ID: 960994537

View in Genome Browser
Species Human (GRCh38)
Location 3:123332275-123332297
Sequence CACCACCCGCTTCCAAGGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 83}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960994528_960994537 11 Left 960994528 3:123332241-123332263 CCCCTGGGGTTTGGGCAGTGTGA 0: 1
1: 0
2: 2
3: 34
4: 255
Right 960994537 3:123332275-123332297 CACCACCCGCTTCCAAGGATGGG 0: 1
1: 0
2: 0
3: 7
4: 83
960994529_960994537 10 Left 960994529 3:123332242-123332264 CCCTGGGGTTTGGGCAGTGTGAC 0: 1
1: 1
2: 0
3: 15
4: 204
Right 960994537 3:123332275-123332297 CACCACCCGCTTCCAAGGATGGG 0: 1
1: 0
2: 0
3: 7
4: 83
960994522_960994537 29 Left 960994522 3:123332223-123332245 CCAGACAAACAGCTTATTCCCCT 0: 1
1: 0
2: 0
3: 13
4: 98
Right 960994537 3:123332275-123332297 CACCACCCGCTTCCAAGGATGGG 0: 1
1: 0
2: 0
3: 7
4: 83
960994521_960994537 30 Left 960994521 3:123332222-123332244 CCCAGACAAACAGCTTATTCCCC 0: 1
1: 0
2: 0
3: 6
4: 115
Right 960994537 3:123332275-123332297 CACCACCCGCTTCCAAGGATGGG 0: 1
1: 0
2: 0
3: 7
4: 83
960994530_960994537 9 Left 960994530 3:123332243-123332265 CCTGGGGTTTGGGCAGTGTGACC 0: 1
1: 0
2: 2
3: 13
4: 145
Right 960994537 3:123332275-123332297 CACCACCCGCTTCCAAGGATGGG 0: 1
1: 0
2: 0
3: 7
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960994537 Original CRISPR CACCACCCGCTTCCAAGGAT GGG Intronic
900519873 1:3100395-3100417 CACCACCCACGGCCAAGGATGGG - Intronic
907074354 1:51565034-51565056 CACCTCCCTCCACCAAGGATTGG + Intergenic
907077649 1:51593022-51593044 CACAATCCTTTTCCAAGGATAGG - Intronic
910772149 1:90841592-90841614 CACCACGCGGTTCCAAGGGCAGG - Intergenic
914705419 1:150166173-150166195 CACCACCTGCTGCCCAGGAAAGG + Intergenic
915064207 1:153211166-153211188 CACCACCCCATTCCCAGGTTGGG + Intergenic
915545340 1:156593865-156593887 CACCACCCTCTTTTCAGGATGGG + Exonic
915584611 1:156837606-156837628 CACCACCTGCTCCCAGGGTTAGG - Intronic
919745532 1:201006194-201006216 GCCCACCCGCTGCCAAGCATAGG - Intronic
920031431 1:203039560-203039582 CCCCACCCACCTCCAAGAATAGG - Intronic
922354912 1:224766493-224766515 CACAACCCGCTGCCAAAGAGGGG - Intergenic
922791121 1:228311678-228311700 CACCACCTGCTGCCTGGGATCGG - Intronic
923346447 1:233057985-233058007 CACCACCTGCTTTCAAGAGTGGG + Intronic
924872463 1:248063746-248063768 CACCACAGGATTCCAAGGAGTGG - Intronic
1067498429 10:46779742-46779764 CACCATCCGCTTGCATGGAGGGG + Intergenic
1067596220 10:47560671-47560693 CACCATCCGCTTGCATGGAGGGG - Intergenic
1070784215 10:79153808-79153830 CACCACCCGCTAGCAAGAACAGG + Intronic
1070863606 10:79692707-79692729 CACCACCTGCTTCCCATGCTGGG + Intergenic
1071616245 10:87079594-87079616 CACCATCCGCTTGCATGGAGGGG + Intronic
1076352419 10:129826147-129826169 CACCACCTGCTCCCCAGGAGGGG - Intergenic
1080777721 11:35401871-35401893 CACCCCCTACTTCCAAGGCTCGG + Intronic
1085328786 11:75629374-75629396 CACCACCCCCTGCCAAGCCTGGG + Intronic
1088549896 11:111002028-111002050 CACAACATGCTTCCAAGGAAGGG + Intergenic
1089352991 11:117831938-117831960 CACCACCAGCTTCCCAGAATGGG + Intronic
1091408473 12:223780-223802 GACCACCCACCTCCAGGGATGGG - Intronic
1098535455 12:71589348-71589370 CACCACCAGCCTCATAGGATTGG + Intergenic
1100661451 12:96703440-96703462 CACCAGCAGCTTCCATGGACAGG - Intronic
1104404568 12:128506736-128506758 CACCACCAGATTCCAAGGTTGGG + Intronic
1104843480 12:131835377-131835399 AACCACCTGCTTCCAAACATTGG + Intronic
1111984751 13:95054633-95054655 CATCAACTGCTTTCAAGGATAGG + Intronic
1114286341 14:21247659-21247681 CACCACACCCAGCCAAGGATAGG - Intronic
1116523342 14:45875167-45875189 CACCACCTGCTTATAAGGAGTGG - Intergenic
1119426223 14:74536057-74536079 CTGCACCCGCTTCCCAGCATGGG - Intronic
1119786780 14:77320453-77320475 CGCCACCCGCTTCCACCGCTTGG - Exonic
1121576844 14:94995754-94995776 CATCTTCCGCTGCCAAGGATCGG + Intergenic
1126100340 15:45114904-45114926 AAGCACCCCTTTCCAAGGATAGG + Intronic
1128594257 15:68930116-68930138 CCCCACCCGCTTCCGGGGGTGGG + Intronic
1130683784 15:86019610-86019632 CACCACTCCCTTAAAAGGATGGG + Intergenic
1131306272 15:91246618-91246640 CTCCTCCCTCTTCCAAGGAGGGG + Intronic
1133832735 16:9339075-9339097 CTCCAGCCTCTTCCAAGGAGGGG + Intergenic
1137266243 16:46871324-46871346 CACCACACCCAGCCAAGGATAGG - Intergenic
1138066459 16:53946529-53946551 CAAAACGCCCTTCCAAGGATTGG - Intronic
1141648091 16:85378098-85378120 CACCACCCGGTGCCAGGGCTCGG + Intergenic
1154171615 18:12056844-12056866 CAGAACCCGCTCCCCAGGATTGG + Intergenic
1154253628 18:12765139-12765161 CTGCACCCGCTTCCAAGAAGGGG + Intergenic
1161253956 19:3295885-3295907 CACCACCCCCTCCCAAGGCCAGG + Intronic
1161508943 19:4659877-4659899 CGCCACCCCCATCCAAGGGTGGG - Intronic
1163513628 19:17750020-17750042 CACCACTCGATTCCCAGGATGGG + Intronic
1164550852 19:29211403-29211425 CACCTCCAGGTCCCAAGGATGGG + Intronic
1165546695 19:36543491-36543513 CACCACCCAGTTCCAAAGCTTGG + Intronic
1165827075 19:38711591-38711613 CACCACCCACCTCCCAGGGTGGG - Intronic
1167650793 19:50727600-50727622 AAACACCCACTTCCAAGAATTGG + Intergenic
928325094 2:30313101-30313123 CAACAGCTGCTTCCAAGGACAGG + Intronic
929529956 2:42743758-42743780 CACCACCCATTTCCCAGGGTTGG - Intronic
936713811 2:115162091-115162113 CGCCTCCCGCTTCCCAGGCTGGG + Intronic
938048552 2:128145937-128145959 CACCACCTTCTTCCAAAGAGCGG + Exonic
938188233 2:129252346-129252368 CACGACCTGCTTCTCAGGATAGG + Intergenic
945323194 2:208451140-208451162 CACTACCTGATTCCTAGGATAGG + Intronic
946922365 2:224593040-224593062 CACCACCCCCGACCAAAGATGGG + Intergenic
1173675943 20:44835804-44835826 CACCACCTGCTTCCCAGGAAGGG + Intergenic
1175800246 20:61797251-61797273 CACCAGCCACTGCCCAGGATGGG + Intronic
1175854417 20:62112710-62112732 CTCCACCCCCTTCCTTGGATGGG - Intergenic
949351379 3:3127408-3127430 CTCCACCCGCTTCCGTGGAATGG + Intronic
951406248 3:22302225-22302247 AACCACCAGCTACCTAGGATGGG + Intronic
953349783 3:42206871-42206893 CCTCACCCGCTCCCAAGGATGGG - Intronic
960994537 3:123332275-123332297 CACCACCCGCTTCCAAGGATGGG + Intronic
962379693 3:134888080-134888102 CGCCACCCGTTTTCAAGGACAGG - Intronic
969244944 4:5925806-5925828 CATCCCCCGCTGCCAAGGGTGGG - Intronic
969601099 4:8176856-8176878 AACCAACCCCTTCCATGGATGGG - Intergenic
972757716 4:42066242-42066264 CACAACCTGCTTCAAAAGATTGG + Intronic
972921680 4:43950223-43950245 CACCACCCTCTTCCAGTTATAGG - Intergenic
980480806 4:133385209-133385231 CCCCGCCCCCTTCCAAGGAGGGG + Intergenic
986132202 5:4942232-4942254 CAGCACCCGCTTCCTCGGCTGGG + Intergenic
992456598 5:76922162-76922184 CTCCACCCCCTCCCAAGCATAGG + Intergenic
997251173 5:132389765-132389787 AGTCACCCGCTTCCAAGGAATGG + Intronic
1002280391 5:178126512-178126534 CACCACCAATTTCCTAGGATAGG - Intergenic
1003503182 6:6719040-6719062 CACCACCCCTTTCCGAGGCTTGG + Intergenic
1003639850 6:7867487-7867509 CACCATTGGCTTCCATGGATTGG + Intronic
1011802754 6:91036418-91036440 CCCCACCTTCTCCCAAGGATGGG - Intergenic
1016363319 6:143290930-143290952 CCCCACCCTCTTCCCAAGATGGG + Intronic
1019630435 7:2046127-2046149 CACCACCCGCATCCCAGGAGAGG - Intronic
1027125853 7:75556244-75556266 CACCACCGGGTTGCAAGGACTGG + Intronic
1030727012 7:112938848-112938870 CACCCTCGGCTTCCATGGATGGG - Intronic
1045250708 8:100481396-100481418 CACCACCCGCATCCTGGCATTGG - Intergenic
1049470323 8:142772438-142772460 CACCTCCCCCTTCCCAGGCTTGG + Intronic
1056931446 9:90881092-90881114 GGCCACCAGCTTCAAAGGATGGG + Intronic
1060426458 9:123510715-123510737 TACCCACTGCTTCCAAGGATAGG + Intronic
1060925475 9:127452352-127452374 CCCCACCTGCCTGCAAGGATGGG - Intronic
1185954680 X:4476798-4476820 CATCAACCTCTTCCAGGGATGGG + Intergenic
1195573207 X:106420046-106420068 GACCACCCTCTTCCCAGGAAAGG + Intergenic
1196375377 X:115027261-115027283 CACCACCCTCATCCAGGGAAGGG - Intergenic