ID: 960996832

View in Genome Browser
Species Human (GRCh38)
Location 3:123345705-123345727
Sequence CTGTGACTGAGGAGCCACCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 218}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960996832 Original CRISPR CTGTGACTGAGGAGCCACCA GGG (reversed) Intronic
900944156 1:5820265-5820287 CTGAGACTCCGGATCCACCATGG + Intergenic
902386496 1:16078896-16078918 CTGTCACATAGCAGCCACCATGG - Intergenic
904401198 1:30257845-30257867 CTGTGACAGAGAGGGCACCACGG + Intergenic
904677813 1:32209075-32209097 CTCTGACTGAGGATACACTATGG + Exonic
905882282 1:41472007-41472029 CTTTGACTGAGGAGGCAGTATGG + Intergenic
907297019 1:53461701-53461723 CTGGGACTGAGGATCCATCAAGG - Intronic
911735104 1:101328404-101328426 AAGTGACTGAGGTGCCATCAAGG + Intergenic
911967641 1:104387595-104387617 CTGTGGCTGAGGAGTCAACCTGG - Intergenic
912965651 1:114235003-114235025 CTGTGACTGAGGAACCAGAGTGG + Intergenic
913352139 1:117873781-117873803 TGGTGACTGAGTAGCCACTAAGG - Intronic
915329925 1:155104716-155104738 ATGTGAATGGAGAGCCACCAAGG - Intergenic
923682109 1:236126707-236126729 GAGGGACTGACGAGCCACCATGG - Intergenic
924419793 1:243897413-243897435 CTCTGCATGAGGAGGCACCAGGG - Intergenic
1063115649 10:3069425-3069447 CTTTGACTGAGAAGCCACTCTGG - Intronic
1066191875 10:33063491-33063513 TTGAGACTGAGGATCCTCCAGGG - Intergenic
1067233507 10:44427750-44427772 GGGTGACTGAGGAGGCACCCAGG - Intergenic
1067437890 10:46291818-46291840 CTGGGACTGAGGAGCTTCCTGGG - Intronic
1068715927 10:60188270-60188292 CTGTGCCTCAGGAGCCATCAGGG + Intronic
1068950831 10:62775467-62775489 CTGAGGCTGAGGAGGCAGCATGG - Intergenic
1071089134 10:81898368-81898390 CTGTCACTGAGGAGCTATCTGGG - Intronic
1072629238 10:97134233-97134255 CTGTGACTGTGGGGACACAAAGG - Intronic
1073299073 10:102459792-102459814 CAGTTCCTGAGGAGCCCCCAGGG - Intergenic
1073302864 10:102481491-102481513 GTGTGACAGGGGAGCCACCTGGG + Intronic
1074846111 10:117399516-117399538 TTGTGACTGTGTAACCACCATGG + Intergenic
1075635697 10:124028913-124028935 CTGTCATTGAGGAGCCAGCTGGG - Intronic
1076330614 10:129662344-129662366 CTGTGACTGAGGGGCCTCCCAGG + Intronic
1076783542 10:132737608-132737630 CTGTGGCTGAGGAGCTGGCAGGG - Intronic
1076830795 10:132993231-132993253 CTGTGTCTGAGGGTCCCCCATGG + Intergenic
1077141922 11:1028523-1028545 CTGTGTCCGGGGAGCCCCCAGGG - Intronic
1077208078 11:1353589-1353611 CTGTGAGTGAGTGGCCTCCATGG + Intergenic
1079478310 11:20854859-20854881 CTGTGACTTAGCAGCATCCAAGG - Intronic
1081502655 11:43681311-43681333 GTGTGACTGAGGAGGCAGCAGGG - Intronic
1083547974 11:63563113-63563135 CTGAGGCTGGGGAGCCTCCAGGG + Intronic
1089305542 11:117524136-117524158 CTGCTGCTGAGGAGCCCCCAAGG - Intronic
1089681262 11:120120204-120120226 CTGGGTCTGAGCAGCCACCTTGG - Intronic
1089692905 11:120197843-120197865 CTGTTGCTCAGGATCCACCAGGG - Intergenic
1089832154 11:121338271-121338293 CTGTAACTGAGGCGTCCCCAGGG - Intergenic
1090026367 11:123170824-123170846 CTGTGACCAAGGAGGCAGCAGGG - Intronic
1095870727 12:47024991-47025013 ATGTGTCAGAGTAGCCACCAAGG + Intergenic
1100738193 12:97561674-97561696 CTCTGAATGAGCAGCCACCAAGG - Intergenic
1102441289 12:112965740-112965762 CTTTGGCTGAAGAGCCACCCTGG - Exonic
1103340817 12:120220316-120220338 CCGTGCCTGTGGAGCCACCCAGG + Intronic
1104370519 12:128220121-128220143 CTGTTACTGATGAGTTACCATGG - Intergenic
1104635670 12:130436801-130436823 TGGGGACTGAGGAGCCACCGAGG + Intronic
1105608460 13:21946905-21946927 AAGTGCCTGAGGGGCCACCAAGG - Intergenic
1106440765 13:29766685-29766707 CTGTGCCAGTGCAGCCACCACGG + Exonic
1106785822 13:33107309-33107331 CAGTCTCTGAGAAGCCACCAAGG + Intronic
1106969088 13:35114489-35114511 CTGGGGCTGAGGAGACAACAAGG - Intronic
1109907430 13:68863840-68863862 CTGAGACTGAGCAGCAAGCAAGG - Intergenic
1114656407 14:24318548-24318570 AGGTGACTGAGGAGACAGCATGG - Exonic
1118391305 14:65298114-65298136 CTGTGGAATAGGAGCCACCAAGG - Intergenic
1119113682 14:71998491-71998513 CTGGGACTGGAAAGCCACCATGG + Intronic
1119426945 14:74541896-74541918 ATCTGGCTGAGGAGCCACAAGGG - Intronic
1121840357 14:97129097-97129119 CTCTCACAGAGGTGCCACCAAGG + Intergenic
1122068942 14:99193062-99193084 CTGTCACTGATCAGCCACCGTGG + Intronic
1122413298 14:101536934-101536956 CTGTGATCGAGGCCCCACCAGGG + Intergenic
1122800613 14:104227653-104227675 CTGGGATTTAGGGGCCACCAGGG + Intergenic
1122820018 14:104337527-104337549 CTCTGTCTGAGCAGCCAGCAGGG + Intergenic
1124457662 15:29859257-29859279 CTTTGACTGATGAGACACTATGG + Intronic
1124601609 15:31137136-31137158 CAGTGACTGAGGAGTCACTGTGG + Intronic
1124687198 15:31792606-31792628 CTCAGACTGAGGAGTCAGCAAGG - Intronic
1125178990 15:36859826-36859848 CAGTGCCTGAGGAGTCAGCAAGG + Intergenic
1125796788 15:42409286-42409308 CTGTGGCTGTGGAGGCACAAAGG - Exonic
1125868222 15:43075041-43075063 CTGTGACTGTGGAGACACAGAGG - Exonic
1126562180 15:50055926-50055948 CTGATACTGAGGAACTACCAGGG - Intronic
1127873434 15:63091741-63091763 CTCTCACTGAGGAGCCAACCAGG + Intergenic
1128678725 15:69630786-69630808 CTGTGACTGAGAAACCACACAGG - Intergenic
1128774798 15:70311995-70312017 CTGTGATTGAGGAGGGAACAGGG - Intergenic
1128830298 15:70762917-70762939 CGGGGACTGGGGAGCCAACACGG + Intronic
1129719823 15:77871960-77871982 CTGTGCCTGAGCAGCCCCGAGGG + Intergenic
1131113847 15:89782037-89782059 CTGAGTCAGAGGAGCCACCAAGG + Intergenic
1131380086 15:91956224-91956246 CTGCTGCTGAGAAGCCACCAGGG - Intronic
1131393692 15:92069815-92069837 CTGTGGCTGAGAACCCACCCAGG + Intronic
1131869357 15:96745607-96745629 CTGTGGCTGAGGATCCAGCATGG - Intergenic
1133050458 16:3114539-3114561 CTGTGGATGAGGCCCCACCAGGG + Intronic
1133718036 16:8468098-8468120 CTGAGACTGAGGTGTCAGCAGGG + Intergenic
1137718695 16:50614464-50614486 CTGTGGGGGAGAAGCCACCAGGG - Intronic
1137776822 16:51062250-51062272 AGGTGAGTGAGTAGCCACCAGGG + Intergenic
1138135671 16:54519493-54519515 CAGTGACTGAGGATCTCCCAGGG + Intergenic
1138208159 16:55140348-55140370 TTGTGTCTGAGGAGTCTCCAGGG + Intergenic
1140756396 16:78071401-78071423 CTTTGCCTGAGGAGCCAAGAGGG + Intergenic
1141289287 16:82702816-82702838 CTGTGCCTGATGAGGCACCAGGG - Intronic
1142284918 16:89167755-89167777 CAGTGACAGAGGAGCCAACCAGG - Intergenic
1143269464 17:5665132-5665154 CGGGGCCTGAGGAGCCCCCAAGG + Intergenic
1144518759 17:15940316-15940338 CAGAGACTGAGGAGCCTCCTGGG + Intergenic
1144965868 17:19076990-19077012 CTGTGCCTGAAGACTCACCAAGG - Intergenic
1145398886 17:22515590-22515612 CAGAGAGTGAAGAGCCACCAAGG + Intergenic
1147626759 17:41905428-41905450 CTTCGTCTGAGGAGTCACCAAGG - Intronic
1153744874 18:8167416-8167438 CTGTGACTCCTGAGTCACCAAGG - Intronic
1155083113 18:22430066-22430088 CTGTGAGTGAGGGGCCTCCTTGG + Intergenic
1157626425 18:49054978-49055000 CTGTGACAGAGGTCCTACCAGGG - Intronic
1157766733 18:50303022-50303044 CTGTGACTGAGAAGTCACTGTGG + Intergenic
1158545100 18:58389356-58389378 CAGTTACAGAGGAGCCACCACGG - Intronic
1160023932 18:75204099-75204121 TTGGGACTGTGGAGACACCAGGG - Intronic
1160927436 19:1553682-1553704 CTGGGACTTAGAACCCACCAGGG - Intergenic
1161156032 19:2732326-2732348 CTGTGCCTCAGGAGCCAGCTGGG - Intronic
1162110009 19:8394955-8394977 ATGGGGCTGAGGAGCCACTAAGG + Intronic
1163827394 19:19531272-19531294 CTGTGGCTCTGGAGACACCAAGG + Intronic
1163860267 19:19739098-19739120 CAGAGACTGAGGAGCACCCATGG + Intergenic
1164575248 19:29401982-29402004 CTGAGACAAAGGAGCCTCCAGGG + Intergenic
1166746294 19:45143403-45143425 CTGGGACTGCGGGGCCTCCATGG + Intronic
1166901469 19:46067303-46067325 CTGGGACTGAGGTGCCACAGAGG - Intronic
1167509242 19:49887651-49887673 CTGGGCCTGAGGTCCCACCAGGG - Intronic
1167615839 19:50532618-50532640 GTGTGACTGATGAGGGACCAGGG - Intronic
925082562 2:1081628-1081650 CAGTGCCTGTGGAGGCACCAAGG - Intronic
926547141 2:14255659-14255681 CTGTGGGGGAGGCGCCACCACGG - Intergenic
927240992 2:20919367-20919389 ATGTGATTGATGAGCCACCGAGG - Intergenic
929762162 2:44815480-44815502 CTGTGACTGGGGGGCCACCTGGG + Intergenic
930092742 2:47543153-47543175 CTGTGAATAAGGAGCTACCAGGG + Intronic
932536015 2:72596325-72596347 CTGTTACTGGGTAGGCACCAGGG - Intronic
933280058 2:80323073-80323095 CTGTCTCTGAGGAGTGACCAGGG + Intronic
933818214 2:86086030-86086052 CTGTGCCTGAGTAGTCCCCATGG - Intronic
934474898 2:94587354-94587376 CTTTAACTGAGAAGCCCCCAAGG + Intergenic
936017642 2:108971917-108971939 ATGTGACTGAGCAGCAGCCACGG - Intronic
936093041 2:109512958-109512980 AGGTGACTGAGAAGCCACCCAGG - Intergenic
936095423 2:109527465-109527487 CAGAGACTGGGGAGCCACCATGG + Intergenic
937082274 2:119148628-119148650 CTGTGTGTTAGGAGACACCAAGG - Intergenic
937965518 2:127505327-127505349 CTGAGAGTGAGGAACCCCCAAGG - Exonic
938518803 2:132044166-132044188 CTGAGACTGAGGTGTCAGCAGGG + Intergenic
945191545 2:207193217-207193239 CTGTGTCTGTGGAGCCACGAAGG + Intergenic
945398504 2:209351198-209351220 CTCTGACTGCAGAACCACCAGGG + Intergenic
946016864 2:216610923-216610945 CTATAACGGAGGAGCCATCATGG - Intergenic
947564478 2:231185367-231185389 CTGGGACTGAGCAGCCTCCCAGG + Intergenic
947651942 2:231794249-231794271 GTGGGACTGAGCAGCCAACAAGG + Exonic
948541214 2:238692546-238692568 CAGTGACTGAGGGGACACTAAGG - Intergenic
948704773 2:239782093-239782115 CTGAGACTGAGGTGTCAGCAGGG - Intronic
1169199075 20:3698962-3698984 CTGGGACAGAGGAGCCCACAGGG + Intronic
1170309832 20:14980696-14980718 CAGTTACTGAGTATCCACCAAGG - Intronic
1171386052 20:24770094-24770116 CCCTGACTGAGAAGCCAACAGGG + Intergenic
1172486663 20:35302451-35302473 CTGTGGCTGGGGAGCTACCCTGG + Intergenic
1174239661 20:49123230-49123252 CTGTGGCTGAGGAACAAACAAGG + Exonic
1174768126 20:53272912-53272934 CTGAGAATGAGGGGCTACCAAGG + Intronic
1175494606 20:59404878-59404900 CTGTGACTGAGAGGCCCCCGTGG - Intergenic
1175960504 20:62634260-62634282 CTGTGTCTGAGGAGCTGCAAGGG - Intergenic
1176034963 20:63031713-63031735 GTGTGGCAGAGGAGCCCCCAGGG - Intergenic
1179612749 21:42563083-42563105 CAGTGACTGGGGAGGCAGCAAGG + Intronic
1180597552 22:16988507-16988529 CCATGACAGAGGAGCCACCATGG - Intronic
1181084503 22:20433236-20433258 CTGAGAAGGAAGAGCCACCAAGG + Intronic
1181421709 22:22803733-22803755 CTCTGCCTGAGGAGGCAACATGG + Intronic
1181963861 22:26643018-26643040 CTCTGAGTCAGCAGCCACCAGGG + Intergenic
1183424489 22:37731917-37731939 CTGTGCCTGAGGAGCCATGCTGG - Intronic
1183717152 22:39540201-39540223 CTGTGGCTGAGGAAACCCCAGGG - Intergenic
1184311055 22:43643124-43643146 ATTTGATTGAGGAGCTACCAGGG + Intronic
1184774804 22:46617778-46617800 CTGTGACAGGGAAGCCACCCAGG - Intronic
1184826584 22:46956761-46956783 GTGTGAGTGAGGAGACACTAGGG + Intronic
1185032085 22:48449524-48449546 CTGAGTCTGAGGAGCCATCCAGG + Intergenic
949952162 3:9238307-9238329 CCCTGACTGAGGAGGGACCAAGG - Intronic
950578910 3:13850365-13850387 CTGTGAGTCAGGGGACACCAGGG - Intronic
952076244 3:29701439-29701461 CTGAGGCTGAGGAGGCACCGAGG - Intronic
953079962 3:39607980-39608002 CTGTGTCTGAGGAAGCCCCATGG - Intergenic
953215897 3:40917713-40917735 CTGAGACTGAAGAGCTACCCTGG + Intergenic
953495890 3:43386751-43386773 CTGGGACTGAGGAGCTGTCAGGG - Intronic
954106889 3:48414351-48414373 CTGTGTCTGATGACTCACCAGGG + Intronic
954951440 3:54477806-54477828 CATGGACTGAGGATCCACCAAGG - Intronic
954954824 3:54510001-54510023 ATAGGACTGAGGAGCCACAAAGG - Intronic
959586734 3:108032192-108032214 CTGTGACTGAAGAGGCATCCTGG + Intergenic
960805461 3:121579446-121579468 ATGTGGCTGAGGAGTCACAAAGG - Intronic
960996832 3:123345705-123345727 CTGTGACTGAGGAGCCACCAGGG - Intronic
963126394 3:141820826-141820848 CATTGACTGAGGAGGCCCCAAGG - Intergenic
964719559 3:159757610-159757632 CTGTAACTTAGGTGCCTCCAGGG - Intronic
968689620 4:1983890-1983912 CTGGGTCTGCGGGGCCACCATGG + Exonic
969179398 4:5425303-5425325 CTGTGACAGTGGGGCCACCATGG + Intronic
969421890 4:7102329-7102351 CTGTTTCTGGGGAGCAACCAGGG + Intergenic
969691825 4:8708159-8708181 CTGAGACTGAGGTGCCAGCATGG + Intergenic
970439534 4:16068129-16068151 CAGTGACATATGAGCCACCAGGG - Intronic
971201230 4:24511140-24511162 ATGCCACAGAGGAGCCACCAAGG + Intergenic
973694608 4:53477870-53477892 CTGAGCCTGAGGAGCCACAGGGG - Intronic
973945959 4:55956058-55956080 AAGAAACTGAGGAGCCACCAAGG + Intronic
974268540 4:59618421-59618443 CTGAGACTGAGAAGTCCCCAAGG + Intergenic
975533682 4:75426662-75426684 ATGTGACTAAGAAGCCAACAGGG + Intergenic
981901404 4:149869456-149869478 CTGTGACTGAGGAGTTCTCAAGG + Intergenic
985425889 4:189829547-189829569 CTGTCACTTCGCAGCCACCACGG + Intergenic
988625240 5:32868197-32868219 TTGTCACTGAGGGTCCACCATGG + Intergenic
994236169 5:97365614-97365636 CTATGAATGGGGAGCCAGCAGGG + Intergenic
996638428 5:125723604-125723626 GTGAGACTGAAGAGCCAGCATGG - Intergenic
997783064 5:136679257-136679279 CTGTGAGTGAGAAGAAACCATGG - Intergenic
998230773 5:140360344-140360366 CTGTGTCTGAGGGGCCATCAGGG - Exonic
1002603532 5:180368924-180368946 CTGTGACTGCGGTGCCTCGATGG + Intergenic
1002968989 6:1995143-1995165 CAGAAACTGAGGGGCCACCATGG + Intronic
1005098089 6:22140641-22140663 CAGTAACTGAGGAACCATCATGG + Intergenic
1005882816 6:30073815-30073837 ATGGGACTGAGGAGGCAGCAAGG - Intronic
1006153394 6:32001263-32001285 CTGGGACTGAGGAGGCAGAATGG + Intronic
1006159702 6:32034000-32034022 CTGGGACTGAGGAGGCAGAATGG + Intronic
1006700567 6:35969627-35969649 CTGACACTGAGGAGCTACTAGGG - Intronic
1007694769 6:43725181-43725203 GTGGGACTGTGGAGCCACCCAGG + Intergenic
1010471123 6:76229863-76229885 ATGTGAGGGAGGAGCAACCAGGG + Intergenic
1011918671 6:92543444-92543466 CGGTCACTGAGGAGCCAAGAGGG + Intergenic
1012067426 6:94565849-94565871 CTGTATCTGAGAAGCCACCTGGG + Intergenic
1013072651 6:106743045-106743067 CTGGGACTGAGGAGCCACTCTGG + Intergenic
1014396866 6:120934536-120934558 CTATGGCTGAGGAGCATCCATGG - Intergenic
1015338330 6:132067428-132067450 TCGTTACTGAGCAGCCACCACGG - Intergenic
1016633643 6:146261112-146261134 CTGTGAGTGAGGAGTCAGCAAGG + Intronic
1017882677 6:158572719-158572741 CTGTGACTGGGCAGACACCTGGG + Intronic
1018639200 6:165891317-165891339 CTGAGGCTCAGGTGCCACCAGGG + Intronic
1019100548 6:169625983-169626005 CTGGGTCTGAGGCGTCACCAAGG + Intronic
1019441493 7:1049828-1049850 CTATGACAGAGAAGCCACCAAGG + Intronic
1019901193 7:4021953-4021975 CTGAGGCTGAGGAGCCCTCAGGG - Intronic
1019921741 7:4167631-4167653 CTCTGACTGAGCATCCGCCATGG + Intronic
1020485558 7:8715655-8715677 GTCTGACTTAGGAGCCACTAGGG + Intronic
1022235745 7:28458811-28458833 CTGTGTCTCAGGCGCCACCTAGG - Intronic
1022482983 7:30756111-30756133 GTGTGACTGTGGAGCACCCAGGG + Exonic
1024050345 7:45617233-45617255 CTGTAACTGAGAAGCAATCATGG + Intronic
1024306319 7:47932424-47932446 CAGTGACTGAGGGGGCACCGCGG + Intronic
1025019460 7:55469275-55469297 CTGAGCCTGAGGAGCCTCCTAGG - Intronic
1025838876 7:65124626-65124648 TTGTGGCTGAAGAGACACCAGGG - Intergenic
1025884190 7:65571339-65571361 TTGTGGCTGAAGAGACACCAGGG + Intergenic
1025889253 7:65631267-65631289 TTGTGGCTGAAGAGACACCAGGG - Intergenic
1027233890 7:76286759-76286781 CACTGACTGAGTAGCCCCCAGGG + Exonic
1030644537 7:112045157-112045179 CTGTGACTGAAGAGCCAGAAAGG - Intronic
1031923579 7:127618696-127618718 CCTTGACTGAGGTGACACCAAGG + Intergenic
1034745926 7:153524021-153524043 CTCTGACTGAGGCGCCGTCAAGG - Intergenic
1035391823 7:158509266-158509288 CTGTGACTGACGGGCCGGCAAGG - Intronic
1037717280 8:21411127-21411149 CTGTGAGTGAGGAGCCACGATGG - Intergenic
1039439794 8:37587175-37587197 CTGAGTCTGAGGAGGAACCAAGG - Intergenic
1045397550 8:101775887-101775909 GTATGACTCAGGAGCCACCTTGG - Intronic
1047860344 8:128959073-128959095 CTGGGACTGTGAAGTCACCAAGG - Intergenic
1048857576 8:138697600-138697622 CTGGGACTGAGGAGGCTCCTGGG - Intronic
1049192857 8:141298416-141298438 CTGGCACTGAGCAGCCACCTGGG + Intronic
1049292465 8:141811862-141811884 CTGTCAGTGAGGAGCGGCCAGGG - Intergenic
1049349871 8:142158833-142158855 CTTTGACGGAGGAGGAACCAGGG + Intergenic
1051762355 9:20481571-20481593 CTGTGACTGAGGAACCTACTGGG + Intronic
1052855156 9:33402405-33402427 CTGTAACTGAGAAGCCCCCAAGG - Exonic
1053135752 9:35649505-35649527 CTGTGCCTGAGGAGACACTGAGG + Exonic
1053683174 9:40498747-40498769 CTTTAACTGAGAAGCCCCCAAGG - Intergenic
1053933151 9:43127063-43127085 CTTTAACTGAGAAGCCCCCAAGG - Intergenic
1054280540 9:63126181-63126203 CTTTAACTGAGAAGCCCCCAAGG + Intergenic
1054296275 9:63334245-63334267 CTTTAACTGAGAAGCCCCCAAGG - Intergenic
1054394291 9:64638750-64638772 CTTTAACTGAGAAGCCCCCAAGG - Intergenic
1054428941 9:65143949-65143971 CTTTAACTGAGAAGCCCCCAAGG - Intergenic
1054501439 9:65877586-65877608 CTTTAACTGAGAAGCCCCCAAGG + Exonic
1056456219 9:86763566-86763588 TTGGGACTGAGGACCCACCCAGG - Intergenic
1057395503 9:94676404-94676426 GTGAGACTTAGAAGCCACCAAGG + Intergenic
1057912507 9:99031100-99031122 CTGTGGCAAAGGAGCCAGCAGGG - Intronic
1061665123 9:132156202-132156224 CTGAGACTGAGGAGTCCTCAGGG + Intergenic
1062069165 9:134546203-134546225 CTGTGGCTAAGGAAACACCAAGG - Intergenic
1062173211 9:135146935-135146957 CTGGGGCTGGGGAGCCAGCATGG - Intergenic
1062459794 9:136658212-136658234 CTGGGACTGGGGACCCCCCAGGG + Intergenic
1189586793 X:42470078-42470100 CTGTCACTGAGGTGCCTTCAAGG + Intergenic
1192181114 X:68916418-68916440 CTGAGGCTCAGGAGCCCCCATGG + Intergenic
1195230179 X:102839064-102839086 CTGCGGATGATGAGCCACCAAGG - Intergenic
1195418060 X:104641770-104641792 CTGTGACTGAGGAGCAAGCTGGG - Intronic
1197082730 X:122439390-122439412 CTGTGATGGAGGAGGCAGCAGGG + Intergenic
1198012488 X:132572474-132572496 CTGTGAATCAGGAGCAACCAAGG + Intergenic
1198113223 X:133521287-133521309 CTATACTTGAGGAGCCACCAGGG + Intergenic