ID: 960989027

View in Genome Browser
Species Human (GRCh38)
Location 3:123298604-123298626
Sequence GGTGGTGTCGCCTGAGAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 153}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960989027_960989028 -10 Left 960989027 3:123298604-123298626 CCACTTTCTCAGGCGACACCACC 0: 1
1: 0
2: 2
3: 19
4: 153
Right 960989028 3:123298617-123298639 CGACACCACCTTCCCAAGAGAGG 0: 1
1: 0
2: 0
3: 6
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960989027 Original CRISPR GGTGGTGTCGCCTGAGAAAG TGG (reversed) Intronic