ID: 960996767

View in Genome Browser
Species Human (GRCh38)
Location 3:123345311-123345333
Sequence CTGTGTTGGCCGAGGCAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 243}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960996760_960996767 6 Left 960996760 3:123345282-123345304 CCGAGGCGCAGGGGTGGCCGGTG 0: 1
1: 0
2: 0
3: 21
4: 225
Right 960996767 3:123345311-123345333 CTGTGTTGGCCGAGGCAGGCTGG 0: 1
1: 0
2: 3
3: 28
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960996767 Original CRISPR CTGTGTTGGCCGAGGCAGGC TGG Intronic
900326958 1:2113062-2113084 CACTGCTGGCCGAGGCTGGCCGG + Intronic
901776941 1:11566595-11566617 CTGTGCTGGCGGAGGGAGGCTGG - Intergenic
903227435 1:21901821-21901843 CTGTGGTGACCGTGGCAGGGAGG - Intronic
903244198 1:22003902-22003924 CTGTGTTGGCCAGGCCAGTCTGG + Intronic
903257838 1:22114608-22114630 TTGTGTTGGCCTCGCCAGGCGGG + Intergenic
905846912 1:41241656-41241678 CCGGGTGGGCCGGGGCAGGCTGG - Intronic
905876653 1:41435884-41435906 CTGTGTGGGCTGAGGGTGGCAGG - Intergenic
906346401 1:45018140-45018162 CTGTGTTTGCCAAGGGAGACAGG + Exonic
906668500 1:47638425-47638447 CTGTGGTGGCCCAGGGAGGGAGG + Intergenic
909512808 1:76474103-76474125 ATGTGTTGACTGAGGCAAGCTGG - Intronic
912817040 1:112837726-112837748 CTTGGGAGGCCGAGGCAGGCAGG - Intergenic
913323910 1:117609862-117609884 CTTGGTGGACCGAGGCAGGCAGG + Intronic
914818846 1:151084102-151084124 CTGTGTTGCCCGGGGTAGTCGGG + Intronic
916474255 1:165153570-165153592 CTGTCTTGGCTCAGGCAAGCAGG + Intergenic
920210718 1:204326300-204326322 GTGTGTTGGCACAGGCAGGAGGG - Intronic
920250220 1:204618253-204618275 GTGGGTTCCCCGAGGCAGGCGGG + Exonic
921859472 1:220026770-220026792 AACTGCTGGCCGAGGCAGGCGGG - Intronic
924520496 1:244802133-244802155 CTGTGTTGGCCCTCGAAGGCTGG - Intergenic
924631470 1:245744656-245744678 CTGGTTTGGCCTAGGCATGCTGG - Intergenic
1064093157 10:12402472-12402494 CTTGGGAGGCCGAGGCAGGCGGG - Intronic
1066188978 10:33037849-33037871 GTGTGCTGGCTGAGGCAGGCTGG - Intergenic
1069838801 10:71326552-71326574 CTGTGCCGGCCGAGACAGGCAGG - Intronic
1071630661 10:87216194-87216216 GTGGGCTGGCAGAGGCAGGCGGG + Intergenic
1073214727 10:101829864-101829886 CTGTGGGGGCGGAGGGAGGCTGG + Exonic
1076342260 10:129757492-129757514 CTGTGTTCGCCGAGGAAGGCAGG + Intronic
1076371005 10:129953661-129953683 CTGTGGCTGCCCAGGCAGGCCGG - Intronic
1077136588 11:1002556-1002578 CTCTCGTGGCCGTGGCAGGCTGG + Intronic
1077400293 11:2352289-2352311 CTGTGATGGCCATGGCAGCCTGG + Intergenic
1077466103 11:2734449-2734471 CTGTGCTGGGCAAGGCAGGACGG + Intronic
1077634342 11:3831852-3831874 CTGGGCTGGCCCAGGCAGGAAGG + Intronic
1077673511 11:4178918-4178940 CTGTGGTGGTAGAGGCAGGTTGG + Intergenic
1078084078 11:8223390-8223412 GTGTGTAGGCAGAGACAGGCAGG - Intergenic
1083332937 11:61907358-61907380 CTGGGCTGGCCTGGGCAGGCGGG + Intronic
1083559795 11:63664294-63664316 CTTGGGAGGCCGAGGCAGGCAGG + Intronic
1083579830 11:63817971-63817993 CTGTGTCGGCCGAGGGTGCCCGG - Exonic
1083715898 11:64576844-64576866 CTGGGTTGGGGGAGGCAAGCAGG - Intergenic
1083850108 11:65360637-65360659 TTTGGTAGGCCGAGGCAGGCGGG - Intergenic
1084322298 11:68380347-68380369 CTGTGTTGACTGAGGCAGGCTGG + Intronic
1084425475 11:69081703-69081725 CTGGGTTGGGAGAGGAAGGCGGG + Intronic
1084542533 11:69796594-69796616 CTGGGATGACGGAGGCAGGCAGG - Intergenic
1084605005 11:70167390-70167412 GAGTGATGGCCGGGGCAGGCAGG + Intronic
1085745217 11:79109335-79109357 CTGTGAGGGCAGAGGCAGCCAGG + Intronic
1089436705 11:118474927-118474949 CCGTGTTGGCCAGGCCAGGCTGG - Intronic
1089724197 11:120459952-120459974 CTTTGGAGGCCAAGGCAGGCGGG - Intronic
1089852713 11:121514345-121514367 TTGTGTTGGCCTAAGAAGGCAGG - Intronic
1090025959 11:123168050-123168072 CTTTGTTGACCATGGCAGGCTGG - Intronic
1090202439 11:124866096-124866118 CTGGCTTGGCCGAGGCCGGCGGG - Intronic
1090527711 11:127555517-127555539 TTGTGTTGACAGATGCAGGCAGG - Intergenic
1091674904 12:2482142-2482164 CTGGGGTGGCAGAGCCAGGCTGG - Intronic
1091988001 12:4928893-4928915 CTGTATTGGTCAAGGCAGTCTGG + Intronic
1094687536 12:32732986-32733008 CTGGGGAGGCTGAGGCAGGCAGG + Intronic
1096155875 12:49341378-49341400 CCGTGATGGCAGAGGCAGGAGGG - Intergenic
1097261945 12:57725390-57725412 CTGGGTTGGCTGAGGGAGGCAGG + Intronic
1104753829 12:131256552-131256574 CTGGGTTCACTGAGGCAGGCGGG - Intergenic
1105870947 13:24505865-24505887 CTGTGTTAGCTTGGGCAGGCAGG + Intronic
1106256236 13:28024373-28024395 CTTGGGAGGCCGAGGCAGGCAGG - Intronic
1106669300 13:31887983-31888005 CTATGCTGACAGAGGCAGGCAGG - Intergenic
1106723108 13:32455821-32455843 CTGTGTTGGTAGTGGCAGACAGG - Intronic
1110562791 13:76927266-76927288 CTGTTGTGGCCGGGGCAGGGAGG + Intergenic
1111368869 13:87289463-87289485 CTCTGTTGCCCGGGCCAGGCTGG - Intergenic
1112177219 13:97038001-97038023 CTCTGGAGGCTGAGGCAGGCAGG - Intergenic
1112933566 13:104770959-104770981 CTATGTTGGCCAGGCCAGGCTGG - Intergenic
1114265190 14:21069631-21069653 CTGTGTTGCCTGGGGAAGGCGGG - Intronic
1115676167 14:35677090-35677112 CTTGGGAGGCCGAGGCAGGCGGG + Intronic
1116287531 14:42991719-42991741 CTATCTTGGCTGAGGCAGGAAGG - Intergenic
1117381371 14:55167010-55167032 CTTTGGGGGCCGAGGCAGGCAGG + Intronic
1117546017 14:56795214-56795236 CCGAGGTGGCCGAGGCAGGGAGG + Intergenic
1118611921 14:67547964-67547986 ATGGGGTGGCCCAGGCAGGCTGG - Intronic
1118718390 14:68576390-68576412 CTGGGTTGGGGGTGGCAGGCAGG - Intronic
1121012062 14:90525684-90525706 CTGGGTTGGGCGAGGTAGGACGG - Exonic
1121082709 14:91121167-91121189 CTGTGTTGACAGTGTCAGGCAGG - Intronic
1121683571 14:95814844-95814866 TTGTCTTGGCAGAGGCAGGAGGG - Intergenic
1122563511 14:102634263-102634285 TTTGGTTGGCCGAGGCAGGAGGG + Intronic
1122880453 14:104688468-104688490 CTGTGTGGGCCGTGGCGGCCAGG - Intergenic
1123970548 15:25504258-25504280 AGGTGTGGGCCCAGGCAGGCTGG - Intergenic
1126549329 15:49909273-49909295 CTGTGGTGGTAGTGGCAGGCTGG - Intronic
1127136937 15:55933909-55933931 TTTGGTAGGCCGAGGCAGGCAGG + Intronic
1128520956 15:68374604-68374626 CTGTGTCTGTTGAGGCAGGCAGG + Intronic
1128550730 15:68596480-68596502 CTGTGCTTTCCGTGGCAGGCAGG - Intronic
1128756763 15:70188485-70188507 CTGTGTTTGCCAACCCAGGCTGG + Intergenic
1130137810 15:81196638-81196660 CTGTGTTGTCCAAAGAAGGCAGG + Intronic
1131332125 15:91510941-91510963 CTGTGATGGGCGAGTAAGGCAGG - Intergenic
1131440622 15:92456866-92456888 GAGTGTTGGCTTAGGCAGGCAGG + Intronic
1133166870 16:3954204-3954226 CTGAGCTGGCCGGGGCAGGCTGG + Intronic
1133308502 16:4827112-4827134 CCTTGATGGCGGAGGCAGGCAGG - Intronic
1134448686 16:14349822-14349844 CTGGGGTGGCTGAGGCAGGAGGG - Intergenic
1134761790 16:16720936-16720958 CTGTGCTCACCAAGGCAGGCCGG - Intergenic
1134984268 16:18638234-18638256 CTGTGCTCACCAAGGCAGGCCGG + Intergenic
1139346454 16:66306898-66306920 CCCTGCTGGCCAAGGCAGGCAGG + Intergenic
1139402532 16:66694510-66694532 CTGTGTTGGCCTGGCCAGGCTGG - Intronic
1139412919 16:66780107-66780129 CTTGGGAGGCCGAGGCAGGCAGG - Intronic
1139613140 16:68073109-68073131 CTGTGGTGGCTGAAGCAGGAAGG + Intronic
1140203607 16:72914746-72914768 CTTTGGGGGCTGAGGCAGGCAGG + Intronic
1141923961 16:87154803-87154825 CTTTGTTGGCCAGGGCAGTCTGG - Intronic
1142270477 16:89086538-89086560 CTGTGTCAGCTGTGGCAGGCTGG - Intergenic
1142823271 17:2489410-2489432 TTTGGTAGGCCGAGGCAGGCAGG + Intronic
1143490931 17:7284879-7284901 CTATGGTGGCATAGGCAGGCTGG - Exonic
1144312766 17:14028148-14028170 CTGTGTTTGCCAAGGGAGACAGG + Intergenic
1144331990 17:14233179-14233201 CTGTGTTTGCCAAGGGAGACAGG - Intergenic
1144498835 17:15768404-15768426 CTGTGTTTGCCAAGGGAGACAGG + Intergenic
1144847766 17:18228930-18228952 CTGGATGGGCAGAGGCAGGCAGG + Intronic
1145162216 17:20583438-20583460 CTGTGTTTGCCAAGGGAGACAGG + Intergenic
1148059284 17:44824246-44824268 TTTGGTAGGCCGAGGCAGGCAGG - Intronic
1150591804 17:66569323-66569345 CTTTGGAGGCCGAGGCAGGCGGG + Intronic
1155845023 18:30695250-30695272 CTGGGTTGGCCAAGGCTGGCAGG + Intergenic
1156774377 18:40769490-40769512 CTGTGTTGGCATAGCCAAGCAGG - Intergenic
1159042780 18:63340899-63340921 CTGTGTTGTGGGAGGCAAGCAGG - Intronic
1160778156 19:866197-866219 GTGGGGTGGGCGAGGCAGGCAGG - Intergenic
1161010136 19:1955910-1955932 CTGTTGTGGCCCAGGCAGGTTGG - Intronic
1161325598 19:3662194-3662216 CTGTGTGGCCCGAGGGAGGGTGG - Intronic
1161428499 19:4217427-4217449 CCGCGGAGGCCGAGGCAGGCCGG + Exonic
1161492074 19:4567654-4567676 CTGAGCTGGGCCAGGCAGGCGGG - Intergenic
1161577924 19:5065034-5065056 GTGCTTTGGCCGTGGCAGGCGGG + Intronic
1162003020 19:7760093-7760115 CAGTGGTGGCAGCGGCAGGCTGG + Intergenic
1162250441 19:9438302-9438324 TTGTGGAGGCCGAGGCGGGCAGG - Intergenic
1162380941 19:10331443-10331465 CTTTGGAGGCTGAGGCAGGCGGG + Intronic
1162774484 19:12970921-12970943 CTTGGGGGGCCGAGGCAGGCGGG - Intronic
1163688837 19:18727337-18727359 TTTGGTAGGCCGAGGCAGGCAGG + Intronic
1163769247 19:19180686-19180708 CTGGGTTGGCGGAGGCTGGGGGG + Exonic
1164708663 19:30339224-30339246 CTGTGGACTCCGAGGCAGGCTGG - Intronic
1166751747 19:45167139-45167161 CTGTGTTGGCTGCTGAAGGCCGG - Intronic
1166903644 19:46087321-46087343 CTGTGGTGGTAGTGGCAGGCTGG + Intergenic
1167232769 19:48295961-48295983 CTATGTTGGTCAGGGCAGGCTGG - Intergenic
925438670 2:3865144-3865166 CTGTGTAGGCCCAGGGAAGCAGG - Intergenic
925587075 2:5474961-5474983 CTGTGATGGGCAGGGCAGGCGGG - Intergenic
927040392 2:19224443-19224465 CTGTGTGGGCAGAGGCCAGCTGG - Intergenic
927663112 2:25009394-25009416 TTTGGGTGGCCGAGGCAGGCGGG + Intergenic
929804321 2:45131484-45131506 CTGTGTTAGCCGGGGCAGATAGG + Intergenic
930019654 2:46993872-46993894 CTGTGTTGGGGCAGGCAAGCAGG - Intronic
930808496 2:55517301-55517323 CTATGTTGGCCGGGCTAGGCTGG - Intergenic
931142458 2:59477901-59477923 TTTGGGTGGCCGAGGCAGGCAGG - Intergenic
932183814 2:69674033-69674055 CAGTGTTCACCGAGGCACGCAGG - Intronic
933738940 2:85517746-85517768 CTGTGGAGGCCAAGACAGGCTGG + Intergenic
934690357 2:96354022-96354044 GAGTCTTGGCCCAGGCAGGCAGG + Intronic
934994358 2:98943412-98943434 TAGTGTTGGCCGAGGCTGGGAGG + Intergenic
935626338 2:105175113-105175135 CTGTGTGGGGCTTGGCAGGCTGG - Intergenic
937111109 2:119367608-119367630 CCGGATTGGCAGAGGCAGGCGGG - Exonic
939885191 2:147673769-147673791 CTTGGGAGGCCGAGGCAGGCAGG - Intergenic
940883339 2:158968599-158968621 CGGTGTGGGCCGAGCAAGGCGGG + Intergenic
941502335 2:166295239-166295261 TTGTGATGGCAGAGGTAGGCAGG + Intronic
941948628 2:171129594-171129616 CTTTGAAGGCCAAGGCAGGCAGG + Intronic
942453386 2:176122324-176122346 CGGTGTCGCCCGAGGCAGGCGGG - Intergenic
943560360 2:189454176-189454198 CTGTGTTGGAGAAGGGAGGCCGG + Intronic
944678289 2:202052765-202052787 ATGGCTTGGCCAAGGCAGGCAGG + Intergenic
946311010 2:218882628-218882650 CTGTGTAGGCTGAGGGTGGCAGG + Intronic
946834653 2:223761051-223761073 CTGTCTGAGCCGAGCCAGGCTGG + Intronic
947289391 2:228555268-228555290 CTGTGTTGGCTGTGGCTGACAGG + Intergenic
948054650 2:235002101-235002123 CTGGGGAGGCCGAGGCGGGCGGG - Intronic
1169507283 20:6224995-6225017 TTGGGGAGGCCGAGGCAGGCGGG - Intergenic
1173537720 20:43828716-43828738 CTCTGTTGGCCAAGGCAGCTGGG + Intergenic
1175801825 20:61805366-61805388 CTGTGTTGGCAGATGGAGGTGGG + Intronic
1176216681 20:63951397-63951419 CTCTGTAGCCCCAGGCAGGCCGG - Intronic
1176255778 20:64152176-64152198 CTGTGTTGGCTGCTGCAGGTCGG + Intronic
1176386503 21:6140760-6140782 CTGTCTTGGAGGAGGCGGGCCGG + Intergenic
1179736970 21:43397492-43397514 CTGTCTTGGAGGAGGCGGGCCGG - Intergenic
1179875598 21:44265829-44265851 CTTGGGAGGCCGAGGCAGGCGGG - Intergenic
1180048891 21:45322357-45322379 GGCTGTTGGCCGAGGCAGGCTGG + Intergenic
1180063978 21:45403985-45404007 CTGGGAAGGCTGAGGCAGGCAGG + Intergenic
1180088842 21:45523739-45523761 CTGTGTGGCCCCAGCCAGGCTGG - Intronic
1180174732 21:46082108-46082130 CGCCGTTGGCCGAGGCAGCCTGG + Intergenic
1180707601 22:17818793-17818815 ATGTTTTGGCCGGGGCAGGCTGG + Exonic
1180861818 22:19087619-19087641 TTTTGGAGGCCGAGGCAGGCAGG - Intronic
1181083944 22:20430658-20430680 GTGTCTGGGCCGACGCAGGCAGG + Intronic
1181098815 22:20524978-20525000 CTGTGTTGACTGAGACAGGAAGG + Intronic
1181821283 22:25477635-25477657 GTGGGTTGGCTGAGCCAGGCTGG + Intergenic
1182005581 22:26956790-26956812 CTGTTCTGGAAGAGGCAGGCAGG - Intergenic
1182037989 22:27214300-27214322 AAGAGTTGGCCAAGGCAGGCAGG - Intergenic
1182081519 22:27532594-27532616 CTGTGTTAGCCTAGCCAGGATGG + Intergenic
1183015601 22:34983946-34983968 CCGTCTTGGCCGAGACAGGCTGG + Intergenic
1183457109 22:37928878-37928900 CTTTGGAGGCTGAGGCAGGCAGG + Intronic
1183467412 22:37986675-37986697 CAGTGTTGGGTGAGGCAGGTGGG + Intronic
1183952587 22:41359856-41359878 CTGTGTTCCCCCCGGCAGGCAGG + Exonic
1184199754 22:42959999-42960021 CTGTGATGGCCACAGCAGGCAGG - Intronic
1184734987 22:46392799-46392821 CTCTGGAGGCCGAGGCAGGAGGG - Intronic
950247577 3:11435649-11435671 CTGTGTGGGCCGTGTCAGGCAGG + Intronic
950532101 3:13558166-13558188 CTGTGGTGGCCAAGGGAGCCTGG + Intronic
951145012 3:19216271-19216293 CAGTGCTAGCAGAGGCAGGCTGG + Intronic
952810769 3:37400594-37400616 CTGTTTTGGCTGAGGCTGGCTGG + Intronic
953707571 3:45243041-45243063 CTGTGTGGGCCCAGGTGGGCTGG + Intergenic
954028266 3:47800256-47800278 CTTTGGAGGCCCAGGCAGGCGGG - Intergenic
954415409 3:50391036-50391058 CTGGCTTGGCAGAGGCAGGCAGG + Intronic
956024992 3:64973868-64973890 CTGTGGAGGCCAAGGCAGGGGGG - Intergenic
959038136 3:101388254-101388276 CTGTGGTGGTGGTGGCAGGCTGG - Intronic
960747700 3:120908273-120908295 CTGAGGGGGCCGAGGTAGGCGGG - Exonic
960996767 3:123345311-123345333 CTGTGTTGGCCGAGGCAGGCTGG + Intronic
961558590 3:127713445-127713467 CTGTGTGGGCCCCAGCAGGCAGG - Intronic
963016235 3:140826762-140826784 CTGTGTAGGCAAAGGCAGGATGG - Intergenic
964812491 3:160680545-160680567 CTGTGTTGGCCTAGCCGGGCTGG + Intergenic
965728172 3:171742331-171742353 CTCTGGAGGCTGAGGCAGGCAGG - Intronic
968612067 4:1561793-1561815 CTCGGGTGGCCGAGCCAGGCAGG + Intergenic
969233599 4:5849577-5849599 ATGTGTTTGCAGAGGCTGGCAGG - Intronic
972052179 4:34750927-34750949 CTTTGGGGGCCGAGGCAGGCGGG + Intergenic
972130243 4:35824005-35824027 CTGTGTTGCCAGAGGCAGTCGGG - Intergenic
976237963 4:82920959-82920981 CTGTGTTGGCCAGGCCAGTCTGG + Intronic
978318525 4:107466974-107466996 CTGTGGGGGCCGAGGGAGGCTGG - Intergenic
978319591 4:107479099-107479121 CTGTGATGGTCTGGGCAGGCTGG - Intergenic
980094387 4:128474459-128474481 CTGTGAGGGCCGAGGTAGACAGG + Intergenic
984261694 4:177450655-177450677 CTGTGTTGCCCCAGGCTGGAGGG - Intergenic
985514626 5:335137-335159 CTGTGTTGGCAGTACCAGGCAGG + Intronic
985767058 5:1785725-1785747 CAGTGTTGGTCGGGGCAGGCAGG - Intergenic
985829216 5:2215618-2215640 CTGTGTTGGCAGAGGTGGGCAGG + Intergenic
987067651 5:14305214-14305236 CAGGGTTAGCCCAGGCAGGCAGG + Intronic
987210604 5:15678099-15678121 CTGAGTTGGCCAAGGGAGGCTGG + Intronic
989090742 5:37728103-37728125 TTTGGGTGGCCGAGGCAGGCAGG + Intronic
990272770 5:54162302-54162324 CTGAGTTGGCCATGGGAGGCAGG - Intronic
990488715 5:56283445-56283467 CTGTGTTGGCCTTCGCAGCCAGG + Intergenic
994648543 5:102498895-102498917 TTGGGTTGGCCCAGGCAGGACGG - Exonic
997930595 5:138069532-138069554 CTGAGTTTGCAGAGGAAGGCAGG + Intergenic
997978447 5:138454088-138454110 CTGTGTTGCACGGGGCAAGCGGG - Intergenic
998164675 5:139836281-139836303 CTGTGTTCCCCAGGGCAGGCAGG + Intronic
1000094832 5:157962530-157962552 TTGTGTTGGCCGGGGTAGGTAGG + Intergenic
1000720925 5:164705601-164705623 CTGTGTTGGTAGAGGTAGGATGG + Intergenic
1001095890 5:168775278-168775300 CTTTGGAGGCCAAGGCAGGCAGG - Intronic
1001734824 5:173989259-173989281 CTGCGATGGCGGCGGCAGGCCGG + Exonic
1003053268 6:2798495-2798517 CTGTGCTGGGCGGGGCAGCCTGG - Intergenic
1003403696 6:5811093-5811115 ATGTGGTTGCAGAGGCAGGCAGG + Intergenic
1007737038 6:43988141-43988163 CTGTTTTGGCTGAGGCAGGCTGG + Intergenic
1011970970 6:93222243-93222265 CTGTGTTGGCCAAGCCAGCAGGG - Intergenic
1013485969 6:110596400-110596422 GTGTGGTGGCCGTGGCAGGCTGG + Intergenic
1016969480 6:149749310-149749332 CTGGGTTGGGCGAGGTAGGACGG + Intronic
1017635951 6:156443250-156443272 CTGTGTAGGCATAGGCAGGTAGG - Intergenic
1018053150 6:160029179-160029201 CTGTGTTGGCCAGGGTAGTCTGG + Intronic
1019062314 6:169265358-169265380 CTGTGTTTTCCGTGGCATGCTGG - Intergenic
1019145794 6:169974900-169974922 ATGTGCTGGCAGAGGCTGGCAGG - Intergenic
1019480542 7:1264747-1264769 TTGTGTTGGCCGGGGCATGGGGG - Intergenic
1019631941 7:2054086-2054108 CTGTGTTGGGGGAGGTGGGCTGG - Intronic
1019987378 7:4667545-4667567 TTGGGAAGGCCGAGGCAGGCAGG + Intergenic
1021746347 7:23745139-23745161 CTGTGTTGGTAGTGGCAGGTTGG + Intronic
1022632402 7:32097706-32097728 CAGTGTTGGCTGAGGCTAGCTGG - Intronic
1026993417 7:74600792-74600814 CGGTGTTAGCAAAGGCAGGCAGG + Intronic
1027176468 7:75906962-75906984 CTTTGGAGGCTGAGGCAGGCAGG + Intronic
1028789299 7:94835188-94835210 CTGAGGAGGCTGAGGCAGGCAGG - Intergenic
1029416057 7:100443880-100443902 CTTTGTTGGCTGAGGCAGGAGGG + Intergenic
1030311523 7:108073814-108073836 CTAGGTTGGCCTTGGCAGGCTGG + Intronic
1030673910 7:112365241-112365263 CAGTGTTGGCTGAGGCTTGCAGG + Intergenic
1032201523 7:129825841-129825863 CGGGGTTGGCCGGGGCAGGGCGG - Intergenic
1033879949 7:145868987-145869009 CTGTGATGGTAGAGGCAGGTTGG + Intergenic
1035395059 7:158529363-158529385 CTGTGTCGGCAGAGGAAGGTGGG + Intronic
1035690967 8:1559377-1559399 ATTTGTTTGCTGAGGCAGGCTGG + Intronic
1036206789 8:6811503-6811525 CTGGGTGGGGCGATGCAGGCTGG + Exonic
1037910536 8:22741288-22741310 CTGGGTTGACGAAGGCAGGCAGG - Intronic
1038169384 8:25115073-25115095 CTGTGATGGCCTAGCCTGGCTGG + Intergenic
1038680200 8:29659811-29659833 ATATGCTGGCCAAGGCAGGCAGG + Intergenic
1039646535 8:39290430-39290452 CTGGCTTGGCCCAGGAAGGCAGG - Intergenic
1041117561 8:54554670-54554692 CTGTGGTTGCCGAGGGAGGGAGG + Intergenic
1041119382 8:54570962-54570984 CACTGGTGGCCTAGGCAGGCAGG + Intergenic
1041570562 8:59333164-59333186 CTGTCTTGGCTGAGTCATGCAGG + Intergenic
1042935024 8:74049908-74049930 CTCTGCTGGCTGAGGCAGGAGGG + Intergenic
1043932692 8:86108674-86108696 CTCTGGAGGCCGAGGCAGGAGGG - Intronic
1044530904 8:93306525-93306547 ATGTGGTTGCAGAGGCAGGCAGG - Intergenic
1044869015 8:96600289-96600311 ATGTGTTGTCCGAGGAAGCCTGG + Intronic
1045031309 8:98139091-98139113 TTTGGTAGGCCGAGGCAGGCGGG - Intronic
1049744689 8:144258305-144258327 CAGTGTCGGCTGAGGCTGGCTGG - Intronic
1054749267 9:68887730-68887752 GGGTGTTGGCAGAGGCGGGCAGG + Intronic
1055792554 9:79938100-79938122 CTTTGGAAGCCGAGGCAGGCAGG + Intergenic
1057231407 9:93323785-93323807 CTGTGTGGGCCGGGGCAGGAGGG + Intronic
1057236688 9:93366838-93366860 CTGTGTGGGCTGGGGCAGGAGGG - Intergenic
1057261725 9:93588213-93588235 CTGTGTGGCCCTAGGCAGGCAGG + Intronic
1057646237 9:96877532-96877554 CAGTCTTGGCGGAGCCAGGCGGG - Intergenic
1057771090 9:97968700-97968722 TTTTGGTGGCCGAGGCAGGAGGG + Intergenic
1058200190 9:102028829-102028851 CTGTGTTGCCAGTGGCTGGCCGG + Intergenic
1060355961 9:122907306-122907328 TTTTGGAGGCCGAGGCAGGCGGG - Intergenic
1061309924 9:129755455-129755477 CTGTGTGGCCTTAGGCAGGCAGG + Intergenic
1061840094 9:133353702-133353724 CTGTCCTGGCAGAGGCAGTCAGG - Intronic
1062432832 9:136533576-136533598 CTGCTGTGGCCGTGGCAGGCAGG - Intronic
1185746298 X:2576171-2576193 TTGGGGAGGCCGAGGCAGGCGGG - Intergenic
1187424206 X:19162513-19162535 CTTTGGAGGCCGAGGCAGGAGGG - Intergenic
1190717091 X:53114145-53114167 CTTGGGAGGCCGAGGCAGGCAGG - Intergenic
1190797817 X:53760543-53760565 CTGTGTTGGCAAGGCCAGGCTGG - Intergenic
1190917344 X:54820667-54820689 CTGTGTTGGCAAGGCCAGGCTGG + Intergenic
1193112523 X:77743814-77743836 CTGTGTTGGCAGTTCCAGGCAGG - Intronic
1194598700 X:95892569-95892591 GTGTGTTGGGGGAGGAAGGCGGG + Intergenic
1197263976 X:124346847-124346869 GGGTGGAGGCCGAGGCAGGCAGG + Intronic
1197804398 X:130385226-130385248 CTGTGTGGGCCGAGAAGGGCTGG + Exonic
1199761088 X:150904525-150904547 CTGTGTGTGCCAAGTCAGGCAGG + Intergenic