 ATTACTGTGCATCTTCTCCCTGG + Intronic
1074010516 10:109474130-109474152 ATCTCTTTGCTTATTTTCACAGG - Intergenic
1075110749 10:119580010-119580032 TTAGCTGTGCTTCTTTTCACAGG - Exonic
1075735762 10:124663809-124663831 TTCCCTGTGCTTCTACCCTCGGG + Intronic
1076883635 10:133251656-133251678 GTCCCTGTCCTCCTGCTCACAGG - Intergenic
1077581481 11:3420092-3420114 ACACCTGTGGTTCTTCTCTCAGG + Intergenic
1084238395 11:67802921-67802943 ACACCTGTGCTTCTTCTCTCAGG + Intergenic
1084834013 11:71789904-71789926 ACACCTGTGCTTCTTCTCTCAGG - Intronic
1085079792 11:73624739-73624761 CTCTCTGTGCTTCCTCACACTGG + Intergenic
1091457300 12:617583-617605 GCTGCTGTGCTTCTTCTCACAGG + Intronic
1092409083 12:8240561-8240583 ACACCTGTGGTTCTTCTCTCAGG + Intergenic
1092970864 12:13693533-13693555 AACCCAGGGCTGCTTCTCACAGG + Intronic
1093876628 12:24356199-24356221 ATCTCTGTGTTTCCTTTCACTGG - Intergenic
1094256663 12:28437708-28437730 AATCCTGTGCCTCTTATCACTGG + Intronic
1095895559 12:47277037-47277059 ATACCTTTCCTTCTTCTCTCTGG - Intergenic
1097011314 12:55955361-55955383 GTGCCTGGGATTCTTCTCACAGG - Exonic
1097535595 12:60866170-60866192 ATCCTTGTTCTTCTAGTCACTGG + Intergenic
1099339591 12:81411320-81411342 ATCTGTGTGCTTTTTCTCTCTGG + Intronic
1099474502 12:83092108-83092130 AGTTGTGTGCTTCTTCTCACTGG + Intronic
1101086686 12:101243407-101243429 ATACATGTGCTTCCTCTGACAGG - Intergenic
1101343797 12:103866285-103866307 ATCCATTTCCTTTTTCTCACAGG + Intergenic
1103142291 12:118559250-118559272 ATTCCTCTGCTTCTTAGCACTGG + Intergenic
1104366731 12:128184752-128184774 GACTCTGTGCCTCTTCTCACAGG - Intergenic
1105204363 13:18207765-18207787 ATGTCTGTGCTATTTCTCACTGG + Intergenic
1105333160 13:19436909-19436931 AGGCCTGTGCTTCTTCTAACTGG - Intronic
1105921299 13:24966189-24966211 AGACCTGTGCTGCTTCTAACTGG - Intergenic
1106365032 13:29070269-29070291 ATCCATGTGTTTCTCCTCTCTGG + Intronic
1107442958 13:40444867-40444889 ATGCATGTGCCTCTTCTCACGGG - Intergenic
1108408902 13:50128502-50128524 AGTTCTGTGCTTCCTCTCACTGG + Intronic
1108567935 13:51719750-51719772 ATTCCTATGGTTCTTCTCCCAGG - Intronic
1108626481 13:52233743-52233765 AGGCCTGTGCTGCTTCTAACTGG - Intergenic
1108659586 13:52572745-52572767 AGGCCTGTGCTGCTTCTAACTGG + Intergenic
1109242558 13:59907690-59907712 CTCCTTGTGGTTCTTGTCACTGG - Intronic
1110115383 13:71808253-71808275 TTTACTGTGCTTCTTCTCAAAGG + Intronic
1112229599 13:97575162-97575184 ATCCCAGATCTTCTACTCACTGG + Intergenic
1112235881 13:97636181-97636203 GTCCCTGTGCATCTGCCCACAGG - Intergenic
1112583277 13:100694805-100694827 TTCCCTCTGCTTCTTCTCCACGG + Intergenic
1114994398 14:28330231-28330253 ATACCTGTCCTTCTTCTGTCTGG + Intergenic
1117188111 14:53262494-53262516 ATCCTTGTGCTGGTTCTCAAGGG + Intergenic
1118020251 14:61705086-61705108 ATTCCTGTGTTTCTTAACACAGG + Intronic
1120926649 14:89803803-89803825 AGCCCGCTGCTTCTTCCCACTGG + Intronic
1121268658 14:92622710-92622732 ATACCTGTGCTTCCTGTCAAAGG - Intronic
1121685303 14:95831190-95831212 ACCCATGTTCTTCTGCTCACAGG - Intergenic
1121803777 14:96797154-96797176 ATCCCCGTCCTTCTGCTCCCTGG - Intergenic
1122178517 14:99938095-99938117 ATCTCTCTGGTTCTTCTCAGTGG - Intronic
1123139716 14:106063043-106063065 GGCCCTGTGCTTCTCGTCACTGG + Intergenic
1124112615 15:26806167-26806189 ATCTCTTTGGTTTTTCTCACTGG + Intronic
1124422650 15:29536211-29536233 ATCCCTGTGTCTCTTCTTAGTGG - Intronic
1125301476 15:38258275-38258297 ATACATGTGTTTCTTCTCAGTGG + Intronic
1126314487 15:47355625-47355647 ATCCATGTGCTTTTTCTCTTAGG + Intronic
1126713929 15:51492508-51492530 ATCCCTGTCAGTCTTCTCCCAGG - Intronic
1131706342 15:95000163-95000185 ATCCCTGCACTTCTACTCTCAGG - Intergenic
1132206462 15:99989229-99989251 ACCCCTGTGCGTCATGTCACTGG - Intronic
1134383466 16:13749595-13749617 ATAACTGTGCTTGTTTTCACTGG - Intergenic
1134797333 16:17053634-17053656 ATGCCTGTGCTTGGTTTCACAGG + Intergenic
1136234475 16:28905424-28905446 ATCCCTCTGCACCTGCTCACTGG + Exonic
1136249077 16:28991868-28991890 ATCCCAGGGCTGCTCCTCACTGG - Intergenic
1138270909 16:55695256-55695278 CTCACTGTGCTTCTTCCCCCAGG + Exonic
1139031843 16:62893536-62893558 ATGCCTGTGATTTTTCTCAGTGG + Intergenic
1142517728 17:443608-443630 GACCCTATGCTGCTTCTCACTGG - Intronic
1143687002 17:8525313-8525335 GTTTCTGTGCTTCTTCTCACTGG + Intronic
1144111455 17:12038540-12038562 ATCCCAGTGCTTCTTATCATTGG - Intronic
1144208299 17:12994502-12994524 ATCCTTGTGCTGCTTCTCCAGGG - Exonic
1145924744 17:28638093-28638115 ATCCGTCTGCTTCTTCTCTAGGG - Exonic
1146024101 17:29304485-29304507 ATCACTGGGGGTCTTCTCACAGG + Intergenic
1146493724 17:33301985-33302007 GTCCATGTCCTTCTCCTCACAGG + Intronic
1147911702 17:43859863-43859885 ATCCCTGTGTTTCTTTTCTTTGG + Intronic
1148143271 17:45343103-45343125 TTCCCTGTCCTGCTTCTGACTGG - Intergenic
1148227697 17:45910434-45910456 ATGCCTGGGCTTCTGCTCCCTGG + Intronic
1149218011 17:54380945-54380967 GGCCCTCTGCTTCATCTCACGGG + Intergenic
1149918468 17:60633917-60633939 ATAACTGTGCTCCTTCTAACAGG - Exonic
1154027372 18:10721328-10721350 ATCCATGTGCTTCATCTATCTGG + Intronic
1154309132 18:13254103-13254125 ATCCCTGGGCTTCCCCTCAGTGG - Intronic
1157943834 18:51956908-51956930 ACCTCTGTGCTTCTTCTTTCTGG - Intergenic
1161238759 19:3210466-3210488 CTCTCCCTGCTTCTTCTCACCGG - Intergenic
1162440422 19:10688795-10688817 ATCCGAGTGCGTGTTCTCACAGG - Intronic
1162524880 19:11201404-11201426 ATCCCTGGGCTTCTCCTCCCTGG + Intronic
1165138587 19:33686036-33686058 AGCTCTGTGTTTGTTCTCACTGG - Intronic
1166201062 19:41238329-41238351 TCCCCTGTGCTTCCTCTCATGGG + Intronic
1167508105 19:49881777-49881799 ATCCCAGAGCTGCTTCTCATTGG + Intronic
1167688575 19:50971325-50971347 ATCCCTCTGCCTCCTCTCTCTGG + Intergenic
1168161365 19:54512553-54512575 ATCTCTGTCTTTCTTCTCTCTGG + Intergenic
925771478 2:7286587-7286609 ATCCCAGAGTTTATTCTCACAGG + Intergenic
927642219 2:24852502-24852524 TGCCCTGTGCTACTCCTCACAGG + Intronic
932091959 2:68813828-68813850 CTCCCTGTCCTTCTTCTCCCTGG - Intronic
934480585 2:94638439-94638461 ATTTCTGTTCTTCTTCTTACGGG + Intergenic
934511626 2:94948760-94948782 AGCCCTGTGCTTCTCATCACCGG + Intergenic
935674297 2:105580981-105581003 ATCCTTCTACTTCTTCTCATTGG + Intergenic
935792047 2:106601724-106601746 GCCCCTGTGGTTGTTCTCACCGG + Intergenic
938094994 2:128455820-128455842 ATCCCTGCACTCCTTCCCACTGG + Intergenic
938595787 2:132785903-132785925 ATCGCTGTGCTTCTTAGCACAGG - Intronic
939069455 2:137521494-137521516 ATCCCTCTTTTTCTTCTCATTGG + Intronic
939849546 2:147288158-147288180 AGAACTGTGCTTCTTCTCATGGG + Intergenic
940691612 2:156926190-156926212 ACCCCTGTGGCTCCTCTCACAGG + Intergenic
942498063 2:176560156-176560178 CTCCCTGTTCTTCCTCACACAGG - Intergenic
942946710 2:181681180-181681202 ATCCCTTGGCTTCTTCTCCTTGG + Intergenic
944131544 2:196352812-196352834 GTCCAAGTGTTTCTTCTCACTGG - Intronic
945132045 2:206584095-206584117 ATCACTGTGGTTCAGCTCACAGG - Intronic
946231067 2:218291672-218291694 CTCCCTCTGCTTCCTCCCACTGG + Intronic
946346964 2:219118643-219118665 ATCCCTGTCCTTCTCTGCACAGG - Intronic
948783564 2:240339638-240339660 GCCCCTCTGCCTCTTCTCACAGG + Intergenic
1170741622 20:19063575-19063597 ATACCTGTATGTCTTCTCACTGG - Intergenic
1173437450 20:43045791-43045813 ATGCGTGTCCTTCTTCTCCCAGG - Intronic
1173760817 20:45558862-45558884 ATCCATGCACTTCTTCTGACAGG + Exonic
1174389397 20:50208458-50208480 ATCCCAGTTCTTCTTCTTTCTGG + Intergenic
1176713615 21:10330321-10330343 ATGTCTGTGCTATTTCTCACTGG - Intergenic
1176739876 21:10591664-10591686 AGGCCTGTGCTTCTTCTAACTGG + Intronic
1180830236 22:18901842-18901864 ATGTCTGTGCTATTTCTCACTGG - Intergenic
1181855298 22:25777287-25777309 ATCCATGAGATTCATCTCACTGG - Intronic
1181988955 22:26822160-26822182 GTCCCTCTGATTCTTCTCTCTGG - Intergenic
1184474364 22:44712505-44712527 TCCCCTGTGCTCCTTCTCCCAGG - Intronic
1184999846 22:48238684-48238706 TTCCTTGTGTCTCTTCTCACAGG + Intergenic
1203280325 22_KI270734v1_random:127113-127135 ATGTCTGTGCTATTTCTCACTGG - Intergenic
949601492 3:5603447-5603469 ATCCCTGAGCTTTTTCTGATTGG - Intergenic
949857635 3:8476640-8476662 ATCCCTGTGGTTCTTCTGGAAGG - Intergenic
951425687 3:22542601-22542623 ATCCTTCTGATTCTTCTCCCTGG + Intergenic
952412150 3:33059031-33059053 ATCCCTGGGCCTCTACCCACTGG - Intronic
953319404 3:41958887-41958909 ATCCCTTTGCTTATTGTCTCTGG - Intronic
956669710 3:71675193-71675215 ATCCCTCTTCTACTTCTTACTGG - Intergenic
956717644 3:72092474-72092496 GTCTCTGTGCTTCTTCTGACAGG - Intergenic
957447001 3:80326044-80326066 AGCCCTGTGGTTGCTCTCACAGG - Intergenic
960383526 3:116992730-116992752 ATCCCTGTATTTCTTTTAACAGG - Intronic
960987979 3:123292734-123292756 ATCCCTGTGCTTCTTCTCACAGG + Intronic
961300494 3:125918985-125919007 ACACCTGTGGTTCTTCTCTCAGG - Intergenic
961816279 3:129552133-129552155 ATCCCTGTGCTCCTCTTTACTGG - Intergenic
962907222 3:139815033-139815055 GTCCCTGTTTTTCTACTCACAGG - Intergenic
964185688 3:153940015-153940037 AGTCCTGAGCTTTTTCTCACTGG - Intergenic
965310375 3:167119427-167119449 ATGCCTTTGCTTCTACTCATAGG - Intergenic
966761458 3:183422874-183422896 ATCCCTGGGACTCTTCACACTGG + Intronic
967888993 3:194351618-194351640 GTCCCTCTGCCTCTGCTCACAGG - Intergenic
968240241 3:197074242-197074264 ATTTCTGTGCTTCATCTCACAGG - Intronic
970472998 4:16395136-16395158 CTTCCTGTGCTTCTTCTGTCTGG + Intergenic
971491415 4:27215973-27215995 ATCCCTGGCCTTGTTATCACAGG + Intergenic
972818317 4:42670067-42670089 CTCCCAGTGCTTCCTCTAACTGG + Intergenic
974387579 4:61222627-61222649 GTCCCTGCCATTCTTCTCACTGG - Intronic
974681461 4:65168975-65168997 ATCACTGTGCTATTTCTCAGTGG + Intergenic
976339612 4:83932459-83932481 ATCCCTGTGGTTTCTCTCACTGG + Intergenic
976776654 4:88713949-88713971 AGCCTTGTTCTTCCTCTCACAGG - Intergenic
977484221 4:97621644-97621666 GGCCCTGAGCTTCTTTTCACTGG - Intronic
978066897 4:104416277-104416299 ATCCCTGTGCTCCTTCACTTAGG + Intergenic
978670796 4:111244893-111244915 ATCACTATACTTCTGCTCACAGG + Intergenic
978727275 4:111984171-111984193 TTCCCTGTGTTTCTTCACACTGG - Intergenic
980553025 4:134365286-134365308 ATCTCTCTGTTTCTTCTCCCTGG - Intergenic
981432519 4:144677733-144677755 CTCCCTGTGCTTCTTAGTACTGG + Intronic
984713578 4:182905616-182905638 CTCTGTGTGCTCCTTCTCACGGG + Intronic
984853742 4:184175553-184175575 ATGGCTGTGCTTCTTCCCAAAGG - Intronic
985303848 4:188517894-188517916 ATTCCTTTTCTACTTCTCACAGG + Intergenic
985698283 5:1355413-1355435 ATCTCTGAGCTTCTTCCCGCAGG + Intergenic
986263519 5:6170987-6171009 ATCCCTGGGCTAAATCTCACTGG - Intergenic
986652775 5:9980696-9980718 AACTTTGTGCTTCTACTCACAGG - Intergenic
987574557 5:19708393-19708415 CTCCATGAGCTACTTCTCACAGG - Intronic
988153390 5:27416530-27416552 AGGCTTGTGCTTCTTCTCATGGG - Intergenic
988633826 5:32959951-32959973 AGCCATGTGCTGCTTGTCACTGG + Intergenic
989223510 5:38997712-38997734 CTCCCTGTGCTTCTTTTTTCAGG - Intronic
990943492 5:61227245-61227267 AACACAGTGCTTCTTTTCACTGG + Intergenic
993817189 5:92564750-92564772 ATCTTTGTGCTTCTTCTTCCAGG - Intergenic
996410319 5:123151744-123151766 CTGCCTGTGCTTTTTCACACAGG + Intronic
999256337 5:150211762-150211784 ATTCAGGTGCTTCTTCCCACGGG + Intronic
999732490 5:154485007-154485029 AACCCTTTCCTTCTGCTCACAGG + Intergenic
1003475538 6:6478682-6478704 CTCTCTGTGCTTCTGCTCAAGGG + Intergenic
1006922004 6:37633401-37633423 ATCCTTGTGTTTTTTCTCGCTGG - Exonic
1006983962 6:38165905-38165927 TTGCCTCTGCTTCTTCTCTCAGG + Intergenic
1007094509 6:39205073-39205095 TGCCCTGGGCTTGTTCTCACAGG - Intronic
1007122876 6:39397913-39397935 ATCTCTGTTTTTCTTCTCTCTGG - Intronic
1009950328 6:70387937-70387959 TGCCCTGTGAGTCTTCTCACTGG + Intergenic
1010214779 6:73392059-73392081 ATCCCTCTGCTTCTACTTTCTGG + Intronic
1013317849 6:108958910-108958932 AACCCTGTGCTTCCACTCACTGG - Intronic
1014911915 6:127104747-127104769 ATCTCTGTGCTTCTGCTCTCTGG + Intergenic
1015974575 6:138776208-138776230 AACCCTGTGCTTTTACTCACTGG - Exonic
1018395317 6:163373872-163373894 GTTCCTGTCCTTCTTCCCACAGG + Intergenic
1020108724 7:5435719-5435741 ACCCCAGTGCCTCTGCTCACAGG + Intronic
1020643157 7:10780288-10780310 GTCCCTGTCCTTCTCCTAACAGG - Intergenic
1022676383 7:32503620-32503642 ATCACTGTGCTCATTGTCACAGG + Intronic
1023590391 7:41775075-41775097 AGCCCTCTGCGCCTTCTCACTGG - Intergenic
1028091124 7:86703051-86703073 TTACCTGTGGTTTTTCTCACTGG + Intronic
1030220231 7:107090697-107090719 ATCCCTGAGCTTCTTCTGTGAGG + Intronic
1031248485 7:119349445-119349467 TTCTCTGTGCTTTTTCTAACTGG + Intergenic
1032410234 7:131689215-131689237 ATCTCTGTTCCTCTTCCCACAGG - Intergenic
1033727176 7:144131296-144131318 ATCTCTGTGCTTGTTTTCACTGG - Intergenic
1034671478 7:152862178-152862200 CACCCTGTACTTCCTCTCACGGG - Intergenic
1036190087 8:6662237-6662259 ATCCCTTTGCTTCTGGTGACAGG - Intergenic
1036849470 8:12191698-12191720 ACACCTGTGCTGCTTCTCTCAGG + Intronic
1036870831 8:12433971-12433993 ACACCTGTGCTGCTTCTCTCAGG + Intronic
1037525406 8:19719608-19719630 ATCCCTGTGTTGTTTCTTACTGG + Intronic
1038417926 8:27410999-27411021 AGACCTTTGCTTCTTCCCACAGG - Intronic
1046379611 8:113434940-113434962 AACCCTGGTCATCTTCTCACAGG + Intronic
1048673569 8:136751170-136751192 AACTCTGTGCTTCTTGTAACTGG + Intergenic
1049327928 8:142033479-142033501 ATCCCTGTGCTCCTTCTGGTGGG + Intergenic
1049584378 8:143426108-143426130 ATCCCTCAGCTCCTCCTCACTGG - Intronic
1050965533 9:11796791-11796813 ATGCCTGGCCTTCTTCTAACTGG - Intergenic
1051171118 9:14318256-14318278 ATGCCAGTGCTTCAGCTCACTGG + Intronic
1053677249 9:40445497-40445519 ATTTCTGTTCTTCTTCTTACAGG - Intergenic
1054286470 9:63179423-63179445 ATTTCTGTTCTTCTTCTTACAGG + Intergenic
1054290322 9:63281024-63281046 ATTTCTGTTCTTCTTCTTACAGG - Intergenic
1054388345 9:64585561-64585583 ATTTCTGTTCTTCTTCTTACAGG - Intergenic
1054507373 9:65930798-65930820 ATTTCTGTTCTTCTTCTTACAGG + Intergenic
1055323495 9:75104646-75104668 CTCCTTGTGTTTCTCCTCACTGG - Intronic
1056634967 9:88324023-88324045 TTTACTGTGGTTCTTCTCACAGG - Intergenic
1056998616 9:91487335-91487357 AGCCCTTTGCTTCTCCTCACTGG - Intergenic
1057746627 9:97757378-97757400 CTCCCTTTGCTTCTTCCCACTGG + Intergenic
1058777851 9:108302814-108302836 TTTCCTGTGCTTCTTCTCACAGG + Intergenic
1058850909 9:109012028-109012050 ATCCCAGTGCCCCTTCCCACTGG + Intronic
1059640261 9:116209870-116209892 ATCCTTGTTCTGCTTCACACTGG - Intronic
1059878103 9:118658613-118658635 ATCACTTTGCTTCTCCTCAATGG - Intergenic
1060156851 9:121326193-121326215 ATCCCTGTGCTTCTATTTAAGGG + Intronic
1060856377 9:126916937-126916959 AGCCCAGTGCCTCTGCTCACTGG + Intronic
1061368490 9:130185055-130185077 AGCCCTCTGCTTCCTCCCACTGG + Intronic
1061545832 9:131303804-131303826 GTCCCTGAGCTTCGTCTCACAGG + Intronic
1185735899 X:2495909-2495931 CTTCCTCTGCTTCTTCACACTGG - Intronic
1187197698 X:17103833-17103855 ATCGCTGTGCTTCTTTGCAAGGG + Intronic
1187621636 X:21062747-21062769 ATTGCTTTGCTTCTTCTCCCGGG - Intergenic
1187727823 X:22222042-22222064 ATCCATGTGCTTCTTTTAAAGGG + Intronic
1190650433 X:52563572-52563594 GTCCCTGTCCTTCTACTAACAGG - Intergenic
1190916924 X:54817799-54817821 ATCACTGGGCTTCTAATCACTGG + Intergenic
1191661695 X:63658230-63658252 ATCCCTTTGCCTGTTCTCCCTGG + Intronic
1196757471 X:119170651-119170673 CTCTTTGTGCTTCTTCTCAGGGG - Intergenic