ID: 960995160

View in Genome Browser
Species Human (GRCh38)
Location 3:123335822-123335844
Sequence GGGGAAACAGCAGTGGTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 554
Summary {0: 1, 1: 0, 2: 2, 3: 47, 4: 504}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960995160_960995166 -5 Left 960995160 3:123335822-123335844 CCCCCAACCACTGCTGTTTCCCC 0: 1
1: 0
2: 2
3: 47
4: 504
Right 960995166 3:123335840-123335862 TCCCCAAATCCTGGCTCCTCTGG 0: 1
1: 0
2: 6
3: 39
4: 314
960995160_960995173 18 Left 960995160 3:123335822-123335844 CCCCCAACCACTGCTGTTTCCCC 0: 1
1: 0
2: 2
3: 47
4: 504
Right 960995173 3:123335863-123335885 CCACTTCAATAGAACAACCAAGG 0: 1
1: 0
2: 1
3: 9
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960995160 Original CRISPR GGGGAAACAGCAGTGGTTGG GGG (reversed) Intronic
900149301 1:1171214-1171236 GGGGAGGCTGCAGGGGTTGGGGG + Intergenic
900783635 1:4633881-4633903 GAGGAAACATCAGGGGCTGGGGG + Intergenic
900843388 1:5076297-5076319 GAGGAAACATCAGGGGTAGGGGG - Intergenic
900988855 1:6088772-6088794 GGGGCAGCAGCAGGGGGTGGGGG - Intronic
901152618 1:7113997-7114019 TGGGTTACAGCAGTGGTGGGAGG - Intronic
901376659 1:8844511-8844533 GAAGAAAAAGCAGTGGTTGGAGG + Intergenic
901420900 1:9150423-9150445 GGAGAAGCAGCAGAGGCTGGGGG + Intergenic
902862752 1:19257806-19257828 GGGAAAAGAGAAGTGGTAGGAGG - Intronic
903154568 1:21435267-21435289 GGGGGAACAGCAGAGGTGAGTGG - Intergenic
903404121 1:23082135-23082157 GGTGGAAAAGCAGTGGTGGGTGG - Intronic
903665607 1:25005693-25005715 GGGGAAGCAGTAGAGGGTGGTGG - Intergenic
903784064 1:25845517-25845539 GGGGAATCAGGAATGCTTGGTGG - Intronic
903865209 1:26392776-26392798 GGGTAAAAAGAAGTGGGTGGGGG + Intergenic
904029121 1:27523062-27523084 GGGGAGGCAGCAGTGGAAGGTGG - Intergenic
904601406 1:31674634-31674656 GGTGAAAGTGCAGTGGTGGGGGG - Intronic
905461691 1:38126527-38126549 GGGGACCCAGCAGGGGTGGGCGG - Intergenic
905856815 1:41319942-41319964 TGGGGAACAGCAGTGCCTGGAGG - Intergenic
906478501 1:46185590-46185612 TGGCAAGCAGCAGTGATTGGGGG + Exonic
907179006 1:52553346-52553368 GGGGAAACAGCACTGGGGGGAGG + Intronic
907506075 1:54919145-54919167 CGGCAAACAGCAGTGGTGGACGG + Intergenic
907602277 1:55783545-55783567 CGGCAAACAGCAGTGGTGGATGG + Intergenic
908487764 1:64611755-64611777 GGGTAACCAGCAGAGATTGGAGG - Intronic
910590511 1:88924646-88924668 CGGCAAACAGCAGTGGTAGACGG - Intergenic
911399540 1:97358009-97358031 TGGGAAGCACAAGTGGTTGGGGG + Intronic
912690914 1:111804138-111804160 TGGGCAGCAGCAGGGGTTGGGGG - Intronic
913233804 1:116763487-116763509 GGGGAAACAGGAGGGGTTCTAGG - Intronic
914044382 1:144078232-144078254 GGGGAAAAAGCCGTGGTGGCAGG - Intergenic
914133728 1:144882455-144882477 GGGGAAAAAGCCGTGGTGGCAGG + Intergenic
914399945 1:147309427-147309449 TGGGACACAGCAGTGTTTAGAGG + Intergenic
914719672 1:150279577-150279599 GGGGACAGAGAAGTGGTAGGAGG + Intronic
914887012 1:151593828-151593850 GGGGAAGCAGAAGCGGTTTGGGG + Intergenic
914904766 1:151734824-151734846 GGAGAAAGGGCAGTCGTTGGAGG + Intergenic
915417893 1:155756431-155756453 GGGAAAACTGCAGTTGTTGCAGG - Intronic
915549342 1:156623638-156623660 GGGGAAAGGGCAGTTGTTGCAGG + Intronic
915990524 1:160511730-160511752 CTAGAAACAGCTGTGGTTGGAGG + Intronic
917403535 1:174678931-174678953 TGGCAAACAGCAGTGGTGGATGG + Intronic
917682853 1:177385219-177385241 TTAGAAACAGCTGTGGTTGGGGG - Intergenic
917724021 1:177812763-177812785 TGGCAAACAGCAGTGGTGGACGG - Intergenic
919082780 1:192886797-192886819 TGGCAAACAGCAGTGGTGGATGG + Intergenic
920029700 1:203029073-203029095 GGGGAAACAGCAGTGGGGGAAGG + Intronic
920131838 1:203738120-203738142 GGGGAAACTGTTGAGGTTGGAGG - Intronic
920131944 1:203738856-203738878 GGGGACACAGTGGTGGTTGTGGG + Intronic
920639855 1:207741518-207741540 CGGCAAACAGCAGTGGTGGACGG + Intergenic
921153324 1:212418717-212418739 GGGGCCACAGGAGTGATTGGTGG + Intergenic
922541487 1:226423647-226423669 TGGGAAATAGCAGTGCTTGGGGG + Intergenic
922876304 1:228942512-228942534 CGGCAAACAGCAGTGGTGGACGG - Intergenic
922877767 1:228953890-228953912 CGGCAAACAGCAGTGGTGGATGG - Intergenic
922989689 1:229895895-229895917 GGGGAATCACCAGAGGTTTGGGG - Intergenic
923525626 1:234770354-234770376 GGGGAATCAGCAGAGGGTGAGGG - Intergenic
924009310 1:239647230-239647252 GGTGAAACTGCAGTGGGTTGAGG - Intronic
924050116 1:240071985-240072007 AGGGACACAGGACTGGTTGGTGG + Intronic
924256155 1:242184962-242184984 GGAGAAACAGCAGGAATTGGGGG - Intronic
1063522356 10:6752433-6752455 GCAGAAAAAGCAGAGGTTGGAGG + Intergenic
1064254330 10:13731278-13731300 GGGGAAACATCATTGGGTGAAGG + Intronic
1064661382 10:17611349-17611371 GGGGAAACAGCATGAGTTAGAGG - Intronic
1064682457 10:17824828-17824850 GGGGAAACAGAAAGGGTAGGGGG - Intronic
1065019632 10:21494058-21494080 GGGGAAAAAGCAGAAGTTGCTGG - Exonic
1065805250 10:29388140-29388162 GGGAAAAAAGCAGTGGTTCCTGG - Intergenic
1066950314 10:42111218-42111240 GGGGAAAAAGCCGTGGTGGCAGG + Intergenic
1067464737 10:46489379-46489401 GGAGAACCAGGAGTGTTTGGAGG - Intergenic
1067622457 10:47895274-47895296 GGAGAACCAGGAGTGCTTGGAGG + Intergenic
1067661025 10:48236312-48236334 GGGAAAACAGCAGCAGTGGGAGG + Intronic
1068791298 10:61034052-61034074 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068792074 10:61039517-61039539 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1069842019 10:71345843-71345865 GGGGAGACAGCCGTGGTGGGGGG + Intronic
1070288023 10:75097896-75097918 GTGGACACCGCAGTGGCTGGAGG + Intronic
1070827384 10:79399142-79399164 GGGGTAAAGGCAGTGGATGGAGG + Intronic
1071066756 10:81644902-81644924 TGGGAAACACAAGGGGTTGGGGG - Intergenic
1071326730 10:84525734-84525756 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1071331542 10:84565570-84565592 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1072378564 10:94841392-94841414 TGGCAAACAGCAGTGGTGGACGG + Intronic
1072472439 10:95724729-95724751 TGGCAAACAGCAGTGGTGGATGG + Intronic
1072633760 10:97164441-97164463 TGGGAAGCGGCAGAGGTTGGGGG + Intronic
1072650305 10:97290219-97290241 CGGCAAACAGCAGTGGTAGAGGG - Intronic
1073733099 10:106314427-106314449 AGGGAAACAGCAGACCTTGGTGG + Intergenic
1073859462 10:107721161-107721183 GGGGAAACAGCAGCACCTGGGGG - Intergenic
1075010547 10:118866131-118866153 GGGGAATCGGCAGGGGGTGGTGG - Intergenic
1075554506 10:123420664-123420686 GGGGAAACATCGGGGGTCGGGGG + Intergenic
1075571211 10:123547585-123547607 GAGAAAGCAGGAGTGGTTGGGGG + Intergenic
1075860954 10:125675800-125675822 CTAGAAACAGCTGTGGTTGGAGG - Intronic
1076168999 10:128304609-128304631 GGGCCACCAGCAGTGGATGGAGG - Intergenic
1076310250 10:129501170-129501192 CTGGAAACGGCAGTGGCTGGAGG + Intronic
1076424293 10:130356594-130356616 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1076519524 10:131072415-131072437 AGGGGAACAGCTGTGGATGGTGG - Intergenic
1076703111 10:132284346-132284368 GGGGGAACAGGTGAGGTTGGGGG + Intronic
1076870048 10:133188689-133188711 GGTGGAACAGCAGTGGGGGGTGG - Intronic
1077284157 11:1758491-1758513 GGGGGAGCAGCAGTGGCTGTTGG - Intronic
1078105114 11:8353596-8353618 GGGGAAAGAGGAGGGGGTGGTGG - Intergenic
1078970305 11:16402679-16402701 GGTGAAACAGGAGTGGGTGGAGG - Intronic
1079647895 11:22890545-22890567 AGGGAAACAGGAGTTGTTGATGG + Intergenic
1079678730 11:23265149-23265171 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1081712071 11:45223813-45223835 GGGGAAGCTGCAAAGGTTGGGGG + Intronic
1083546705 11:63554152-63554174 GGGGAAACAACACGGGGTGGGGG + Intronic
1083879572 11:65541355-65541377 GGGGAAAGACCTGTGGTGGGTGG - Intronic
1084878722 11:72154300-72154322 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1084959185 11:72707331-72707353 AGAGAAGGAGCAGTGGTTGGAGG - Exonic
1085571065 11:77558515-77558537 GGGGAAACTGCTGGGGGTGGTGG - Intronic
1085621569 11:78041702-78041724 TGGCAAACAGCAGTGGTGGATGG - Intronic
1086672720 11:89567322-89567344 GGGGGCAAAGCAGTGGTAGGAGG - Intergenic
1087181451 11:95146264-95146286 GGGCAAATTGCAATGGTTGGTGG - Intergenic
1088246456 11:107822586-107822608 GGGGAAAGAACAGTGTGTGGTGG - Intronic
1088425093 11:109693628-109693650 TGGGCACCAGCAGTGGTGGGTGG - Intergenic
1088969010 11:114754853-114754875 CAGGGAATAGCAGTGGTTGGTGG + Intergenic
1088993093 11:114971522-114971544 GGGGAGACAGTAGTGGTAGACGG - Intergenic
1089176561 11:116552797-116552819 GGGGAGACAGTTCTGGTTGGAGG - Intergenic
1090229029 11:125088678-125088700 GGAGGAACAGCAGTGATGGGCGG - Exonic
1090336389 11:125970492-125970514 GTGGAAACAGCAGAGGTGAGTGG - Intronic
1091673831 12:2473119-2473141 GGGGAAAAAGCAGTGTCAGGAGG - Intronic
1093106666 12:15095461-15095483 TGGCAAACAGCAGTGGTGGACGG + Intergenic
1093780552 12:23132052-23132074 GGAGAAACATAAGTGGTTAGAGG - Intergenic
1093935220 12:24993719-24993741 AGGGAAACAGCATGGGGTGGTGG + Exonic
1094640992 12:32275642-32275664 TGGCAAACAGCAGTGGTGGACGG - Intronic
1095552470 12:43459166-43459188 CAGCAAACAGCAGTGGTAGGCGG - Intronic
1096351238 12:50902861-50902883 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1096860988 12:54527961-54527983 TGGAAAAGAGCAGTGGTTGAGGG + Intronic
1097243422 12:57591595-57591617 GGGGGAACACCTGGGGTTGGTGG - Intronic
1097376748 12:58852228-58852250 CAGCAAACAGCAGTGGTGGGCGG + Intergenic
1097377757 12:58859357-58859379 CAGCAAACAGCAGTGGTGGGCGG + Intergenic
1099292613 12:80790072-80790094 GGCAAAACAGCAGTGGTGGATGG - Intergenic
1099734564 12:86550957-86550979 GGGGAAACAGCCGTGCCTGTGGG + Intronic
1101086643 12:101243006-101243028 AGGGAAAAAGCAGGGGGTGGAGG + Intergenic
1101225711 12:102686319-102686341 GGGGAAAGGGCAGTGGTGGTAGG - Intergenic
1101276444 12:103206971-103206993 AGGGAAACAGAACTGGTTGGAGG - Intergenic
1102576992 12:113861879-113861901 GAGGTCACAGCTGTGGTTGGGGG + Intronic
1102660534 12:114523650-114523672 AGGGAAACAGAAGTGGTTCTGGG + Intergenic
1102663228 12:114547663-114547685 GGAGAAAGAGAAGTGGTAGGAGG + Intergenic
1103168221 12:118789290-118789312 CAGGAAACAGCAGTGGGTGATGG - Intergenic
1103948571 12:124540200-124540222 GGCGACCCAGCAGTGGTGGGAGG + Intronic
1104211126 12:126689718-126689740 GGAGGAACAGCAGTGGCTGGAGG + Intergenic
1107732150 13:43359080-43359102 GGGAAAACAGTAGCGGGTGGGGG - Intronic
1108342313 13:49509975-49509997 GGTGAAACCTCAGTGGTTTGAGG - Intronic
1108781693 13:53844031-53844053 GGGAAAAAAAAAGTGGTTGGGGG - Intergenic
1108876192 13:55054003-55054025 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1108877212 13:55061318-55061340 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1109680720 13:65748471-65748493 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1110125264 13:71934262-71934284 GGCCAAACAGTAGTGGTGGGAGG + Intergenic
1110464989 13:75790216-75790238 GGGGACAGGGCAGTGGCTGGAGG - Intronic
1111021439 13:82457681-82457703 AGGCAAACAGCAGTGGTGGATGG - Intergenic
1111243116 13:85501786-85501808 GGGGCCACAGGAGTGGTTGGTGG - Intergenic
1111820395 13:93206892-93206914 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1112297653 13:98202375-98202397 TGGGGCACAGAAGTGGTTGGAGG + Intronic
1112482084 13:99785505-99785527 GGGGAAACAATAATGGTTGGGGG - Intronic
1113570704 13:111354792-111354814 GGGGAAAAATCAGTGGTTGCAGG + Intergenic
1114383847 14:22236732-22236754 TGGCAAACAGCAGTGGTGGATGG - Intergenic
1114562309 14:23602240-23602262 GGAGACACAGTAGTGGTTGAAGG - Intergenic
1114602584 14:23968827-23968849 GGGGAAACAGTGGTGGTGGGTGG + Exonic
1114606953 14:24005956-24005978 GGGGAAACAGTGGTGGTGGGTGG + Exonic
1114612262 14:24050924-24050946 GGGGAAACAGTGATGGTGGGTGG + Intergenic
1117171807 14:53108124-53108146 TGGCAAACAGCAGTGGTGGATGG - Intronic
1118003773 14:61547102-61547124 TTCGAAACAGCAGTGGTGGGGGG + Intronic
1118871384 14:69745766-69745788 GGCGACAGAGCAGTGGCTGGGGG + Intronic
1119089946 14:71772217-71772239 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1120397381 14:83985581-83985603 GCGCAAACAGCAGTGGTGGATGG - Intergenic
1121904202 14:97724573-97724595 GAGGAAACAGCATTGCTTGGGGG + Intergenic
1121985658 14:98502857-98502879 GGAGAGACAGCAGGGGCTGGTGG + Intergenic
1122456131 14:101853057-101853079 GGGGAAACAAAAATGGGTGGAGG - Intronic
1122546340 14:102524728-102524750 GGGGAAGTAGCTGTGGCTGGCGG - Intergenic
1122919991 14:104876050-104876072 GGGGCAGCAGCAGAGGGTGGGGG + Intronic
1122969666 14:105147462-105147484 GGGGCCACAGCAGGGGTGGGTGG - Intronic
1123125452 14:105942865-105942887 GGGCAAACAGCAGTGGTGGACGG - Intergenic
1124076813 15:26454004-26454026 GGGTATATAGCAGTGCTTGGTGG - Intergenic
1124689757 15:31812071-31812093 GTGGAAGCAGCAGGGGTTGAGGG + Intronic
1124829535 15:33134547-33134569 GGGGAAACAGTAGTCGATTGGGG + Intronic
1126814204 15:52438858-52438880 TGGCAAACAGCAGTGGTGGACGG - Intronic
1127057789 15:55150292-55150314 GGGGAAACAGAAGTGTATAGGGG - Intergenic
1128320700 15:66691861-66691883 GGGAAAACATCAGTTGTAGGAGG - Intergenic
1128363113 15:66976484-66976506 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1129776379 15:78239329-78239351 CGGCAAACAGCAGTGGTGGACGG + Intronic
1130042429 15:80415994-80416016 GGGGACACAGCAGTGGAGAGTGG - Intronic
1130053899 15:80506428-80506450 AAGGAAACATCAGAGGTTGGGGG + Intronic
1131673844 15:94651138-94651160 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1132362737 15:101231111-101231133 GGGGTAACAGCAGCCCTTGGAGG + Intronic
1132929589 16:2452017-2452039 GGAGAAGCAGCAGCGGCTGGTGG - Intronic
1133274109 16:4626183-4626205 GGGGAACCAGCACAGTTTGGGGG + Intronic
1133387642 16:5383197-5383219 GGGGAAACAGGAGGAGTAGGGGG + Intergenic
1134203388 16:12217318-12217340 GCAGAAACAGCAGGTGTTGGGGG - Intronic
1134839601 16:17391289-17391311 GAGGACACAGTACTGGTTGGTGG - Intronic
1136580698 16:31149318-31149340 GGGCAAACTGAAGTGGGTGGAGG - Intronic
1136683620 16:31981828-31981850 GGGGGAACAGGAGTGGTGAGAGG - Intergenic
1136784249 16:32925388-32925410 GGGGAAACAGGAGTGGTGAGAGG - Intergenic
1136885535 16:33928418-33928440 GGGGAAACAGGAGTGGTGAGAGG + Intergenic
1137560673 16:49500195-49500217 GGAGAAACAGCAGCAGTAGGTGG - Intronic
1138893998 16:61180877-61180899 AGGGAAACAGGAGAGGTCGGGGG - Intergenic
1139850652 16:69950176-69950198 GGGGAAACACCAGTGGAATGTGG - Intergenic
1139879637 16:70173088-70173110 GGGGAAACACCAGTGGAATGTGG - Intergenic
1140033051 16:71353786-71353808 GGTGAAATAGCAGTAGCTGGGGG - Intergenic
1140372889 16:74422460-74422482 GGGGAAACACCAGTGGAATGTGG + Intergenic
1141272079 16:82550118-82550140 GAGGAAAAAGCAGGGGTTTGGGG + Intergenic
1141471523 16:84241801-84241823 GGGGAGACAGCTGGGGTAGGAGG - Intergenic
1142148314 16:88501843-88501865 TGGCAAACAGCAGTGGCAGGAGG - Intronic
1142153152 16:88521526-88521548 GAGGGAACAGCACGGGTTGGGGG - Intronic
1142153193 16:88521667-88521689 GAGGGAACAGCACGGGTTGGGGG - Intronic
1203086906 16_KI270728v1_random:1189394-1189416 GGGGAAACAGGAGTGGTGAGAGG - Intergenic
1143280672 17:5751993-5752015 GGGGAGCAAGCAGGGGTTGGTGG + Intergenic
1143967352 17:10766030-10766052 GGCGGATCACCAGTGGTTGGGGG - Intergenic
1145877836 17:28333259-28333281 AGGGAAACAGCTGAGGCTGGGGG - Intronic
1146137993 17:30340114-30340136 GGGGAAAGGGCATTGGTTGTGGG - Intergenic
1146318537 17:31828197-31828219 GAGGAAACAGGAGTGTTTGATGG + Intergenic
1147420388 17:40319530-40319552 GGGTAAGCAGCAGGGGGTGGGGG - Intronic
1148549962 17:48544452-48544474 GGAGAAAAAGCAGTGGAAGGAGG - Intronic
1149243112 17:54673775-54673797 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1149254215 17:54806691-54806713 GAGGAAACAACAGGGGTAGGAGG - Intergenic
1149467229 17:56889736-56889758 TGGGAAACAGCTGGGCTTGGAGG - Exonic
1151224445 17:72638348-72638370 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1151517734 17:74607042-74607064 GTTGAATCAGGAGTGGTTGGTGG - Intergenic
1152217706 17:79044061-79044083 GGGGGAACAGCAGGAGTGGGAGG + Exonic
1152577980 17:81151293-81151315 GGGGAGACAGGAGGGGTCGGTGG - Intronic
1152623927 17:81379802-81379824 GGGTGAACAGCAGTGGAGGGTGG + Intergenic
1153289203 18:3483760-3483782 GAGGAAGCAGCAGTGATTTGAGG + Intergenic
1153297076 18:3557188-3557210 GAGGCAAAAGCAGTGGTTAGAGG - Intronic
1153402050 18:4692000-4692022 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1156610798 18:38721806-38721828 GGGGAAAAAGCAGTGTCAGGAGG - Intergenic
1157259332 18:46165103-46165125 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1157428099 18:47601398-47601420 GTGGACACAGCAGTGGTTTAGGG - Intergenic
1157497319 18:48165606-48165628 GTGGAAGGAGCAGAGGTTGGGGG - Intronic
1158152293 18:54386967-54386989 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158868607 18:61662195-61662217 AGGCCAACAGGAGTGGTTGGTGG - Intergenic
1160292026 18:77603674-77603696 GCGGAGACAGCAGTGTGTGGGGG - Intergenic
1160771759 19:835225-835247 GGGGGAGCAGCAGGGGCTGGGGG - Intergenic
1161127495 19:2566560-2566582 GGGGCCACAGCAATGGTCGGGGG + Intronic
1161589216 19:5121236-5121258 GGGGAAAGAGCAGAGGCCGGGGG + Intronic
1161700735 19:5793646-5793668 GGGGGCACAGCAGGGCTTGGTGG - Intergenic
1161976070 19:7608223-7608245 GGGACAATAGCAGTGGATGGTGG - Exonic
1163901126 19:20101075-20101097 CGGCAAACAGCAGTGGTCGACGG - Intronic
1164731638 19:30509833-30509855 GGGGAAGAAGCAGAAGTTGGTGG + Intronic
1165131758 19:33636956-33636978 GGGCAACCAGCAGTGGTTGGGGG - Intronic
1165734851 19:38169736-38169758 GGGGACACAGCGGTGACTGGGGG + Intronic
1165843484 19:38803490-38803512 GGGGAAACAGAGATGGATGGTGG - Intronic
1165857651 19:38889644-38889666 GGCGAAACAGGAAGGGTTGGGGG - Intronic
1165901179 19:39170010-39170032 CGGGAGACAGCAGAGCTTGGAGG - Intronic
1166198235 19:41220270-41220292 GGGGAAGAATCAGGGGTTGGGGG - Intronic
1167576490 19:50320334-50320356 GGGGGAGCACCAGTGGCTGGGGG + Exonic
1168086384 19:54050639-54050661 GGGGAAACTGCTGTGTTTTGGGG - Intronic
1168147019 19:54425248-54425270 CGGCAAACAGCAGTGGTGGACGG + Intronic
1202683932 1_KI270712v1_random:31623-31645 GGGGAAAAAGCCGTGGTGGCAGG - Intergenic
925245350 2:2377701-2377723 AGGGAAACAGAAGGGGTGGGAGG + Intergenic
925510731 2:4622297-4622319 GTGGAAACTTCAGTGGCTGGTGG - Intergenic
925633868 2:5923422-5923444 TGGACAACAGCTGTGGTTGGGGG - Intergenic
925670309 2:6303814-6303836 GGACAGACTGCAGTGGTTGGGGG + Intergenic
926130171 2:10297995-10298017 GGGGAAAGAGCGGGGGTGGGGGG + Intergenic
926864982 2:17346308-17346330 GGCAAAACAGCAGTGGTAGATGG - Intergenic
927640187 2:24841113-24841135 TGGGACACAGCACTGGTTGATGG - Intronic
928249171 2:29659910-29659932 GGAGAAACAGCAGAGCTGGGAGG - Intronic
928451639 2:31383370-31383392 GAGGAAAGAGCATTGGTTGTAGG - Intronic
928676629 2:33657541-33657563 CGGCAAACAGCAGTGGTAGATGG - Intergenic
929542353 2:42832094-42832116 CGGCAAACAGCAGTGGTGGACGG - Intergenic
930235416 2:48884557-48884579 GGAGAAGGAGCAGAGGTTGGGGG - Intergenic
931038980 2:58275750-58275772 CGGCAAACAGCAGTGGTGGACGG - Intergenic
931289787 2:60862308-60862330 GAGGAAACAGGAGTGCATGGGGG + Intergenic
932792901 2:74671400-74671422 GGGGAAGCAGCAGAGAGTGGGGG - Intronic
932907516 2:75769468-75769490 GGGGAAACAGAAGGACTTGGAGG + Intergenic
932917171 2:75872053-75872075 CGGCAAACAGCAGTGGTGGATGG - Intergenic
932918178 2:75879091-75879113 CGGCAAACAGCAGTGGTAGACGG - Intergenic
933856558 2:86419876-86419898 GGGACAACAGCAGAAGTTGGGGG - Intergenic
935500331 2:103831061-103831083 ATAGAAACAGCAGAGGTTGGTGG + Intergenic
936077242 2:109409393-109409415 CTGGAGACAGCAGTGGATGGTGG + Intronic
939006227 2:136790868-136790890 GGGGAAACAGCGGGAGTTGATGG + Intronic
939055525 2:137360422-137360444 TGGGAAGCAGGAGGGGTTGGGGG + Intronic
939134088 2:138273520-138273542 CGGCAAACAGCAGTGGTGGACGG + Intergenic
939444101 2:142286839-142286861 GGAGCAACAGCAGGGGTTAGAGG + Intergenic
940012929 2:149073641-149073663 GGAGACACAGCAGTGGTAGGAGG - Intronic
940323533 2:152401515-152401537 GGGGAAGGAGAAGTGCTTGGAGG + Intronic
940669037 2:156645140-156645162 TGGCAAACAGCAGTGGTGGATGG - Intergenic
940910275 2:159204250-159204272 GGAGAAATACCTGTGGTTGGAGG + Intronic
941716259 2:168766689-168766711 GGAGAAACAGAACTAGTTGGAGG + Intronic
941784744 2:169485034-169485056 AGGCAAACAGAGGTGGTTGGTGG + Intronic
942679484 2:178462535-178462557 TGGCAAACAGCAGTGGTGGACGG - Intergenic
943076886 2:183206601-183206623 GGGGAAAAAGCTGGGGTTGGGGG + Intergenic
943092368 2:183390224-183390246 GGGGAAGCTGAAGTGGTGGGAGG + Intergenic
943216626 2:185044945-185044967 GTAGAAACAGCAGTGTTTGGAGG - Intergenic
943345695 2:186734761-186734783 TGGGAAACAGCAGAGGCTGAGGG - Intronic
944881390 2:204016622-204016644 GGAAATACAGCTGTGGTTGGTGG + Intergenic
945770811 2:214040005-214040027 GGGGCCACAGGAGTGGTTAGTGG + Intronic
946721672 2:222615480-222615502 GCGGAAGCAGCAGGGGTTGAGGG - Intronic
947317430 2:228876550-228876572 GGGGAGTCAGCAGTGGTTGCTGG - Intronic
947598013 2:231426170-231426192 GGGGAAGCTTCCGTGGTTGGCGG + Intergenic
948178384 2:235961453-235961475 AAGGACACACCAGTGGTTGGTGG + Intronic
948284603 2:236773926-236773948 GGGGAACCAGCTGTGGCTGGGGG + Intergenic
948342366 2:237264640-237264662 TGGGAAACAGTAGAGGGTGGTGG + Intergenic
948955016 2:241282356-241282378 GGGAAAACAGGTGTGGCTGGAGG + Intronic
1169218750 20:3808347-3808369 GGGGGAACAGTAGTGTCTGGAGG + Intergenic
1169905638 20:10600485-10600507 AAGGAGACAGCAGTGGTTGATGG + Intronic
1169950124 20:11034519-11034541 GGGGTGAAGGCAGTGGTTGGTGG + Intergenic
1169993534 20:11530240-11530262 GGGGAAAAAGCAGTGTTAAGAGG + Intergenic
1170136492 20:13079893-13079915 GGGCAAACAGCTGTGGCAGGTGG - Intronic
1170974599 20:21150292-21150314 AGGGAAATAACAGTGGGTGGAGG + Intronic
1171500797 20:25591493-25591515 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1172388521 20:34550281-34550303 GGAGGATCAGCAGAGGTTGGGGG - Intronic
1172627178 20:36353981-36354003 GGGGAAACAGCAGGCGCTCGAGG - Intronic
1172852533 20:37976995-37977017 GGGGAAACGGAAGCGGGTGGTGG + Intergenic
1172947191 20:38698744-38698766 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1174204991 20:48831738-48831760 GGGGAAGCACCATTGGTTGGTGG + Intergenic
1175525526 20:59630914-59630936 GGGTAGACAGGGGTGGTTGGAGG + Intronic
1176086241 20:63296837-63296859 GGGGGAAGAGCAGGGGCTGGGGG - Intronic
1176125509 20:63472936-63472958 GGGGAGACAGGAGTGGAGGGGGG + Intergenic
1177287041 21:19065057-19065079 TGGGAAGCAGCAGTGGTTCCAGG + Intergenic
1177359363 21:20048656-20048678 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1177738119 21:25118775-25118797 CGGGGAACAGCAGTGGTAGAGGG - Intergenic
1177895730 21:26854808-26854830 CGGCAAACAGCAGTGGTGGAAGG - Intergenic
1177896702 21:26861644-26861666 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1178685544 21:34707913-34707935 GAGGAAACAGCAGTGTTTATGGG - Intronic
1179259613 21:39746277-39746299 TGGCAAACAGCAGTGGTGGACGG + Exonic
1179459199 21:41522284-41522306 GGGGAAACATCAGGGGTGAGGGG + Intronic
1179908890 21:44437767-44437789 GAGGAAACAGGAGCTGTTGGAGG - Intronic
1181044450 22:20207902-20207924 GAGGAATCTGCAGTGGTTGCCGG - Intergenic
1181105919 22:20575164-20575186 GCGGACACAGCGGTGGTAGGCGG - Exonic
1181530863 22:23516611-23516633 GGGGAACCTGCAGGTGTTGGAGG + Intergenic
1181626924 22:24128663-24128685 GAGGAAACAGGAGTGGTGGAGGG - Intronic
1181807358 22:25383252-25383274 GGGGATAAAGCAGTGCCTGGAGG - Intronic
1182221360 22:28761554-28761576 GGCAAAACAGCAGTGGTGGATGG - Intergenic
1182454883 22:30443959-30443981 TGGGGTACAGCAGTGGTAGGTGG - Intergenic
1182655238 22:31884806-31884828 GGGGAAACAGCAGGGCTAGCTGG - Intronic
1183118773 22:35713444-35713466 TGGGAAACACCAATGGTAGGTGG - Intergenic
1183363795 22:37396673-37396695 GGAGGAGCAGCAGTGGTTAGTGG - Intronic
1184279218 22:43427473-43427495 GGGCAGGCAGCAGGGGTTGGGGG + Intronic
1184479540 22:44738505-44738527 GGGGAACCAGGTGTGATTGGAGG + Intronic
1184668825 22:46002251-46002273 GGGGAAGGAGCAGTGGGGGGAGG + Intergenic
1184910224 22:47527196-47527218 GAGGAAACATCAGGGGCTGGGGG + Intergenic
1185020467 22:48371755-48371777 GGGGAAATAACAGTGGCTGATGG - Intergenic
1185372259 22:50466360-50466382 GAGGAAACAGCAGTGCCAGGAGG + Exonic
950139673 3:10606803-10606825 GGGGATACAGCAGTGACTGAGGG - Intronic
950447250 3:13045440-13045462 GGGGAAACAGCAGAGCTGAGGGG + Intronic
950708731 3:14800356-14800378 GGGCAAACAAGAGTGGTAGGAGG + Intergenic
951201178 3:19876492-19876514 TGGCAAACAGCAGTGGTAGACGG + Intergenic
951326078 3:21303135-21303157 CGGAAAACAGCAGTGGTGGATGG + Intergenic
952423158 3:33149161-33149183 GGGGAACCATCAGGGGATGGTGG - Intergenic
953010330 3:39019268-39019290 GGGGTCACAGGAGTGGTTGGTGG - Intergenic
953348087 3:42192790-42192812 GGGGAGACAGCCTTGGTTGGTGG + Intronic
954137504 3:48588799-48588821 GGGCATACAGCAATGGTTAGGGG + Intronic
954146855 3:48638801-48638823 GAGGAAAGAGCAGGGGTTTGGGG - Intronic
954685512 3:52368050-52368072 GAGGAAACATCAGTGGTGAGGGG + Intronic
954752672 3:52822598-52822620 GAGGAAACTGCAGTAGATGGAGG + Intronic
954754322 3:52830999-52831021 GGAGAAACAGCGGGGGATGGTGG + Intronic
954905975 3:54063142-54063164 GGAGAAGCAGCAGTCTTTGGTGG + Intergenic
955381279 3:58440224-58440246 TGGCAAACAGCAGTGGTGGACGG + Intergenic
958550876 3:95610161-95610183 GGGGCCACAGGAGGGGTTGGTGG - Intergenic
960006990 3:112790777-112790799 CGGCAAACAGCAGTGGTGGATGG + Intronic
960088417 3:113614715-113614737 GGGGACACAGTAGTGATTTGGGG - Intronic
960574651 3:119218032-119218054 GGGGAAGAAGCTGTGGGTGGAGG + Intronic
960995160 3:123335822-123335844 GGGGAAACAGCAGTGGTTGGGGG - Intronic
961197200 3:125012709-125012731 GTGGAAACAACTGTGGTTTGGGG + Exonic
961215895 3:125160286-125160308 GGGGAAACAGAGGTGGTGAGAGG - Intronic
961917889 3:130396452-130396474 GGGGAAACAGTCGTGTGTGGAGG - Intronic
961942729 3:130654961-130654983 GGGGCCACAGGAGTGGTTGGTGG + Intronic
962154754 3:132934494-132934516 GTGCAAGCAGCAGTGGTAGGTGG - Intergenic
962299811 3:134229326-134229348 GGAGAGACAGAAGGGGTTGGGGG - Intronic
963024086 3:140901144-140901166 TGGCAAACAGCAGTGGTGGATGG - Intergenic
963897620 3:150703694-150703716 GGGGGAAGAGCAGGAGTTGGAGG - Exonic
963914023 3:150841249-150841271 GGGGAAACTGCAGTGTTGGGAGG + Intergenic
966933670 3:184691801-184691823 GGGGGAAAGGCAGGGGTTGGGGG - Intergenic
968552598 4:1231377-1231399 GGGGACACATCAGTGGGTGTTGG - Intronic
968980642 4:3847605-3847627 GTGGAAACCTCTGTGGTTGGTGG + Intergenic
969162615 4:5274794-5274816 CGGCAAACAGCAGTGGTGGACGG - Intronic
972766775 4:42158571-42158593 CGGCAAACAGCAGTGGTGGACGG + Intergenic
972853836 4:43082217-43082239 GGGCAAACAGCAGTGGTGGACGG - Intergenic
973590524 4:52436442-52436464 GGGGACTCAGGAGTGGGTGGTGG - Intergenic
975313230 4:72926028-72926050 CGGCAAACAGCAGTGGTGGACGG + Intergenic
975538981 4:75484453-75484475 GGCAAAACAGCAGGGGGTGGGGG + Intronic
976786432 4:88826699-88826721 GTGGGAACAGGAGTGGTAGGTGG - Intronic
976856509 4:89610388-89610410 GGGGAGAAACCAGTGGTGGGCGG - Intergenic
977251317 4:94692625-94692647 CGGCAAACAGCAGTGGTGGACGG - Intergenic
978587031 4:110284303-110284325 TGGCAAACAGCAGTGGTGGACGG + Intergenic
979910827 4:126363671-126363693 TGGCAAACAGCAGTGGTGGATGG - Intergenic
980625711 4:135372297-135372319 CGGCAAACAGCAGTGGTGGATGG - Intergenic
981273736 4:142874395-142874417 CTGGATACAGCTGTGGTTGGCGG + Intergenic
981667713 4:147248337-147248359 GAGCAAACAGAAGTGGATGGAGG - Intergenic
982978783 4:162104067-162104089 TGGCAAACAGCAGTGGTGGACGG - Intronic
983537512 4:168873956-168873978 AGGGGAACAGCAGTGGCAGGTGG - Intronic
983667444 4:170196968-170196990 CGGCAAACAGCAGTGGTGGATGG + Intergenic
984423189 4:179551092-179551114 GGGGAAACAGCAGTGGTCCTGGG + Intergenic
984702209 4:182825714-182825736 GGGGACTCGGGAGTGGTTGGTGG - Intergenic
985023566 4:185716826-185716848 GAGGAAACATCAGTGGAGGGAGG + Intronic
985493055 5:190310-190332 AGAGAAACAGCAGTGGGAGGGGG - Intergenic
985658083 5:1142365-1142387 GGGGAGACAGGAGAGGGTGGAGG - Intergenic
987508221 5:18800422-18800444 GGCAAAACAGCAGTGGTGGAGGG - Intergenic
987757125 5:22110578-22110600 GGGGCTACAGGAGTGTTTGGTGG + Intronic
987905347 5:24069366-24069388 TGGCAAACAGCAGTGGTGGACGG - Intronic
988554439 5:32224028-32224050 GGGGAAGCAGTAGAGATTGGTGG - Intergenic
988740545 5:34064672-34064694 CGGCAAACAGCAGTGGTGGATGG + Intronic
988957400 5:36332981-36333003 CGGCAAACAGCAGTGGTGGATGG + Intergenic
989128843 5:38084012-38084034 GGGAAAATACCTGTGGTTGGTGG - Intergenic
989233459 5:39115461-39115483 TGGAAAACAGCAGTGGATGAGGG + Intronic
989608410 5:43268493-43268515 GGGGCCACAGGAGTGGTTGGTGG + Intronic
989688426 5:44114670-44114692 TGGCAAACAGCAGTGGTGGATGG - Intergenic
990891806 5:60658870-60658892 TGGTAAACAGCAGTGGTGGATGG - Intronic
992293493 5:75304574-75304596 CGGCAAACAGCAGTGGTGGATGG - Intergenic
993225633 5:85165289-85165311 TGGCAAACAGCAGTGGTGGACGG - Intergenic
993941859 5:94068393-94068415 TGGCAAACAGCAGTGGTGGATGG + Intronic
995125595 5:108574491-108574513 AGCGAAACAGCAGTGGTGGATGG + Intergenic
995465163 5:112444070-112444092 TGGCAAACAGCAGTGGTGGACGG - Intergenic
996482365 5:123989080-123989102 TTAGAAACAGCTGTGGTTGGTGG - Intergenic
998932989 5:147201665-147201687 GGGGACACAGCAGTGTATGGTGG - Intergenic
999019987 5:148154501-148154523 GGGGAAACTGCAGTGGCAGAAGG - Intergenic
999257947 5:150220275-150220297 GGGGAAAGAGCAGTGATTTGGGG - Intronic
999324850 5:150637582-150637604 GGGGAACCCGCAGGGGTTGGGGG + Intronic
1000519637 5:162280182-162280204 GGTGAAGGAGAAGTGGTTGGGGG + Intergenic
1002107756 5:176888571-176888593 GGGGAAAGGGAAGTGGTTTGGGG + Intronic
1002636995 5:180613481-180613503 GGGGGAGCAGCAGGGGTTGGGGG - Intronic
1002637003 5:180613500-180613522 GGAGGAGCAGCAGGGGTTGGGGG - Intronic
1002806297 6:578037-578059 GAGAAAACAGCAGTCTTTGGTGG - Intronic
1003054572 6:2806622-2806644 GGGGCCACAGGAGGGGTTGGTGG - Intergenic
1003224075 6:4189145-4189167 GAAGAAACAGAAGTGGTTGGAGG + Intergenic
1003235095 6:4288483-4288505 GGGCAAACAGCCTGGGTTGGGGG - Intergenic
1004474523 6:15959017-15959039 GGGGCCACAGGAGTGGTTAGTGG + Intergenic
1005324148 6:24682705-24682727 CGGCAAACAGCAGTGGTGGATGG + Intronic
1006193224 6:32222092-32222114 GGGAAGACTGCAGTGGTGGGAGG - Intronic
1007011949 6:38426521-38426543 GGCAAAACAGCAGTGGTGGATGG - Intronic
1007714530 6:43848086-43848108 ATGGTGACAGCAGTGGTTGGGGG + Intergenic
1007975687 6:46098962-46098984 GGGGAACCAGCACTGGCTGCGGG + Intergenic
1008028247 6:46663328-46663350 GGGCAGACAGCAGTGGTCAGCGG - Intronic
1008368304 6:50707283-50707305 GAGGAAACGGAAGTGTTTGGCGG - Intergenic
1008582777 6:52921518-52921540 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1008688032 6:53945908-53945930 GGGGAAGCTGCAGTGGAGGGAGG - Intronic
1009544321 6:65005109-65005131 TGGCAAACAGCAGTGGTGGACGG - Intronic
1011368691 6:86609200-86609222 GGGCAAACTTCAGTGGATGGAGG - Intergenic
1011851744 6:91638061-91638083 GGGGAATCAGCAGTGAAGGGTGG - Intergenic
1011888395 6:92126432-92126454 GGGGATACAGCGCTGGTTTGAGG - Intergenic
1012734542 6:102921703-102921725 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1013021753 6:106228254-106228276 CGGCAAACAGCAGTGGTGGATGG - Intronic
1013375675 6:109511620-109511642 GTGGAGATAGCAGTGGGTGGAGG + Intronic
1013821587 6:114159569-114159591 GGGGACACAGAAGTGTTTGTTGG + Intronic
1013852607 6:114534468-114534490 GGGGAAGAACCAGTGGTGGGCGG + Intergenic
1014208910 6:118687752-118687774 CGGCAAACAGCAGTGGTGGACGG - Intronic
1014934138 6:127366443-127366465 GTGGAGACGGCAGTGATTGGTGG - Intergenic
1015045714 6:128774084-128774106 GGGGACACAGGAGTGGGTGAAGG - Intergenic
1015866189 6:137729231-137729253 GGGAAAACAGCCCTGGTTGCTGG + Intergenic
1016444928 6:144121424-144121446 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1016553004 6:145302819-145302841 GGGGCAATTCCAGTGGTTGGGGG + Intergenic
1017251393 6:152283977-152283999 GGGGAAACGGCAGCTTTTGGAGG - Exonic
1018900740 6:168050569-168050591 GGGGAAAGAGCAGCGGTCGGAGG + Intergenic
1018911747 6:168104961-168104983 GGGAAAAGATCAGTGGTTGCCGG + Intergenic
1019364239 7:623604-623626 GAGGAAACACCAGGGGCTGGGGG - Intronic
1019381738 7:727505-727527 GGGGAAGCAGTGGTGGTGGGAGG - Intronic
1019404762 7:877525-877547 GGGGAGAGAGCCGGGGTTGGGGG - Intronic
1020708088 7:11570779-11570801 AGGGAGACAGCAGTGGGTAGGGG + Intronic
1020906203 7:14067210-14067232 CGGCAAACAGCAGTGGTGGGCGG - Intergenic
1021885344 7:25131953-25131975 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1022117652 7:27276465-27276487 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1022425200 7:30262005-30262027 GAGGAAACTGCAGTGGGTTGGGG + Intergenic
1022712662 7:32866203-32866225 GGGTAATAAGCAGAGGTTGGAGG - Intergenic
1023644718 7:42298167-42298189 GGGGAAACTGCACATGTTGGAGG - Intergenic
1024252344 7:47515969-47515991 GGGGAAGCAGCAGAGCGTGGTGG - Intronic
1024375805 7:48636757-48636779 GGGGAAACAGCTGAGGATGCAGG - Intronic
1025995461 7:66524671-66524693 GGGGGAACGGCAGGGGTTGAGGG + Intergenic
1026981029 7:74526632-74526654 GGGGCAACAGCAGGGTTCGGGGG + Intronic
1026987114 7:74561537-74561559 GGGTGAACGGCAGGGGTTGGGGG + Intronic
1027139705 7:75648474-75648496 GGGGCAACAGCAGTGTCAGGAGG - Intronic
1027139949 7:75649910-75649932 GGGGGAACAGCAGTGTCAGGAGG - Intronic
1027714126 7:81648010-81648032 GTGAAAAGAGCAGTGGTTGCAGG + Intergenic
1028013983 7:85684105-85684127 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1028587731 7:92468311-92468333 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1028589093 7:92477798-92477820 TGGCAAACAGCAGTGGTGGACGG + Intronic
1028692082 7:93663971-93663993 GGGGAAACACAAGGGGTTGGGGG - Intronic
1028917751 7:96278223-96278245 GGGGACAAAGCAGTGGTTTGGGG + Intronic
1028993385 7:97074790-97074812 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1029480016 7:100806648-100806670 GGGGAAAAAGCAGAGGCAGGTGG - Intronic
1029529914 7:101118502-101118524 GGGTAAAGAGAAGTGGATGGAGG + Intergenic
1030336804 7:108337404-108337426 TGGCAAACAGCAGTGGTGGATGG - Intronic
1030843985 7:114386161-114386183 TGGCAAACAGCAGTGGTGGATGG + Intronic
1031250879 7:119378956-119378978 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1031299569 7:120047464-120047486 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1031364958 7:120890415-120890437 GGTGAAAGAGAAGGGGTTGGGGG + Intergenic
1031400843 7:121325088-121325110 GGGGAAACTGCATTTGCTGGGGG - Intergenic
1031820655 7:126497332-126497354 GGAGCAACAACAGTGGATGGAGG + Intronic
1032258428 7:130315237-130315259 GGGGAAACGAGAGGGGTTGGTGG + Intronic
1033117149 7:138635343-138635365 GGGGAAACAAAGCTGGTTGGAGG + Intronic
1033311746 7:140266764-140266786 GGGCGAACAGCAGTGGGAGGGGG - Intergenic
1033429493 7:141276112-141276134 GGGGAAAATGCAGTGGGTTGGGG + Intronic
1033616526 7:143021787-143021809 GGGTAATGAGCAGAGGTTGGAGG + Intergenic
1034152658 7:148929093-148929115 GTGGAAAAAGCAGGGGTTTGGGG - Intergenic
1034248764 7:149671695-149671717 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1034249490 7:149676815-149676837 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1034650848 7:152688867-152688889 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1034965015 7:155385412-155385434 CGGCAAACAGCAGTGGTGGACGG + Intronic
1036459733 8:8941242-8941264 AGGGAAGCAGCAGTGGCGGGCGG + Intergenic
1036567281 8:9948295-9948317 TGGGAAAGAGAAGAGGTTGGTGG - Intergenic
1039604321 8:38868084-38868106 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1039611682 8:38924237-38924259 GGGGAAACAGCAGTCATTGTGGG + Intronic
1042055652 8:64763075-64763097 TGGCAAACAGCAGTGGTGGACGG - Intronic
1042792003 8:72618050-72618072 GGAGAAACAGCAGTGTGTGCAGG - Intronic
1043163142 8:76871061-76871083 GGGGAAACAGGAGTTGAAGGTGG - Intergenic
1043804497 8:84654572-84654594 AGGGAAAGAGCAGTGGTGGTAGG - Intronic
1044540044 8:93398617-93398639 AGGGAACCAGCATTTGTTGGTGG - Intergenic
1044725612 8:95192147-95192169 GGGGACAGAGCAGTGGCTTGAGG - Intergenic
1045657587 8:104403114-104403136 TGGCAAACAGCAGTGGTGGACGG - Intronic
1045788640 8:105955560-105955582 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1046104518 8:109649569-109649591 GGGGAAGAGGCAGAGGTTGGGGG + Intronic
1046374085 8:113352751-113352773 GGCTAAAGAGCAGTAGTTGGTGG + Intronic
1046499468 8:115057013-115057035 GAGGCAGCAGCAGTGGTTTGAGG - Intergenic
1046815488 8:118578731-118578753 GAGGAAACAACAGTGGCTGCTGG - Intronic
1047995280 8:130329162-130329184 GAGGCAGCAGCAGTGGTTGAGGG - Intronic
1048567290 8:135614971-135614993 GAGGAAACATCAGTGGTAGGGGG + Intronic
1049038136 8:140092627-140092649 GGGGAAAGAGAAGTGCTTGAGGG - Intronic
1049157154 8:141074076-141074098 GGGGACACAGAGGTGGATGGGGG + Intergenic
1049277212 8:141725869-141725891 GTGGCAACAGCAGTGGTAGCCGG - Intergenic
1049339266 8:142103248-142103270 GGGGAGACAGCACTGGGTGGAGG + Intergenic
1049657342 8:143804665-143804687 GTGGCAACAGCAGCGGTGGGGGG + Exonic
1050010665 9:1182706-1182728 CGGGAAAGAGCAGTTTTTGGGGG + Intergenic
1050124974 9:2347484-2347506 AGGGAAAGGGCAGAGGTTGGAGG - Intergenic
1051890097 9:21932546-21932568 GGGGCCACAGGAGTGGTTGGTGG - Intronic
1051996918 9:23228259-23228281 GGGGCCACAGGAGTGGTTGGTGG + Intergenic
1053134339 9:35640685-35640707 TGGCAAACAGCAGTGGTGGACGG + Intronic
1053946268 9:43312311-43312333 GGGGAAAAAGCCGTGGTGGCAGG - Intergenic
1055121243 9:72663259-72663281 GGGGCCACAGGACTGGTTGGTGG + Intronic
1055789844 9:79911963-79911985 CGGTAAACAGCAGTGGTGGACGG + Intergenic
1056902324 9:90611602-90611624 GGAGAAACAGCAGTTGCAGGAGG + Exonic
1060201778 9:121655572-121655594 GGGGACAGAGCAGTGGTTAGTGG + Intronic
1061009081 9:127944689-127944711 GGGGACACAGGAGAGGATGGAGG + Intronic
1061403592 9:130381850-130381872 GGGGTGACAGCAGTGGTTGCTGG - Intronic
1061613497 9:131763850-131763872 GAGGAAGCAGCAGTGGCTGAGGG - Intergenic
1062057329 9:134475358-134475380 GGGGAAGCAGGAGGGGTTCGGGG + Intergenic
1062114923 9:134803229-134803251 GGGGAGAGAGCAGAGGGTGGAGG - Intronic
1062168961 9:135123786-135123808 GGGGAAACAGAAGATGTGGGCGG + Intergenic
1062282168 9:135757005-135757027 GGGGAAATAGGAGAGGGTGGGGG - Intronic
1062402281 9:136377965-136377987 GGCCACACAGCAGTGGCTGGGGG - Exonic
1203589398 Un_KI270747v1:40869-40891 GGGGAAAAAGCCGTGGTGGCAGG - Intergenic
1185483944 X:468246-468268 GGGGCAACAGCAGGTCTTGGCGG - Intergenic
1185763681 X:2707660-2707682 GTGGAAACAGCAGTGGCAGTTGG + Intronic
1186369034 X:8927717-8927739 AGGGAGACAGCAGTGGCGGGAGG - Intergenic
1187607818 X:20905628-20905650 GGGGAGCCTGCAGGGGTTGGGGG + Intergenic
1189558160 X:42166260-42166282 GGGGAAACTGCAGTGGTGGGAGG + Intergenic
1189648221 X:43157856-43157878 GAGGGAGCAGGAGTGGTTGGGGG + Intergenic
1189796611 X:44651730-44651752 TGGGAGACAGCAGTGGCAGGGGG + Intergenic
1190227700 X:48559042-48559064 AGGGACCCAGCTGTGGTTGGAGG + Intronic
1190998555 X:55636389-55636411 GAGGAAAGAGCAGGGGTAGGGGG - Intergenic
1191167488 X:57405562-57405584 CGGCAAACAGCAGTGGTGGATGG + Intronic
1191207907 X:57853667-57853689 GGGGAAGCAGCAGTGGGGTGAGG + Intergenic
1192254874 X:69447982-69448004 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1192571972 X:72213538-72213560 TGGCAAACAGCAGTGGTGGACGG - Intronic
1192875348 X:75223645-75223667 AGGGAAACTGCAGTGATTGTGGG - Intergenic
1193306246 X:79956018-79956040 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1194919756 X:99750342-99750364 GGGTAATGAGCAGAGGTTGGTGG + Intergenic
1195046451 X:101058772-101058794 GGGACCACAGGAGTGGTTGGTGG - Intergenic
1195259091 X:103115404-103115426 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1195508243 X:105684241-105684263 GGGGAAGCACAAGGGGTTGGGGG + Intronic
1195757725 X:108215819-108215841 AGGGAAACAACAATGGATGGTGG - Intronic
1196284619 X:113864428-113864450 CTAGAAACAGCTGTGGTTGGTGG - Intergenic
1196287281 X:113897473-113897495 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1196618583 X:117795995-117796017 GGGGAAAGAGCAGTGGGAAGTGG + Intergenic
1197168326 X:123403828-123403850 GGGGAAGCAGCATTGTGTGGAGG + Intronic
1197999720 X:132420349-132420371 CGGCAAACAGCAGTGGTGGATGG + Intronic
1198219822 X:134589048-134589070 GGAGAAACTGGAGGGGTTGGGGG - Intronic
1198675662 X:139127615-139127637 GGGGAAACAGCTGAGGCTGCTGG + Intronic
1198722604 X:139639327-139639349 GAGGAAACAGCATTGGTTTTAGG + Intronic
1198891627 X:141403305-141403327 GGGGAAGCTACAGTGGTGGGAGG + Intergenic
1199368802 X:147020883-147020905 CGGCAAACAGCAGTGGTCGACGG - Intergenic
1199432073 X:147773164-147773186 GGCAAAACAGCAGTGGTGGATGG - Intergenic
1200181925 X:154155905-154155927 GAGGCAAAAGCAGTGGCTGGCGG - Intronic
1200187574 X:154193019-154193041 GAGGCAAAAGCAGTGGCTGGCGG - Intergenic
1200193223 X:154230159-154230181 GAGGCAAAAGCAGTGGCTGGCGG - Intronic
1200198978 X:154267963-154267985 GAGGCAAAAGCAGTGGCTGGCGG - Intronic
1200741941 Y:6863784-6863806 GGGGAAACAGCAAAGATGGGTGG + Intergenic
1201182136 Y:11358985-11359007 CGGGAAACATAAGGGGTTGGGGG + Intergenic
1201981130 Y:19911448-19911470 TGGGAAAGAGAAGGGGTTGGGGG - Intergenic