ID: 960998439

View in Genome Browser
Species Human (GRCh38)
Location 3:123354630-123354652
Sequence ATCTGTGTGAAAAGAGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 488
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 451}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960998436_960998439 14 Left 960998436 3:123354593-123354615 CCACAGGGAATTCTGAAGTATGA 0: 1
1: 0
2: 4
3: 22
4: 249
Right 960998439 3:123354630-123354652 ATCTGTGTGAAAAGAGAGGAAGG 0: 1
1: 0
2: 2
3: 34
4: 451

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960998439 Original CRISPR ATCTGTGTGAAAAGAGAGGA AGG Intronic
903534497 1:24057626-24057648 GTCTGTTTGAAAAGACAGGAAGG + Exonic
904501446 1:30915095-30915117 AGCTGGGTGAGGAGAGAGGAGGG + Intergenic
904706569 1:32395205-32395227 ATCAGAGGGAAAAGAGATGAAGG - Intergenic
904781394 1:32951778-32951800 ATATGTGTCAGAAGAGAGAAAGG - Intronic
905678684 1:39849917-39849939 ATCTGTTTGGAAAGGGAGAAAGG - Intronic
905824804 1:41019725-41019747 AGCTGTGAGAGAAGACAGGAAGG - Intronic
905868377 1:41388723-41388745 ATCTGTGTTTACAGAGAGGCAGG + Intergenic
906101994 1:43269968-43269990 ATTTGAGTGAACAGGGAGGAGGG - Intronic
906509692 1:46403917-46403939 ATATGTTTGAAAAGAAAGGGAGG + Intronic
907263287 1:53238262-53238284 ATCTGTGGGGAACTAGAGGAGGG - Intronic
907457284 1:54583823-54583845 ATGTGTGAGAAAAATGAGGAGGG - Intronic
907683508 1:56586876-56586898 ATCTGGGAGAAAAGAGCAGAAGG + Intronic
908323105 1:62997235-62997257 AGCTGTGTGAAAAAGGAGGCTGG - Intergenic
911215132 1:95184724-95184746 ATCTGAGAGGAAAGAGGGGAAGG - Intronic
913379603 1:118194663-118194685 ATCAGTCTGAAAAGGGAGGAAGG + Intergenic
914247021 1:145893772-145893794 ACCAATGGGAAAAGAGAGGAAGG + Intronic
914442246 1:147717977-147717999 ATCCGTCTGAAAATAGAGCATGG + Intergenic
914503272 1:148265664-148265686 GTCTCAATGAAAAGAGAGGAAGG - Intergenic
914665857 1:149832146-149832168 ATCTGTGCGCCAAGGGAGGACGG - Intergenic
914669908 1:149861648-149861670 ATCTGTGCGCCAAGGGAGGACGG + Intronic
914675137 1:149902501-149902523 ATCTGTGGGAATGGAAAGGAAGG + Intergenic
915358161 1:155268959-155268981 ATCGGTGTGAGAAGAGAGAGCGG + Intronic
915405934 1:155659787-155659809 ACCGTTGTGAAAACAGAGGAGGG - Exonic
915419100 1:155765580-155765602 ACCGTTGTGAAAACAGAGGAGGG - Exonic
915628699 1:157135428-157135450 ATCTGTGTTAACAGATTGGAAGG - Intronic
916628085 1:166581366-166581388 ATGTGGGTGAAAAGAGTAGAAGG + Intergenic
917166620 1:172119573-172119595 ATTTGGGTGAGAAGAGAAGAGGG - Intronic
917336038 1:173925216-173925238 TTCTGAGTGAAAAGATTGGAAGG + Intergenic
917369467 1:174275038-174275060 ATATGTGTGTGGAGAGAGGAGGG - Intronic
917502558 1:175599143-175599165 AGCTGAGGGAGAAGAGAGGAGGG + Intronic
918018793 1:180664541-180664563 TTCTGTGTGAAGAGAGGGTAGGG - Intronic
918905291 1:190484257-190484279 AGGTGTGTGAAAGTAGAGGAGGG + Intergenic
919441175 1:197634986-197635008 CTCTGCGTGAAAAGGAAGGAAGG + Intronic
919489629 1:198189915-198189937 ATATTTTTAAAAAGAGAGGAGGG + Intronic
919664184 1:200276364-200276386 ATGTGTGGGAGGAGAGAGGATGG - Intergenic
919847065 1:201648943-201648965 GTCCGTGAGAAAAGAGAGGTTGG - Exonic
920688462 1:208127903-208127925 ACCTGTGGGCACAGAGAGGAGGG - Intronic
920800903 1:209186523-209186545 ATGTGTTGGACAAGAGAGGAGGG - Intergenic
920971552 1:210747424-210747446 TTCTGAGTGTAAAGTGAGGAAGG + Intronic
921823173 1:219640844-219640866 ATCTGTTTGAAGAAAGTGGAGGG + Intergenic
922010771 1:221583852-221583874 ATCAGTGGCAAAAGAGAGAATGG + Intergenic
922022342 1:221717419-221717441 ATGTGTTTGAAAAGAAAAGAGGG + Intronic
922576441 1:226663958-226663980 ATCTGAGGGAGAAGACAGGAAGG - Intronic
922604241 1:226879354-226879376 CTCTGAGTGAAGAGGGAGGAGGG + Intronic
922690828 1:227688625-227688647 GTCAGTGTGACAAGAGAGGGTGG + Intergenic
923706173 1:236346616-236346638 AAGTGTGTGCAAAGAGAGGTGGG - Intergenic
924837465 1:247666862-247666884 ACCCTTGTGAAGAGAGAGGATGG + Intergenic
1062976385 10:1686457-1686479 ATTTGTGTGAAAGTAGGGGAAGG + Intronic
1063865456 10:10360443-10360465 ATGCATGTGAAAAAAGAGGAAGG + Intergenic
1064016694 10:11778553-11778575 ATCTGGTTCAAAAGAGGGGATGG - Intergenic
1064651879 10:17517534-17517556 ATACCTGTGAAAAGAGAGAAAGG - Intergenic
1065798530 10:29329707-29329729 GTGTGTGTGAAGAGAGAGAAGGG + Intergenic
1066362076 10:34740705-34740727 ATCAGTAGGAAAAGAGGGGAGGG - Intronic
1067250753 10:44584685-44584707 ATATGTGGGAAAAGAGGAGAGGG - Intergenic
1067989918 10:51200243-51200265 ATATGTGTGAAAGGAAAGGATGG + Intronic
1068130304 10:52888393-52888415 ACATGTCTGAAGAGAGAGGAAGG - Intergenic
1068756067 10:60654813-60654835 CTCTTTGAGAAAATAGAGGAAGG - Intronic
1068995453 10:63197169-63197191 ATCTGACTGAAATGAGAAGATGG + Intronic
1070155074 10:73828220-73828242 ATCAGGGAGAAAAGAGCGGAGGG + Intronic
1070166860 10:73905496-73905518 ATCTGTGGGAAGAGGGAGCAGGG - Intergenic
1070305196 10:75235371-75235393 AGCTGCGTGAAAGGAGAGGGTGG + Exonic
1070371888 10:75790438-75790460 ATTTTTGTGGAAAGAGAGGTGGG + Intronic
1071580086 10:86761316-86761338 ATCTGTGCCATAAGAAAGGAAGG - Intronic
1071757289 10:88557629-88557651 ATATTAGTGAAAAGAGAGGAAGG - Intronic
1072196414 10:93120413-93120435 GTCTTTCTGAAGAGAGAGGAGGG + Intergenic
1072836034 10:98713342-98713364 AACTGAGTGAACAGATAGGAGGG + Intronic
1072932895 10:99682639-99682661 ATATATGTGAACAGAAAGGAGGG - Intronic
1073223370 10:101895021-101895043 AACTGTGAGAAAATACAGGAAGG + Intronic
1074173743 10:110974576-110974598 ATCCATAAGAAAAGAGAGGAAGG - Intronic
1076174365 10:128355812-128355834 ATCTAGGTGAGAAGAGAGAAGGG + Intergenic
1078730058 11:13965363-13965385 ATTAGTGTGAAAAGAGACGCTGG - Intronic
1079128081 11:17732816-17732838 ATCTGGGTAGAAAGAAAGGAAGG + Intergenic
1081655079 11:44851648-44851670 ATGTATGAGAAGAGAGAGGAGGG - Intronic
1082991389 11:59210421-59210443 ATTTGTGTAAAAATAGCGGAGGG - Exonic
1083000521 11:59287039-59287061 ATTTGTGTAAAAACAGAGAAGGG - Intergenic
1083373075 11:62197024-62197046 ACCTGGGAGAAAGGAGAGGAAGG - Intergenic
1084277606 11:68062503-68062525 TTCTGTGTGACAGGAGGGGATGG - Intronic
1084291250 11:68170016-68170038 AACTGTGTGGTGAGAGAGGACGG - Intronic
1085453466 11:76652955-76652977 AGCAGTGTGGAAAGTGAGGAGGG + Intergenic
1085564580 11:77501583-77501605 ATCAGTGTGACCAGAGAGGTGGG - Intergenic
1085801454 11:79593765-79593787 ATCAGTGAGAATGGAGAGGAAGG - Intergenic
1086473015 11:87137368-87137390 CTTTTTGTGAGAAGAGAGGAAGG + Intronic
1088040855 11:105380049-105380071 ATCTGTGTAAGCAGAGTGGACGG + Intergenic
1089231072 11:116977247-116977269 GTCTGTATGAAAAGGAAGGAAGG - Intronic
1089407280 11:118208525-118208547 ATGAGTGTCATAAGAGAGGAAGG + Intronic
1089610773 11:119667287-119667309 ATCTGGGTGAGAACCGAGGAGGG - Intronic
1090267445 11:125362172-125362194 CTCTCTGTGAAAAAAGAGGCAGG - Intronic
1091338287 11:134790199-134790221 TACTGTGTGATGAGAGAGGAAGG - Intergenic
1091694916 12:2622029-2622051 AACTGGGAGAGAAGAGAGGAAGG + Intronic
1091996424 12:4997597-4997619 CTCTGTGTCATGAGAGAGGAAGG - Intergenic
1092009787 12:5099805-5099827 AGCTGGCTGAAAAGAGAGAAGGG + Intergenic
1092163359 12:6328119-6328141 ACCTCTCTGAAAAGACAGGAGGG - Exonic
1092632247 12:10394661-10394683 GTCTGTGTAGAAAGGGAGGAAGG + Intronic
1092893502 12:12991429-12991451 ATTTGTGTGAAAAGAGACAGTGG - Intronic
1093124034 12:15307013-15307035 TTCTGTTTGAAAAAAGAAGAGGG - Intronic
1094005746 12:25748850-25748872 ATCTGTGTCAGCAGAGAGGATGG - Intergenic
1094163091 12:27412462-27412484 ATCTGATTGTAAAGAGATGAGGG + Intronic
1095215519 12:39542834-39542856 AGCTGTGAGAAAAGAAGGGAGGG + Intergenic
1095837790 12:46657052-46657074 ATATTTGTGAAAATAGAGGTGGG + Intergenic
1096633136 12:52942399-52942421 ATCTTTGGGAAAAGAGAGGATGG - Intronic
1096809019 12:54158052-54158074 GTCAGTGTGGATAGAGAGGAAGG - Intergenic
1097613875 12:61860719-61860741 ATCTGAATGAAGACAGAGGAAGG - Intronic
1098651034 12:72969330-72969352 ATCTGTAGGCAAAGAGAGCAAGG - Intergenic
1098770576 12:74547606-74547628 AACTGTGAGAAAATAAAGGAAGG + Intergenic
1098782520 12:74704703-74704725 AACTGTGTGATAAGAGTTGAAGG + Intergenic
1098783485 12:74719118-74719140 ATATGTGTGCACACAGAGGAAGG + Intergenic
1098908272 12:76183202-76183224 AGCTGGGAGAAAAGAGAGAACGG + Intergenic
1100073240 12:90747239-90747261 ATCTTTGTGAAAATAGAGTTTGG + Intergenic
1100266218 12:92978809-92978831 ATCCGTGGGAAAAGAGAAGTAGG - Intergenic
1101512324 12:105404561-105404583 TTCTGTGGGACAGGAGAGGAAGG + Intergenic
1101570151 12:105946362-105946384 ATCTGGTTGTAAAGACAGGATGG - Intergenic
1102349673 12:112183265-112183287 ATCTGTGTGAACAGAGAACAGGG + Exonic
1102511755 12:113420815-113420837 ATGTGTGTCTAAAGCGAGGATGG + Intronic
1102691864 12:114767472-114767494 ATCTGGGAGAAAAGGGTGGAAGG - Intergenic
1103084651 12:118053041-118053063 ATCTGGGTGAGATGAGATGAAGG - Intronic
1104060028 12:125259835-125259857 ATCAAGGTTAAAAGAGAGGATGG + Intronic
1104948699 12:132429086-132429108 ATCTGCGAGAACAGAGACGAGGG - Intergenic
1105795117 13:23843966-23843988 GTTTGTGGGAGAAGAGAGGAGGG + Intronic
1106468226 13:30031818-30031840 AACAGGGAGAAAAGAGAGGATGG - Intergenic
1106586068 13:31057106-31057128 ATCAGTGTGAAAACAGACAATGG + Intergenic
1107280335 13:38726164-38726186 TTCTGTGGGAAAAGTGAGGTAGG + Intronic
1107415524 13:40196390-40196412 CTCTGTGGGAAAGGAGAGCATGG + Intergenic
1108483509 13:50900762-50900784 GTCTGTGAGAAAAAAGAGGAGGG - Intergenic
1108781599 13:53843261-53843283 GGCTGTGTGAACAGAAAGGAAGG + Intergenic
1109037830 13:57287812-57287834 ATATGTGTGTAAACAAAGGATGG - Intergenic
1110133529 13:72036844-72036866 TTCTGTGTGAAAAGAGATACAGG + Intergenic
1110850103 13:80235555-80235577 CTGTTTGTGAAAAGAAAGGAGGG - Intergenic
1110965454 13:81689390-81689412 ATATGTATTAAAAGACAGGAAGG - Intergenic
1111098043 13:83540059-83540081 ATCTGCATGAAATGAGAGGTTGG + Intergenic
1111705878 13:91748936-91748958 GTGTGTGTGAATAGAGAGAAGGG + Intronic
1111965318 13:94856257-94856279 CTCTATGTGGACAGAGAGGAGGG + Intergenic
1114408598 14:22479350-22479372 ATGAGTGTGAAGAGAAAGGAAGG + Intergenic
1114445558 14:22785368-22785390 TTCTGTGTGGAGACAGAGGAGGG - Intronic
1114840069 14:26252665-26252687 ATCCGCATGAAAAGACAGGATGG + Intergenic
1115202010 14:30863803-30863825 TTTTGTATGAAAAGAGAGAAGGG - Intergenic
1117339005 14:54777974-54777996 TTCTGCGTGAAAACAGAGGATGG - Intronic
1117376661 14:55123824-55123846 ATCTGAGGAAAAAAAGAGGAAGG + Intergenic
1118042588 14:61933267-61933289 ATCTTTGTGAAAACAGACAATGG - Intergenic
1119110235 14:71965776-71965798 GTCTGTGTGAAAGGTAAGGAGGG + Intronic
1120481657 14:85056381-85056403 AGCTGTGTGAAGACAGAGGCAGG + Intergenic
1120596667 14:86447981-86448003 GTCTTTGGGAAAAGAGAGAATGG + Intergenic
1120613548 14:86673711-86673733 ATGTGAGGGAAAAGAGAGGTAGG + Intergenic
1121181087 14:91929449-91929471 TTATCTGTGAAAAGAAAGGATGG - Intronic
1121982347 14:98465920-98465942 TTCTTTGTGAAGAGAAAGGAAGG + Intergenic
1124201013 15:27678472-27678494 ATCTAAGTGCACAGAGAGGAGGG - Intergenic
1124406595 15:29398412-29398434 TTCTTTTTTAAAAGAGAGGATGG - Intronic
1124711224 15:32014007-32014029 ATCTATGTGATTAGAGAAGAGGG - Intergenic
1125047934 15:35264047-35264069 TTCTGTGTGAAAAGTCAGCATGG - Intronic
1125276942 15:38003633-38003655 ATCTGCTTGAGAAAAGAGGAGGG - Intergenic
1125352308 15:38780845-38780867 ATCAGTGGGAAAGGGGAGGAGGG - Intergenic
1125595324 15:40881672-40881694 ATCTGAGCGGAAAGAGAGGTTGG - Intergenic
1126336107 15:47587955-47587977 ATCTCTCTGAAAAGAGTGGCTGG + Intronic
1126947260 15:53835496-53835518 ATATGTCTGAAAAGGGAAGAGGG + Intergenic
1127475400 15:59327979-59328001 AGCTGTGTTAAAAGAGGAGATGG + Intronic
1127572751 15:60260326-60260348 GCCTGTGGGAAAAGAGAGGAAGG - Intergenic
1128418131 15:67465844-67465866 ATCTTTGTGGAGAGAGAGGAGGG - Intronic
1128518229 15:68357389-68357411 CTCTGTGTGATAATACAGGAGGG + Intronic
1129028473 15:72601424-72601446 ACCAGTGTGAAAAGAGAAAAAGG - Exonic
1131344718 15:91635808-91635830 ATCTGAGAGAATAAAGAGGAAGG - Intergenic
1132309408 15:100846134-100846156 GTCTGGGTGAAGGGAGAGGAGGG + Intergenic
1134202576 16:12211050-12211072 GTCTGTGTAAAAAGTGAGGGAGG - Intronic
1135829312 16:25759592-25759614 TTCCGTGTTAGAAGAGAGGAGGG + Intronic
1135843990 16:25901708-25901730 TTCTGTGTGAGAACAGAGAAAGG - Intronic
1137235493 16:46613576-46613598 AGCTGTGTGAAAGGGGAGGCAGG - Intronic
1138118600 16:54380095-54380117 ATCTGTGTGATTAGAGAGGAGGG + Intergenic
1138140171 16:54561210-54561232 GTCTGTGTGTAAGAAGAGGAGGG - Intergenic
1138354082 16:56363829-56363851 ATCTGTTTAAAAAGAGAAGACGG + Intronic
1140069209 16:71634599-71634621 TCCTGTGTGTAAAGAGAGGCAGG + Intronic
1141337224 16:83167626-83167648 AGCTTTGGGAAAAGAGAGAAAGG - Intronic
1141358070 16:83367799-83367821 ATTTCTGTGAAAAAAGAGAAAGG + Intronic
1141373044 16:83504984-83505006 AGAGGAGTGAAAAGAGAGGATGG + Intronic
1141486593 16:84344388-84344410 GGCTGTCTGAACAGAGAGGATGG + Intergenic
1142131301 16:88432773-88432795 TTCCCTGTGAACAGAGAGGAGGG + Exonic
1144089526 17:11841975-11841997 AACTGTATAAAAAGAAAGGAAGG - Intronic
1144260696 17:13517166-13517188 ATATGTTTGAAATGAGAGTATGG - Intronic
1144583748 17:16475314-16475336 GTGTGTGTGGAGAGAGAGGAAGG + Intronic
1145177126 17:20710674-20710696 TTTTGTGTCAAAAGGGAGGAAGG - Intergenic
1146141626 17:30373299-30373321 AGGTTTGAGAAAAGAGAGGAAGG - Intergenic
1146222067 17:31032806-31032828 TTCTGTGTGAAAACAGAAGAGGG - Intergenic
1146542103 17:33705139-33705161 ATTTGTGAGAAAAAAGAGGCAGG - Intronic
1146829151 17:36052353-36052375 ATCTGAATTAAAAAAGAGGAAGG + Intergenic
1146853254 17:36241538-36241560 TTTTGTGTCAAAAGGGAGGAAGG + Intronic
1146869162 17:36365428-36365450 TTTTGTGTCAAAAGGGAGGAAGG + Intronic
1147058623 17:37855370-37855392 TTTTGTGTCAAAAGGGAGGAAGG - Intergenic
1147072036 17:37966059-37966081 TTTTGTGTCAAAAGGGAGGAAGG + Intergenic
1147083562 17:38045591-38045613 TTTTGTGTCAAAAGGGAGGAAGG + Intronic
1147099508 17:38169558-38169580 TTTTGTGTCAAAAGGGAGGAAGG + Intergenic
1148177868 17:45583566-45583588 TTCTGTGTGTAAACAGAAGAGGG + Intergenic
1149634834 17:58158018-58158040 ATCTTTGTGAAAGGAGAAGGGGG - Intergenic
1149667303 17:58374373-58374395 AGAAGAGTGAAAAGAGAGGAGGG - Intronic
1150082521 17:62252848-62252870 TTTTGTGTCAAAAGGGAGGAAGG + Intergenic
1150378323 17:64700709-64700731 ATCCCTGTGAAAACAGAGTAGGG + Intergenic
1150443800 17:65212856-65212878 AACTGGGTGACACGAGAGGAGGG + Intronic
1150549988 17:66201546-66201568 AACTGTGCAAAAATAGAGGATGG + Intergenic
1150552953 17:66227846-66227868 CTCTCTGTGCAAAGAGAGTAAGG - Intronic
1150747523 17:67827347-67827369 TTCTGTGAGAAAACAGAAGAGGG - Intronic
1150792129 17:68207250-68207272 TTCTGTGTGAAAACAGAAGAGGG - Intergenic
1151191708 17:72403141-72403163 AACTGTGTGTCAAGAAAGGAAGG + Intergenic
1151193649 17:72416430-72416452 GGCTCTGGGAAAAGAGAGGAAGG + Intergenic
1151827450 17:76531141-76531163 ATCTGGGGGCAAAGGGAGGAAGG + Exonic
1151848450 17:76674624-76674646 ATCTGTGATAAAAGGGAGCATGG - Exonic
1153005352 18:493365-493387 AAATGTCTTAAAAGAGAGGAGGG - Intronic
1153284983 18:3449206-3449228 TTCTGTTTGAAATGGGAGGAGGG + Intronic
1153463975 18:5368219-5368241 ACATGTGTGAAAGGAGAGGGAGG - Intergenic
1153834104 18:8949110-8949132 ATCAGAGTCAAAGGAGAGGAAGG - Intergenic
1153934234 18:9906564-9906586 AACTGGGTGGAAAAAGAGGAAGG - Intergenic
1154331882 18:13436763-13436785 ATCTGTGTGCAGAGTGAGGCTGG - Intronic
1155382544 18:25239977-25239999 ATGTGTGTGATAAGATAAGATGG - Intronic
1156102979 18:33620866-33620888 ACCTTTGTGATAAGAGAGTAGGG + Intronic
1156763306 18:40620074-40620096 ATCTATTTGAAAAGAGAGGCTGG - Intergenic
1157088021 18:44602425-44602447 ATCAGTGTAAAAAGAGTGGGTGG + Intergenic
1157703514 18:49780886-49780908 ATCTGTGAGAAAAGTCAAGACGG + Intergenic
1157793773 18:50557360-50557382 ACCTATGAGAAAAGAGAGGGAGG + Intergenic
1159317799 18:66801576-66801598 TACTGTTTGACAAGAGAGGAGGG - Intergenic
1160599025 18:79998478-79998500 TTGTGTGTGAAAAGGGAGAAAGG - Intronic
1160602927 18:80028097-80028119 TTGTGTGTGAAAAGGGAGAAAGG - Intronic
1161088881 19:2349732-2349754 ATGTGTGTGGAGAGAGAGAACGG - Intronic
1161899875 19:7110407-7110429 ATCAGAGGGAAAAGAGATGAAGG - Intergenic
1162533050 19:11246893-11246915 AGCTGGCTGAATAGAGAGGATGG - Intronic
1163829936 19:19542779-19542801 TTCTGGGAGAAAGGAGAGGATGG + Intronic
1165183536 19:33995184-33995206 ATGAATGTCAAAAGAGAGGATGG + Intergenic
1166822254 19:45587748-45587770 ACCTTTGTGAAGGGAGAGGAGGG + Intronic
1168533653 19:57150766-57150788 CTCTGTGGGGAAAGAAAGGATGG + Intergenic
925119414 2:1405632-1405654 ATCTGTGAGAAAACAGAAGAGGG - Intronic
925363505 2:3295654-3295676 GTGTGTGTGAGTAGAGAGGACGG - Intronic
925363524 2:3295754-3295776 GTGTGTGTGCAGAGAGAGGACGG - Intronic
925363560 2:3295923-3295945 GTGTGTGTGCAAGGAGAGGATGG - Intronic
925363568 2:3295960-3295982 GTGTGTGTGCAGAGAGAGGATGG - Intronic
925363582 2:3296026-3296048 GTGTGTGTGAGTAGAGAGGATGG - Intronic
925363587 2:3296060-3296082 GTGTGTGTGCAGAGAGAGGAGGG - Intronic
925363655 2:3296375-3296397 GTGTGTGTGCAGAGAGAGGATGG - Intronic
926386591 2:12341407-12341429 ATATTTGAGAAAGGAGAGGAAGG - Intergenic
926761524 2:16282690-16282712 AGCTGTGGGGATAGAGAGGATGG + Intergenic
926894407 2:17669058-17669080 ATCAGTGAGAAAGGAGAAGAGGG + Intronic
927004842 2:18837216-18837238 GTCTATGAGAACAGAGAGGAAGG - Intergenic
927257001 2:21048398-21048420 ATCTGTGTAAAATGAGTGAAGGG - Intergenic
927303672 2:21545146-21545168 ATCTGAGAGAAGTGAGAGGAAGG - Intergenic
927345494 2:22033882-22033904 CTATGTGGGTAAAGAGAGGAGGG - Intergenic
928578455 2:32680562-32680584 ATCTGTGTGAAATGAGGGATGGG + Intronic
928687432 2:33763257-33763279 ATCTATGCAAGAAGAGAGGAGGG + Intergenic
929069276 2:38012295-38012317 AACTGTGTGAAATGATAGCAAGG - Intronic
929264687 2:39904817-39904839 ATCTGTGGGAATGGAGAGAAGGG + Intergenic
929264697 2:39904920-39904942 ATCTGTGGGAATTGAGAGAAGGG + Intergenic
929543653 2:42841597-42841619 CCCTGGGAGAAAAGAGAGGAGGG + Intergenic
929596481 2:43179350-43179372 TTCTGTCTCCAAAGAGAGGAGGG + Intergenic
930025607 2:47027451-47027473 TGCTGTGTGAAAAGAATGGAAGG + Intronic
931794240 2:65694069-65694091 TTGTGTGTCAAAATAGAGGAGGG + Intergenic
932875676 2:75448757-75448779 GTCTGTGGAAAATGAGAGGAAGG + Intergenic
935125458 2:100218609-100218631 ATGAATGGGAAAAGAGAGGAAGG - Intergenic
935127110 2:100234278-100234300 ATCAGTGTGAAAAAAGAAGACGG + Intergenic
935520307 2:104096414-104096436 ATCTCTGCAAGAAGAGAGGATGG + Intergenic
935982028 2:108636804-108636826 CTCTGTGTGGGGAGAGAGGAAGG + Intronic
938546578 2:132338150-132338172 ATCTGTGGGAAAAGGTAGGAAGG + Intergenic
939596678 2:144133613-144133635 ATCTTTGTTAAAAGAGAGTTTGG - Intronic
939901792 2:147859360-147859382 CTGTGTGTGATTAGAGAGGAGGG + Intronic
940017162 2:149119082-149119104 ATCTGAGTGAAAAGAAATAAAGG - Intronic
940025792 2:149206002-149206024 ACTTGTCTGAAAAGAAAGGAGGG - Intronic
940366835 2:152857720-152857742 ATCTGTGTGGAGGGAAAGGAGGG + Intergenic
941139107 2:161755550-161755572 GTATGTGAGAAAAGAGAGGGTGG - Intronic
941384725 2:164840522-164840544 ACATGTTTGAGAAGAGAGGAAGG - Intronic
941664589 2:168231762-168231784 GTCTGGGTGAAGGGAGAGGAGGG + Intronic
941674322 2:168327689-168327711 ATATGTATGAAGAGAGAGAAAGG - Intergenic
941885048 2:170519417-170519439 AACTGAGAGAAAAGAAAGGAGGG - Exonic
943069717 2:183126048-183126070 GGCTGTGTCAAAAAAGAGGAAGG - Intronic
944368945 2:198958441-198958463 ATCTGTGTGGTGAGAGAGGGTGG + Intergenic
946184781 2:217974312-217974334 CTCTGTGTCAGAAGATAGGAAGG + Intronic
947668796 2:231924093-231924115 GTCTGGCTGCAAAGAGAGGAAGG + Intronic
947683853 2:232062878-232062900 ATCCATGTGAAAAGGAAGGAAGG - Intronic
1168739609 20:176506-176528 ATCAGGGTGAAAAGATTGGAGGG - Intergenic
1169017530 20:2304157-2304179 ATGTGTAGGAAAGGAGAGGAGGG - Intronic
1171875441 20:30570884-30570906 ATCTGTGGGAAAAGGTAGGAAGG + Intergenic
1172083128 20:32358316-32358338 GTGTGTGTGAAGAGTGAGGAGGG - Intergenic
1173084210 20:39899903-39899925 ATAGGTGTGAAAAGAGAACAGGG + Intergenic
1173946067 20:46951940-46951962 ATATTTGTTAAGAGAGAGGAAGG - Intronic
1177028086 21:15947145-15947167 AGTTTTGTGAAAAGAGAGAAGGG - Intergenic
1179266591 21:39809085-39809107 CTTTGTGTGAAAAGCAAGGAAGG + Intergenic
1179353274 21:40633639-40633661 AACTGAGTGAGAAGAAAGGAGGG + Intronic
1181612268 22:24024613-24024635 ATCTGAGGGAGAAGAGAGAAAGG - Intronic
1182558894 22:31143566-31143588 ATCTATGGGAAGAGAGGGGAAGG + Intergenic
1183583263 22:38738045-38738067 AGCTGTGGGAAAGGAGAGCAGGG + Intronic
1183712834 22:39515945-39515967 ATCTGTGACAAAAGAGGGGCAGG - Exonic
1183880002 22:40819269-40819291 ATCTGTGGGAAAAGTGTGGCTGG - Exonic
1183968783 22:41460237-41460259 GTCTGGGTGAAGGGAGAGGAGGG + Exonic
1184217167 22:43075512-43075534 ATAACTTTGAAAAGAGAGGATGG - Exonic
1184308593 22:43626479-43626501 ATTTGTGTGAGAAGAGACCATGG - Exonic
949261882 3:2112000-2112022 CTCTGTGTGGAGACAGAGGAAGG + Intronic
950676576 3:14557769-14557791 AGCTGTGCAAACAGAGAGGAAGG + Intergenic
950825603 3:15816891-15816913 ATCTCTATTAAAAAAGAGGAGGG + Intronic
951353967 3:21641546-21641568 ATATGTGTTAATAGAGAGAACGG - Intronic
951447344 3:22798228-22798250 CCCAGTGTGAAAAGAGAGCAGGG - Intergenic
951484434 3:23196064-23196086 ATACCTGTGAAAAGAGAGAAAGG - Intergenic
951823302 3:26838396-26838418 ATCTATGTGACGAGAGAGGAGGG + Intergenic
952743566 3:36757679-36757701 ATCAGTGAGAAAAGATGGGATGG + Intergenic
953819028 3:46188346-46188368 TTCTTTGTGAAAAGAAAGAAAGG - Intronic
953877622 3:46675307-46675329 ATCTGTGTGCAGGGAGAGGAGGG + Intronic
954872723 3:53780007-53780029 ATCTCTGTAAACAGAAAGGAAGG - Exonic
955882307 3:63560528-63560550 ATCTTTGTGAATAAAGAGGATGG - Intronic
956144600 3:66180075-66180097 ATCTGAGGGCAAAGAGAGAAAGG - Intronic
956498325 3:69853213-69853235 ATCTGTGAGAACAGAGATGGTGG + Intronic
957480346 3:80784635-80784657 ACCTGTGTGAAATGAGTTGATGG - Intergenic
957979765 3:87494140-87494162 ATCTCTAGGAAAAGAGAGGAAGG + Intergenic
958544828 3:95531702-95531724 ATCTGTAAGAGAAGAGAGGGTGG - Intergenic
959265559 3:104132954-104132976 TTCTGTGTCAGAAGAGAAGAAGG + Intergenic
959613525 3:108321338-108321360 AGCTTCTTGAAAAGAGAGGATGG + Intronic
960257215 3:115523542-115523564 AGCTATGTTAAAAAAGAGGATGG + Intergenic
960998439 3:123354630-123354652 ATCTGTGTGAAAAGAGAGGAAGG + Intronic
961054079 3:123772423-123772445 TTCTGTGTGTAATGTGAGGAAGG - Intronic
961615238 3:128174116-128174138 ATCTGTGGAAACAGAGGGGAGGG - Intronic
963005672 3:140724292-140724314 ATCTGTGTGGAAAGTTAGGCAGG + Intergenic
963496667 3:146072141-146072163 TTTTGTGTGTAAAGATAGGAAGG - Intronic
964019792 3:151995949-151995971 ACCTGTATGAGAAGAAAGGAAGG - Intergenic
964151661 3:153532498-153532520 TTCTGTTTGAGAAGAGGGGAGGG + Intergenic
964194819 3:154050834-154050856 TTCTGTGTGAAAATCCAGGATGG + Intergenic
964223735 3:154373095-154373117 GTTTGTGTGAAATGAGAAGAGGG + Intronic
964566751 3:158064451-158064473 ATCTGCTTCAAAAGTGAGGAGGG + Intergenic
965610142 3:170535156-170535178 ATCTGCGGGAGAAGAGTGGAAGG - Intronic
966540128 3:181079817-181079839 AATTGAGTGAAAGGAGAGGAAGG + Intergenic
966774733 3:183533843-183533865 AGCTGAGGGAAAAGAGAAGAGGG - Intronic
966789066 3:183648221-183648243 ATTAGAGTGAGAAGAGAGGATGG + Intronic
966790720 3:183667093-183667115 CCCTGTGGGGAAAGAGAGGAAGG - Intronic
967012147 3:185445836-185445858 GTTGGTGTGACAAGAGAGGATGG - Intronic
968792214 4:2673660-2673682 CTCTGGGTGTAAAGTGAGGAAGG + Intronic
970010895 4:11457944-11457966 AACTGTGTGAAGACAGAGGGAGG - Intergenic
970159354 4:13173428-13173450 ATCTTTTAGAAAAGCGAGGAGGG - Intergenic
970304381 4:14716684-14716706 AGCAGTGTGAACAGAGAGCAGGG + Intergenic
970917010 4:21347763-21347785 AAATGGGTGAGAAGAGAGGAAGG - Intronic
971263187 4:25075736-25075758 AACTCTGTCAAAAGTGAGGAAGG + Intergenic
971485341 4:27154264-27154286 ATCTGGTTGAAAAGACAGCACGG + Intergenic
971791134 4:31171114-31171136 ATATGTGTGGAAAGAAAGAATGG + Intergenic
971962681 4:33508755-33508777 ATTTTTGTGAGAAAAGAGGATGG + Intergenic
972903543 4:43715805-43715827 ATCTGTGTGTAGAGAGAGTTTGG + Intergenic
973726149 4:53778123-53778145 ATCTGTGTGCAAAGACAGTGGGG + Intronic
973801706 4:54484770-54484792 CTCAGTGAGAAAAGAAAGGAAGG + Intergenic
974483019 4:62470355-62470377 CTCTGTCTGAAAAAAGAGAAGGG - Intergenic
974737764 4:65960722-65960744 AGCAGTGTGAAAGAAGAGGAGGG + Intergenic
975799393 4:78043962-78043984 AACTGTGAGAAAAGAAAGAAGGG - Intergenic
975833893 4:78400217-78400239 AGCTGTGGGAGAATAGAGGAAGG - Intronic
975847064 4:78535897-78535919 GTCAGTGTGACAAGAGTGGAGGG - Intronic
976913668 4:90342453-90342475 TTCTCTGTGAAAAGAAAGGTAGG - Intronic
978455757 4:108889527-108889549 ATCTGTGGGAAATGTGATGAAGG - Intronic
978839169 4:113189294-113189316 CTCTGTGGGAAGAGAGAGGAGGG - Intronic
979157768 4:117419474-117419496 ATCTAAGTGAACAAAGAGGACGG + Intergenic
979318775 4:119299317-119299339 ATCTTGGTGAAAATATAGGATGG + Intronic
980039342 4:127921434-127921456 GTCTGTGTAAAAATAGAGAATGG + Intronic
980879644 4:138696895-138696917 AGTTATGTGAAAAGAGAGAAGGG - Intergenic
980883310 4:138736103-138736125 ATATCTCTAAAAAGAGAGGATGG + Intergenic
981070836 4:140536373-140536395 TTCTATGTGAATATAGAGGAAGG + Intronic
981328963 4:143485626-143485648 ATCTATGTGAGAAAAGAGGTAGG - Intergenic
983026000 4:162739126-162739148 ATCTGTATCAAAAGAGAAAAGGG + Intergenic
983560936 4:169100769-169100791 AGCTGTGTAAAAAGAGATTAGGG - Intronic
984926660 4:184813067-184813089 AGCTGTGTGTGAAGAGAGAAGGG - Intronic
985035243 4:185832482-185832504 ATTTGTGTCAAATGAGAGTATGG + Intronic
986120893 5:4835276-4835298 ATCTGTCTGAGAAGTGAGGGTGG + Intergenic
986446709 5:7827610-7827632 AACTGTGTCAAAAGGGAGAATGG - Exonic
987499656 5:18692341-18692363 ATCTGAATGAGACGAGAGGAAGG - Intergenic
989232418 5:39101568-39101590 ATCTGTATCAAAAGTGAGCAAGG + Intergenic
990804067 5:59638093-59638115 ATCTGAGTGTAGAGAGAGGATGG + Intronic
991609145 5:68432989-68433011 AGGTGTGCGAAAAGAGAGCAAGG - Intergenic
991979855 5:72219489-72219511 ATCTTTGGGGAAAGGGAGGAGGG - Intronic
992789307 5:80199183-80199205 GGCTGTGTGACTAGAGAGGAGGG - Intronic
993005976 5:82428738-82428760 AGCTGTGTGTAAAAGGAGGATGG + Intergenic
993031536 5:82712306-82712328 ATGTGTTTGGAAAGAGAGGAGGG + Intergenic
993171217 5:84421457-84421479 TGCTGTGTGAGAAGAGACGAGGG + Intergenic
993547942 5:89235991-89236013 ACTTGTGTGGAAAGAGAGCATGG - Intergenic
993636821 5:90354012-90354034 ATTTGTGTGAAAAGAGGTGGAGG + Intergenic
994383031 5:99094327-99094349 AACTGTGTCAGAAGAGAAGAAGG + Intergenic
994502367 5:100595928-100595950 ATATGTGAGCAAAGAGAGAAAGG + Intergenic
995452707 5:112320254-112320276 AGCTGTGTGAGAAAAGAGGAAGG + Intronic
995566880 5:113440115-113440137 AACTGGGTGAGAAGAGATGAGGG - Intronic
996859669 5:128050511-128050533 ATCTGAGAGAGAAGAGGGGATGG - Intergenic
997520670 5:134523021-134523043 ACCTTTCTGAAAAGGGAGGAAGG + Intergenic
997875554 5:137543651-137543673 CTGTGTGTGTAAGGAGAGGAGGG + Intronic
998112494 5:139512985-139513007 ATCTGTGTTCATAAAGAGGAAGG - Intergenic
998129462 5:139644037-139644059 ACCTGTGTAAACAGAGGGGAAGG - Intergenic
998875493 5:146594830-146594852 AACTGTGTGAAAGCAGAGGGAGG + Intronic
999509442 5:152233074-152233096 AGCTGTGTGAAGATAGAGGTAGG + Intergenic
1000641091 5:163702565-163702587 AGCTGTGTAAAAAGAAAAGAAGG - Intergenic
1000936483 5:167308050-167308072 TCCTGTGTGAATAGAGAGAAAGG + Intronic
1001074721 5:168617109-168617131 ATCTGTGTGACCTGTGAGGAAGG - Intergenic
1001241563 5:170075491-170075513 AGCTGAGAGAAAACAGAGGAGGG - Intronic
1001491235 5:172156868-172156890 ATGAGTGTGAAAACAGAGGCCGG + Intronic
1001610794 5:172999913-172999935 ATCTGAGTGAAAAATGTGGACGG + Intronic
1003277893 6:4667847-4667869 GTCTGTGGGAAGAGAGAAGAAGG - Intergenic
1003692121 6:8365148-8365170 ATCTCTGTGCAGAGGGAGGATGG - Intergenic
1004722626 6:18281085-18281107 AGCTGAGTGTAGAGAGAGGAAGG + Intergenic
1005270929 6:24162670-24162692 ATGTATCTAAAAAGAGAGGAAGG + Intergenic
1005659476 6:27981405-27981427 ATCAGCTTGAGAAGAGAGGACGG + Intergenic
1005867086 6:29944481-29944503 AGCTCTGGGAAAAGAGGGGAAGG - Exonic
1006056465 6:31388667-31388689 ATTTGTGTGAAAAGGGACAAAGG + Intergenic
1006101019 6:31686497-31686519 ATCTTGGTGAAGAGTGAGGAAGG - Intergenic
1006277073 6:33013651-33013673 ATGTGTGTAAAGAGAAAGGAGGG + Intergenic
1006441989 6:34058739-34058761 AAATGTCTGAGAAGAGAGGAGGG + Intronic
1007971903 6:46060406-46060428 ATCTCTGTGAAAAAAGAGGGTGG + Intronic
1007994882 6:46296286-46296308 TTCTGAGTCAAAAGAGTGGAGGG + Intronic
1010715225 6:79221368-79221390 ATCTTTGTGTAAAGAAAGAATGG - Intronic
1010716938 6:79240854-79240876 ATCTATGTCCAAAGAGAGAAGGG + Intergenic
1011860881 6:91754369-91754391 ATATGTCTAAAAAGAGAGGCAGG - Intergenic
1013492193 6:110659320-110659342 AGCTGAGTGAAAACAGAGGGTGG + Intronic
1013882310 6:114919457-114919479 ATCAGTGTGAAAAGAGGGTGAGG - Intergenic
1014310296 6:119791815-119791837 GTCTGTTTAAAAAAAGAGGAGGG - Intergenic
1014743437 6:125171902-125171924 CTCCGTGTGAGAGGAGAGGATGG + Intronic
1014893303 6:126869535-126869557 ATCTCAGTGAACAGAGTGGAAGG - Intergenic
1016270779 6:142288015-142288037 GTCTGTGTGAGAATAGAGGGAGG + Intergenic
1016685920 6:146882013-146882035 GTATGTGTGATAAGAGAGAAAGG - Intergenic
1017513206 6:155132424-155132446 CTCTGTGTGAAGGAAGAGGAGGG - Intronic
1018268711 6:162053539-162053561 ATATATGTGCAAAGAGAGAAAGG + Intronic
1018901656 6:168054671-168054693 ATCTGTGCAAAAAGAAAGGTTGG + Intergenic
1019281435 7:202393-202415 TCCTGTGTGCATAGAGAGGACGG + Intronic
1019380937 7:723114-723136 CTCTTTGTGCTAAGAGAGGAAGG + Intronic
1019701352 7:2476287-2476309 ATCTCTGTGCAGAGAGAGCACGG + Intronic
1020837877 7:13177193-13177215 ATCTGTGGGAAAGTAGAAGAGGG - Intergenic
1021001610 7:15338650-15338672 ATCACTGTGCAAAGGGAGGAAGG + Intronic
1022119672 7:27295787-27295809 GTGTGTGTTTAAAGAGAGGAAGG + Intergenic
1023712444 7:43009364-43009386 CTATGGGTGAAATGAGAGGAAGG - Intergenic
1024918970 7:54536693-54536715 ATATGTGTGAGAAGAGGGGCAGG - Intergenic
1025034647 7:55586547-55586569 ATCTGTGTGAGAAGGATGGATGG - Intergenic
1027477981 7:78657497-78657519 AGCTGTCTGAAAAGATATGAAGG + Intronic
1027870135 7:83696151-83696173 ATCTGGTGGAAAACAGAGGAAGG + Intergenic
1027990373 7:85352054-85352076 ATCTGTGGGATCAGAGATGATGG + Intergenic
1028025457 7:85832021-85832043 GACTGTGTGAAAAGAAAGGGAGG + Intergenic
1028196333 7:87912046-87912068 TTTTGTGTGAAAAGAGAAGTAGG - Intergenic
1028492458 7:91427290-91427312 CTTTTTGTGAAATGAGAGGAGGG + Intergenic
1034067159 7:148148049-148148071 AACTGTGTGGAAGGAAAGGAAGG + Intronic
1034514048 7:151559907-151559929 GAGTGTGTGAAATGAGAGGAAGG + Intronic
1034631005 7:152530527-152530549 GACTCTGTGGAAAGAGAGGAGGG - Intergenic
1034755660 7:153616859-153616881 AGCTGTGAGAGAGGAGAGGACGG + Intergenic
1034867314 7:154652914-154652936 CTCTGAGTGGGAAGAGAGGAGGG + Intronic
1034916583 7:155044982-155045004 ATCTGTGTAAGCAGAGAGAAAGG - Intergenic
1035145193 7:156808649-156808671 ATCTGTGGGAACATAGAAGAAGG - Intronic
1036616932 8:10395381-10395403 ATGTGTGTAGAAAGAGAGTAGGG + Intronic
1036658396 8:10692156-10692178 CTCTGAGTGAAAGGACAGGAAGG + Intronic
1037410459 8:18590379-18590401 AGCAGTGTGTAAAGAGTGGAAGG + Intronic
1037996483 8:23356213-23356235 ATTTGTGTAAACAGAGTGGATGG - Intronic
1038321594 8:26532052-26532074 ATGTTTGTGTAGAGAGAGGAAGG + Intronic
1039256161 8:35721212-35721234 AGGTGTGTGAAAATGGAGGATGG - Intronic
1039333225 8:36561900-36561922 AACTGAGAGACAAGAGAGGAGGG - Intergenic
1039334231 8:36572300-36572322 ATTTGTTGGAAAAGAGAGGGAGG + Intergenic
1040042623 8:42931759-42931781 ATCTGTCAAAAAAGAAAGGACGG - Intronic
1041761070 8:61367017-61367039 ATATGGGTGTGAAGAGAGGAAGG - Intronic
1042734342 8:71970835-71970857 ATATGTGAGAGAAGAGAGGAAGG + Intronic
1043583389 8:81739019-81739041 ATCTGAGTGATGATAGAGGAAGG - Intronic
1044002378 8:86899573-86899595 ATCTTTATGAAAATAAAGGAGGG - Intronic
1044184787 8:89238544-89238566 ATCTTTGGGAAAAAAAAGGAGGG - Intergenic
1046018760 8:108638009-108638031 ATGTGTCTGCAAAGAGAGGTTGG - Intronic
1046999304 8:120557619-120557641 ATGTGTGGGAATACAGAGGAGGG - Intronic
1047358420 8:124144940-124144962 AAGTGTGGGAAAAGGGAGGATGG + Intergenic
1047503293 8:125458909-125458931 TTCTGTGGGAACACAGAGGAGGG + Intergenic
1047631926 8:126716736-126716758 CCCTGTGTGAAAAGATAGGAAGG + Intergenic
1048428010 8:134340664-134340686 TTGTGTGCGAAAAGAAAGGATGG - Intergenic
1048945678 8:139444974-139444996 ATATGTGTGAAGAGAGAAGTAGG + Intergenic
1049386920 8:142347480-142347502 GTCTCTGTGCAGAGAGAGGATGG - Intronic
1049632543 8:143666435-143666457 ATGTGTGTGCACACAGAGGAGGG - Intergenic
1049632562 8:143666533-143666555 ATGTGTGTGCACACAGAGGAGGG - Intergenic
1049632584 8:143666631-143666653 ATGTGTGTGCACACAGAGGAGGG - Intergenic
1049632595 8:143666679-143666701 ATGTGTGTGCACACAGAGGAGGG - Intergenic
1049632616 8:143666777-143666799 ATGTGTGTGCACACAGAGGAGGG - Intergenic
1050436666 9:5618140-5618162 ATTTGTCTGAATAGAGAGTAGGG + Intergenic
1050587342 9:7126189-7126211 ATATGTGTGGAAGGAGAAGAGGG + Intergenic
1050735518 9:8758054-8758076 ATCTGTGTGAAATGAAATAATGG + Intronic
1051375007 9:16393645-16393667 ATCTGTAAGAGAGGAGAGGAAGG + Intergenic
1051681366 9:19611269-19611291 ATGTGAGAGAAAAGAGAGAAGGG + Intronic
1053512375 9:38699459-38699481 ACATCTGTGAAAAGAGAGGGGGG + Intergenic
1054958036 9:70935599-70935621 ATCAGTGAGTAAAGAGAGCAAGG - Intronic
1056956546 9:91086336-91086358 AACAGTGTGAAAAGAGAGACTGG + Intergenic
1057317509 9:93979304-93979326 ATCTGTGTGCACAGTGGGGAGGG - Intergenic
1058695482 9:107555424-107555446 ATCGATGTGAGAAGACAGGAGGG - Intergenic
1059440548 9:114304454-114304476 GACTGTCTGCAAAGAGAGGAAGG + Intronic
1059663947 9:116428112-116428134 AGCTGTGTGAAGACAGAGGAAGG + Intronic
1059862561 9:118481216-118481238 ACCTGTGGAAGAAGAGAGGAAGG + Intergenic
1185528368 X:797076-797098 TTCTGTGTGAAAACTGAAGAAGG - Intergenic
1187452832 X:19413742-19413764 TACTTTGTTAAAAGAGAGGAGGG + Intronic
1188489503 X:30722771-30722793 GTGTGTGTGAAGAGAGAGGGGGG + Intronic
1189555687 X:42142875-42142897 AACTGTGGGAAATGAGAGGATGG + Intergenic
1190969103 X:55331677-55331699 ATCTGACTGAAAAGACATGAGGG + Intergenic
1191680775 X:63837797-63837819 ATATGGGTGAAAAGATATGATGG - Intergenic
1193815478 X:86100423-86100445 ATGTGTGTAAAAAGAAAGGAAGG - Intergenic
1194305133 X:92235473-92235495 ACCTGTGTTAAAAGAGAGAGTGG - Intronic
1195229025 X:102827597-102827619 ATCTGTGAGAGAAGAAAGCAAGG - Intergenic
1195552882 X:106188021-106188043 ATATGAGTGGAAAGAGAGGAGGG - Intronic
1196038849 X:111178675-111178697 ATCTCTGTGGACAGAGAGGAGGG + Intronic
1196950069 X:120868232-120868254 CACTGTGAGAAAAGGGAGGAAGG - Intergenic
1197375991 X:125682495-125682517 ATCTGTTTGAGAAAAGTGGAGGG + Intergenic
1197748772 X:129951004-129951026 ACATGTGTGACAAGAGAGAAAGG + Intergenic
1198056146 X:132997203-132997225 ATCTTTGTGGAAAGATGGGAGGG - Intergenic
1198142350 X:133817144-133817166 ATATGGGGGAAAACAGAGGATGG - Intronic
1198276803 X:135102254-135102276 ATTTGTATTAAAAGTGAGGAGGG - Intergenic
1199419202 X:147623878-147623900 ATCTGGGAGACCAGAGAGGAAGG + Intergenic
1199445926 X:147920823-147920845 AGCTATGTAAAAAGAGGGGAAGG + Intronic