ID: 960996807

View in Genome Browser
Species Human (GRCh38)
Location 3:123345589-123345611
Sequence GGCTCAGGTTTAAAGTGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 146}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960996807_960996819 29 Left 960996807 3:123345589-123345611 CCTTCCCACTTTAAACCTGAGCC 0: 1
1: 0
2: 0
3: 15
4: 146
Right 960996819 3:123345641-123345663 TTTCCTCACATGTCCTAAGGGGG 0: 1
1: 0
2: 0
3: 11
4: 231
960996807_960996818 28 Left 960996807 3:123345589-123345611 CCTTCCCACTTTAAACCTGAGCC 0: 1
1: 0
2: 0
3: 15
4: 146
Right 960996818 3:123345640-123345662 GTTTCCTCACATGTCCTAAGGGG 0: 1
1: 0
2: 0
3: 33
4: 377
960996807_960996815 -1 Left 960996807 3:123345589-123345611 CCTTCCCACTTTAAACCTGAGCC 0: 1
1: 0
2: 0
3: 15
4: 146
Right 960996815 3:123345611-123345633 CTATGGGATCTGTTCTAATAGGG 0: 1
1: 0
2: 0
3: 8
4: 156
960996807_960996816 26 Left 960996807 3:123345589-123345611 CCTTCCCACTTTAAACCTGAGCC 0: 1
1: 0
2: 0
3: 15
4: 146
Right 960996816 3:123345638-123345660 CTGTTTCCTCACATGTCCTAAGG 0: 1
1: 0
2: 5
3: 59
4: 823
960996807_960996814 -2 Left 960996807 3:123345589-123345611 CCTTCCCACTTTAAACCTGAGCC 0: 1
1: 0
2: 0
3: 15
4: 146
Right 960996814 3:123345610-123345632 CCTATGGGATCTGTTCTAATAGG 0: 1
1: 0
2: 0
3: 10
4: 97
960996807_960996817 27 Left 960996807 3:123345589-123345611 CCTTCCCACTTTAAACCTGAGCC 0: 1
1: 0
2: 0
3: 15
4: 146
Right 960996817 3:123345639-123345661 TGTTTCCTCACATGTCCTAAGGG 0: 1
1: 0
2: 3
3: 44
4: 563

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960996807 Original CRISPR GGCTCAGGTTTAAAGTGGGA AGG (reversed) Intronic
900493708 1:2966540-2966562 GGTTCAGGCCTAAGGTGGGATGG - Intergenic
901538977 1:9902416-9902438 GGTTAAGGCTTTAAGTGGGAAGG + Intronic
903061293 1:20670574-20670596 GGCTCAGGCTTAAACAGGGGAGG + Intronic
904644828 1:31957856-31957878 GGCACAGCTTAAAAGTGGGAGGG - Intergenic
905414523 1:37794864-37794886 GGCCCAGGATGAGAGTGGGAGGG - Intronic
906399800 1:45496555-45496577 GGCTCAGGTTGGCAGTTGGAAGG - Exonic
907799722 1:57752461-57752483 GGCTCAGCTTTTAGCTGGGATGG + Intronic
908497435 1:64708715-64708737 GGCTCAGGGAAAAGGTGGGAGGG + Intergenic
908645806 1:66276424-66276446 ATCTGAGGTTTACAGTGGGATGG - Intronic
910039224 1:82828183-82828205 GGCATAGGCTTAGAGTGGGATGG - Intergenic
910857970 1:91715065-91715087 AGCTCAGCTTCATAGTGGGAGGG - Intronic
912623862 1:111192019-111192041 AGCTCAGGCTTAAAGAGGTAAGG + Intronic
913106771 1:115621932-115621954 GGCTCAAGTTTACACTGGCATGG + Intergenic
914246783 1:145892158-145892180 GTCTCAGGTTTCAGGGGGGATGG + Exonic
915645970 1:157272682-157272704 GGCTCAGTTTTAGAGTCTGAGGG + Intergenic
915727849 1:158031463-158031485 GGCTCAGGGGCCAAGTGGGATGG + Intronic
916252697 1:162754275-162754297 GGCTGAGTTTGAAAGAGGGAAGG + Intronic
916262270 1:162854204-162854226 TGAGCAGGTTGAAAGTGGGAGGG + Intronic
916774070 1:167941687-167941709 GCTTCAGGTTTAAGGTGGGCAGG + Intronic
1063935504 10:11073601-11073623 GACTCTGGTTTCAAGTGGAATGG + Intronic
1066485409 10:35838220-35838242 TGCCCAGGTTTATAATGGGAAGG + Intergenic
1067306110 10:45065393-45065415 TGCCCAGGTTTATAATGGGAAGG + Intergenic
1068276283 10:54802307-54802329 GGCTCAGTTTTCCAGAGGGAGGG + Intronic
1070498303 10:77045598-77045620 GGCTGAGGTTTCCAGTTGGAAGG - Intronic
1077597159 11:3543772-3543794 GGCTCAGGGGGAAGGTGGGAGGG - Intergenic
1077968735 11:7164924-7164946 GATTCAGGTTTAATTTGGGAAGG - Intergenic
1081757817 11:45557094-45557116 GGCTGAGGTCTGGAGTGGGAAGG + Intergenic
1081771595 11:45653512-45653534 GGGTCAGGTTTAAAGTAGAGGGG - Intronic
1083486867 11:62988575-62988597 GGCACAGGCTTAGAGAGGGAGGG - Intergenic
1083579836 11:63818019-63818041 GGCTCAGGTCCAAGGTGTGAGGG - Exonic
1083792255 11:64993647-64993669 GGTTCAGGGTTAAAATGGGCAGG - Intronic
1084100821 11:66947623-66947645 GGCCAAGGTGGAAAGTGGGAAGG + Intronic
1084253089 11:67917743-67917765 GGCTCAGGGGGAAGGTGGGAGGG - Intergenic
1087049551 11:93871658-93871680 GACACAGGTGTGAAGTGGGATGG - Intergenic
1088115229 11:106305137-106305159 GGGCCAGGTTTAAAGGGGGTGGG + Intergenic
1090523044 11:127499263-127499285 GGGTCAGGTTTACATGGGGAAGG + Intergenic
1091096162 11:132824087-132824109 GGCTGAGATTTAAACTGGAAAGG - Intronic
1093368924 12:18341634-18341656 GGCTCACATTTAAAATGGGATGG - Intronic
1093475071 12:19545730-19545752 GGCTAAGGCTTCAAATGGGAAGG + Intronic
1097045911 12:56187995-56188017 GGCTCAGGTTCAAATTAGAATGG - Intronic
1102729143 12:115092625-115092647 GGGCCAGGATGAAAGTGGGAAGG - Intergenic
1104743208 12:131193882-131193904 GTCTCATGTTGAAAGGGGGAGGG + Intergenic
1108168836 13:47720491-47720513 GGCTAAGGTTCAAAGAAGGAAGG + Intergenic
1109710241 13:66149766-66149788 GCCTCAGGCTCAAAGAGGGAAGG - Intergenic
1110657349 13:78015914-78015936 GACTCAGGGGAAAAGTGGGAGGG - Intergenic
1112980213 13:105374836-105374858 GTCTCAGCTTTATGGTGGGATGG + Intergenic
1113965397 13:114150270-114150292 GGTCCAGGTTTAATCTGGGAAGG - Intergenic
1115432423 14:33335298-33335320 GGATCAGGTTTAAAATGGCATGG + Intronic
1117443951 14:55785782-55785804 AGCTCATGTTTCAAGTGGGTAGG + Intergenic
1121324111 14:93009907-93009929 GGGTCAGGTAGAAAGTGGCAAGG - Intronic
1122671095 14:103373062-103373084 AGCTCAAGTTCAAGGTGGGAAGG + Intergenic
1122680468 14:103457444-103457466 GGCTCAGTTGTAAAAAGGGAAGG - Intronic
1124023204 15:25942559-25942581 GGCTCTGCTTTAAAGTGAAATGG + Intergenic
1124100466 15:26688355-26688377 TGCTGAAGTTTAGAGTGGGAAGG - Intronic
1126917950 15:53486859-53486881 GAGTCAGGTATACAGTGGGATGG - Intergenic
1127925255 15:63533357-63533379 TGCTCAGGTTTAAACTGGGGTGG - Intronic
1128238207 15:66081678-66081700 TTCTCATCTTTAAAGTGGGAAGG - Intronic
1129254157 15:74324807-74324829 GGCGCAGGTCTGGAGTGGGAAGG - Intronic
1132318563 15:100908663-100908685 GGCTGAGGATGTAAGTGGGAAGG - Intronic
1133983571 16:10651272-10651294 GGCTGCAGTTTAAACTGGGATGG - Intronic
1134452790 16:14373683-14373705 GGCTCAGGGTTCACGGGGGAAGG - Intergenic
1138329608 16:56203119-56203141 GGCTCAGGATTAAGCTGGGAGGG + Intronic
1139096507 16:63710849-63710871 GGCTGAGGCTTGAACTGGGAAGG + Intergenic
1143374981 17:6462034-6462056 GGCTCAGGTTAGATGTGGGTAGG - Intronic
1144753892 17:17668105-17668127 GGCCCAGGTGTAAGGAGGGAGGG - Intergenic
1147219582 17:38920496-38920518 GGCTCAGGATGAAAATGGGATGG - Exonic
1148716001 17:49716381-49716403 GACTGAGGTGTAAAGTGGCAAGG + Intronic
1149547483 17:57514730-57514752 GGCTCAGGGATTAAGTAGGAGGG + Intronic
1150192723 17:63260119-63260141 TGTTTAGCTTTAAAGTGGGAAGG + Intronic
1150486876 17:65550175-65550197 GGCCCAGGGTCAAAGTGAGAAGG - Intronic
1150902741 17:69299690-69299712 GGCTCAGGGAAAAGGTGGGAGGG + Intronic
1156597866 18:38568375-38568397 GTCTCATGTATAAAGTGGGCTGG - Intergenic
1158270597 18:55710796-55710818 GAATCAGGTGTGAAGTGGGAAGG - Intergenic
1162299275 19:9835137-9835159 GGCGCAGGGATAACGTGGGAGGG + Intergenic
1162901642 19:13798682-13798704 TTCTCAGGTGTAAAGTGGGGAGG - Intronic
1164106402 19:22109912-22109934 GGCTCAAATATAAAGTGAGAGGG - Intergenic
1166391663 19:42411955-42411977 GGCTCAGGTTTTAAGTGAGGAGG + Intronic
1166644967 19:44524933-44524955 GGGTCAGGGGTAAAGAGGGAGGG - Intronic
1167163502 19:47782411-47782433 GGCTCAGGTTTACAGTGTGTTGG - Intronic
1167903843 19:52642121-52642143 GACTCAGGTGTACAGAGGGACGG + Intronic
1168300432 19:55401774-55401796 GGCTCAGGGTCACAGTGGGTCGG + Intronic
925529102 2:4839796-4839818 GTCTCTGGTTTAAAGTAGAAAGG - Intergenic
926101437 2:10120731-10120753 GACTCAGGTTTAGCGCGGGAGGG + Intergenic
930735164 2:54770977-54770999 GGAGCAGGTTTAATGTGGGGTGG + Intronic
932453988 2:71834563-71834585 GGCTGAGGATGAAAGTGGGTGGG + Intergenic
933725994 2:85427586-85427608 GGCTGAGGTTTACAGTGGGGTGG + Intronic
937734300 2:125271111-125271133 GGCTCAGAGTTAAAGTTAGAGGG + Intergenic
938525008 2:132121018-132121040 AGCTCAAATTTGAAGTGGGAGGG - Intergenic
941184635 2:162306316-162306338 TTCTCTGGTTTAAACTGGGATGG - Intronic
942276861 2:174329294-174329316 GGCTCAGATTTGAAGAGGGAAGG + Intergenic
946251507 2:218416735-218416757 GACTCACGTTTCAGGTGGGATGG - Intergenic
946330985 2:219009314-219009336 GCCCCAGGGGTAAAGTGGGATGG - Intronic
1171320791 20:24242335-24242357 CTCTCAGGGTTACAGTGGGATGG - Intergenic
1175483364 20:59327030-59327052 GGCTCAGGATTCTAGTGAGAGGG + Intergenic
1178841427 21:36140644-36140666 TGCTCAGTTTTTTAGTGGGATGG - Intronic
1181264125 22:21620473-21620495 GGCACTGTTTTACAGTGGGAAGG + Intronic
1181865669 22:25852867-25852889 TCCTCATGTGTAAAGTGGGAAGG + Intronic
1182504443 22:30771784-30771806 GGCTGAGCTTGAAGGTGGGAAGG + Intronic
1185021798 22:48380704-48380726 GGCTCAGGTATGAAGAGGGCCGG + Intergenic
1185170763 22:49292513-49292535 GGGTCAGGTTGAAACTAGGAGGG - Intergenic
954852776 3:53617593-53617615 TCCTCAGCTGTAAAGTGGGATGG - Intronic
955660532 3:61294282-61294304 GCCTCAGGTTGAAATTGGAAAGG - Intergenic
955799337 3:62669627-62669649 TGCTCAGCTTTAAAGTGGAAAGG - Intronic
956389452 3:68755798-68755820 AACTCTGGTTTAATGTGGGAGGG - Intronic
957067160 3:75534243-75534265 GGCTCAGGGGGAAGGTGGGAGGG - Intergenic
958055401 3:88404548-88404570 GACTGAGGCTTAAAGAGGGAAGG - Intergenic
960796340 3:121492156-121492178 GAGTCAGGTTTAAAGTGAGTGGG + Intronic
960996807 3:123345589-123345611 GGCTCAGGTTTAAAGTGGGAAGG - Intronic
961285990 3:125803739-125803761 GGCTCAGGGGGAAGGTGGGAGGG + Intergenic
962369292 3:134807459-134807481 GGGTCAGACTTAGAGTGGGAAGG + Intronic
964979796 3:162665297-162665319 GGCCCAGGAATGAAGTGGGAAGG - Intergenic
969011753 4:4070827-4070849 GGCTCAGGGGGAAGGTGGGAGGG - Intergenic
969652048 4:8473824-8473846 GGCTCAGGTGTTAAGAGGGGCGG + Intronic
969801714 4:9571762-9571784 GGCTCAGGGGGAAGGTGGGAGGG + Intergenic
972648183 4:40990131-40990153 TACTCAGCTTTAAAGTGGAAGGG + Intronic
973759227 4:54101350-54101372 GTCACAGGATTAAAGAGGGATGG - Intronic
975980240 4:80149144-80149166 TTTTCATGTTTAAAGTGGGAGGG - Intergenic
977905551 4:102474113-102474135 TGCTAAGGGTTAAAGAGGGATGG + Intergenic
978390553 4:108220730-108220752 GGCTCAGTTGAAAAGAGGGAAGG - Intergenic
979859143 4:125671955-125671977 GCCTCATGTTTTAAGTGGGAGGG - Intergenic
986433026 5:7700560-7700582 GTCTCAGGATTAAAGTAGAAAGG + Intronic
987886347 5:23818204-23818226 ATCTCAGGTTTAAAGTGAGTTGG + Intergenic
989262158 5:39430256-39430278 GCCTCAGTTTTAAAATGGAATGG + Intronic
991507042 5:67336421-67336443 AGCTCACGTTCAAGGTGGGAAGG + Intergenic
992136723 5:73753296-73753318 GGTTCAGGTAAAAAGTGGGCAGG - Intronic
994383612 5:99101659-99101681 GGCTAAGGTTTCAATTAGGAGGG - Intergenic
995786855 5:115840204-115840226 GAGTCTGATTTAAAGTGGGAAGG + Intronic
997579179 5:135006413-135006435 AGATCAGGTTTTGAGTGGGAAGG - Intronic
998418377 5:141961725-141961747 GGCTGAGGGGTGAAGTGGGAAGG + Intronic
1004182763 6:13395255-13395277 GGCTAAGGTTTCAGGAGGGAGGG + Intronic
1006027496 6:31156902-31156924 GGCCGAGCTTGAAAGTGGGAGGG + Exonic
1006196085 6:32243472-32243494 GGCTGAGGTTTAGGATGGGAGGG + Intergenic
1009428327 6:63539377-63539399 GGTTGAGGTTGGAAGTGGGATGG - Intronic
1009906255 6:69873189-69873211 AGCTCAGGTTTTAGGTGGGCAGG - Intronic
1010135173 6:72543186-72543208 AGCTCTGGTTTGAGGTGGGAGGG + Intergenic
1010811554 6:80306311-80306333 GGCTGAGGTTTAAAGTGTCTAGG + Intronic
1011674162 6:89715184-89715206 GGAGCAGGTTTAATGTGGGGAGG - Intronic
1016259216 6:142147489-142147511 AGCTCAGGTTTAAAGCGAGGGGG - Intronic
1017887469 6:158610910-158610932 GGCTGAGGGTTTCAGTGGGACGG + Intronic
1019125315 6:169836009-169836031 GGCTAGGGTTTACAGTGTGATGG - Intergenic
1023039289 7:36158221-36158243 GGCATAGGTCTAAAGTGAGAAGG - Intronic
1023614937 7:42010287-42010309 GGCTGCGGCTTAAAGTGGGACGG + Intronic
1026409569 7:70106118-70106140 TGCGCAGGTTAAAAATGGGAGGG + Intronic
1026988312 7:74568813-74568835 GGGTCAGGTTTCTAGAGGGAGGG + Intronic
1034902896 7:154918477-154918499 TACTCAGGTGTAAAGTGTGAGGG + Intergenic
1036247537 8:7131504-7131526 GGCTCAGGGGGAAGGTGGGAGGG + Intergenic
1036886730 8:12562499-12562521 GGCTCAGGGGGAAGGTGGGAGGG - Intergenic
1037498774 8:19465589-19465611 GGATCAGATTTAAAAGGGGAAGG - Intronic
1038494261 8:27990504-27990526 GGCTTATGTTTAAAATGGGAGGG - Intronic
1041396186 8:57393935-57393957 GGCTCAGTTTTAAATTTGGGTGG + Intergenic
1046604640 8:116357564-116357586 GAGTCAGGGTGAAAGTGGGAAGG - Intergenic
1047724534 8:127672354-127672376 GGCTTTGGTTTTAAGTGGGCTGG - Intergenic
1048437926 8:134434873-134434895 GCATCAGGTCAAAAGTGGGAAGG - Intergenic
1055759927 9:79596535-79596557 GGAACAGATCTAAAGTGGGATGG - Intronic
1062345832 9:136114749-136114771 GGCTGAGGGTGAAGGTGGGACGG - Exonic
1186388246 X:9131910-9131932 GGGTCAGCTATAAAGTGGGATGG + Intronic
1189620794 X:42835129-42835151 GGTTAAGGTTGAAAGAGGGAGGG + Intergenic
1190689009 X:52898049-52898071 GTCTCATGTTTAGAGAGGGAGGG + Exonic
1190696974 X:52957743-52957765 GTCTCATGTTTAGAGAGGGAGGG - Intronic
1191785621 X:64914552-64914574 AGCTCAGGTTTAAAGGGTAAGGG - Intergenic
1192244344 X:69360415-69360437 GACTCAGGTTGAGAGTGGGTGGG + Intergenic
1196458368 X:115905735-115905757 TGTTTAGGTTTAAACTGGGAGGG - Intergenic