ID: 961001644

View in Genome Browser
Species Human (GRCh38)
Location 3:123378212-123378234
Sequence TATCCACCCCTCCCAGGGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 150}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961001644_961001647 -8 Left 961001644 3:123378212-123378234 CCAGTCCCTGGGAGGGGTGGATA 0: 1
1: 0
2: 0
3: 17
4: 150
Right 961001647 3:123378227-123378249 GGTGGATACCCTGCTTCTTCAGG 0: 1
1: 0
2: 0
3: 6
4: 98
961001644_961001651 3 Left 961001644 3:123378212-123378234 CCAGTCCCTGGGAGGGGTGGATA 0: 1
1: 0
2: 0
3: 17
4: 150
Right 961001651 3:123378238-123378260 TGCTTCTTCAGGTGAGGAAATGG 0: 1
1: 0
2: 1
3: 40
4: 366
961001644_961001652 4 Left 961001644 3:123378212-123378234 CCAGTCCCTGGGAGGGGTGGATA 0: 1
1: 0
2: 0
3: 17
4: 150
Right 961001652 3:123378239-123378261 GCTTCTTCAGGTGAGGAAATGGG 0: 1
1: 0
2: 2
3: 41
4: 316
961001644_961001648 -3 Left 961001644 3:123378212-123378234 CCAGTCCCTGGGAGGGGTGGATA 0: 1
1: 0
2: 0
3: 17
4: 150
Right 961001648 3:123378232-123378254 ATACCCTGCTTCTTCAGGTGAGG 0: 1
1: 0
2: 1
3: 12
4: 132
961001644_961001653 17 Left 961001644 3:123378212-123378234 CCAGTCCCTGGGAGGGGTGGATA 0: 1
1: 0
2: 0
3: 17
4: 150
Right 961001653 3:123378252-123378274 AGGAAATGGGTCTAGTGTCCAGG 0: 1
1: 0
2: 1
3: 8
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961001644 Original CRISPR TATCCACCCCTCCCAGGGAC TGG (reversed) Intronic
900421026 1:2556010-2556032 CTTCCACCCCTCCCAGGGGACGG + Intronic
901313986 1:8293026-8293048 TGTCCAACCCTGCCTGGGACTGG + Intergenic
901794674 1:11673439-11673461 TACCCACTCCTCCCAGGGCCAGG + Intronic
902401034 1:16156849-16156871 TATCAACCCATGCCAGGGTCGGG - Intergenic
903401958 1:23060098-23060120 TATCCACCCCACCCAAGCCCTGG - Intronic
905355618 1:37381963-37381985 TATGCACCCCTCCCTGGGCTAGG - Intergenic
905706564 1:40064346-40064368 TAGCCACCCAGCCCAGGGCCTGG - Exonic
905858317 1:41329777-41329799 TCTCCAACCCTCCCAGGCTCCGG + Intergenic
906536597 1:46554307-46554329 CCTCCACCCCTCCCAAGGATTGG + Intergenic
907158554 1:52355515-52355537 CAGCCACACCTCCCAGGGATGGG + Intronic
915145475 1:153793879-153793901 TGTCCCCTCCTCCCAGGGCCAGG - Intergenic
916203547 1:162294333-162294355 TCCCCACATCTCCCAGGGACGGG + Intronic
916330255 1:163608025-163608047 TAGCCAACCCTCCCAGTGTCTGG - Intergenic
916533335 1:165679412-165679434 TTTACACCTCTTCCAGGGACAGG + Intronic
921187125 1:212679699-212679721 TATCCACCTCTTCCAGTGTCTGG - Intergenic
921308311 1:213818901-213818923 TAGCGAACACTCCCAGGGACTGG - Intergenic
921814627 1:219549620-219549642 TCACCACCACTCCCAGGGGCTGG + Intergenic
923369344 1:233295288-233295310 TACCCACAGCTCCCCGGGACCGG + Intronic
1063636413 10:7787527-7787549 TTTGCACCCCTCACAGGGGCGGG - Intronic
1064095775 10:12423604-12423626 TATCCAGAACTCCCAGGTACAGG + Intronic
1067676002 10:48377590-48377612 TTTCCACCCCTCCCCTGGATTGG + Intronic
1067829913 10:49605660-49605682 TCTCTACAGCTCCCAGGGACAGG - Intergenic
1069663674 10:70140231-70140253 TATCCAGCCCTACCAGGCCCTGG - Intronic
1069948451 10:72003009-72003031 TGGCCACCCCTCCCAGGTCCAGG - Intronic
1070775374 10:79106708-79106730 TATCCAGCCCTAGCAGGGAGTGG - Intronic
1071039172 10:81286278-81286300 TGTGCACCACTCCCATGGACAGG + Intergenic
1072735416 10:97875813-97875835 TATGGCCCCCTCCCAGGGTCTGG - Intronic
1073139508 10:101238121-101238143 AATCCAGCCCTCGCAGGGCCTGG + Intergenic
1077490715 11:2859660-2859682 TATCCATGCCTCCCAGCCACGGG - Intergenic
1078027205 11:7708240-7708262 TATTCAACCCTCCCAGGGTCTGG + Intergenic
1081050588 11:38335910-38335932 TCTCCAACCTTCCCAGGCACTGG + Intergenic
1081669965 11:44937346-44937368 TTTCCACGCCTCCCAGGGTCTGG - Exonic
1084006726 11:66327015-66327037 CACCCACCCCACCCAGGGCCAGG - Intergenic
1084932607 11:72569182-72569204 GAGCCACCCATCCTAGGGACTGG + Intergenic
1089602853 11:119625876-119625898 TACCCTCCCCTGCCAGGCACTGG - Intronic
1092087420 12:5774691-5774713 GACCCAGCCCTCCCAGGGACAGG + Intronic
1092981091 12:13794972-13794994 TATCCAGCCATCCCAGGAGCTGG - Intronic
1096260502 12:50087230-50087252 CATCCACCCACCCAAGGGACTGG + Intronic
1097036531 12:56128280-56128302 GATCCGCCCGACCCAGGGACTGG - Exonic
1099861958 12:88232704-88232726 TATCCACCAAGCCCAGGGCCTGG + Intergenic
1101879226 12:108614986-108615008 TCCCTGCCCCTCCCAGGGACTGG - Intergenic
1102047683 12:109840038-109840060 CAACCACCCCTCCCATGGGCAGG + Intergenic
1108245387 13:48508229-48508251 TCTCCACCCTTTCCAGGGATGGG - Intronic
1109202933 13:59451016-59451038 TCTCCACCCCTCTCAGAGTCTGG - Intergenic
1112483646 13:99800380-99800402 TATCAGCCTCTCCCAGGCACTGG - Intronic
1114724530 14:24921665-24921687 TATCCACACCACAGAGGGACAGG + Intronic
1122293819 14:100693939-100693961 TACCCACCCCTCCCAAGCACTGG + Intergenic
1122296719 14:100709936-100709958 TGTCCCCCCCACCCAGGGGCAGG - Intergenic
1122389473 14:101370407-101370429 TCTCAACACCTGCCAGGGACCGG - Intergenic
1125412027 15:39415894-39415916 TGACCATCCCTGCCAGGGACTGG - Intergenic
1126549323 15:49909237-49909259 TGACCACTCCTCCCAGAGACTGG + Intronic
1126846730 15:52766977-52766999 TGTCCACCCCTCCCAGGCCCAGG - Intronic
1127493101 15:59483881-59483903 TGTCCACCCCTCCATGGGGCAGG - Intronic
1130995534 15:88901769-88901791 GATCCACAGCTCCCAGGGGCAGG + Intronic
1132470139 16:97988-98010 CCTCCAGCCATCCCAGGGACTGG + Intronic
1132769158 16:1551408-1551430 TTTCCACCCCTCTCAGTCACTGG - Intronic
1133164915 16:3939406-3939428 TGTCCATCCCTCCCAGGGATCGG - Intergenic
1134077692 16:11303642-11303664 CATGCTCCCCTCCCAAGGACAGG + Intronic
1134682357 16:16135044-16135066 AAACTACCCCTCCCGGGGACAGG - Intronic
1135941638 16:26827068-26827090 TATCCACCCCTCCCAAATGCAGG + Intergenic
1136364561 16:29803715-29803737 TCCTCACCCCTCCCTGGGACTGG - Intronic
1141004510 16:80339696-80339718 TATCCAATCCTCCCAGGGGCAGG + Intergenic
1141250831 16:82357544-82357566 CATCCACCCCTCCCAGAGGAGGG - Intergenic
1141799097 16:86295176-86295198 TCTGCACCCCTCCCAAGGCCTGG + Intergenic
1141911537 16:87062880-87062902 AAACCTCCCCACCCAGGGACGGG + Intergenic
1142241651 16:88950193-88950215 TGTTCACCCCTCCCCTGGACCGG + Intronic
1142241718 16:88950461-88950483 TGTTCACCCCTCCCCCGGACCGG + Exonic
1142241866 16:88951066-88951088 TGTTCACCCCTCCCCTGGACCGG + Exonic
1143129954 17:4671876-4671898 TCTCCACCTCTCCCTGGGAGGGG + Exonic
1145882847 17:28364686-28364708 CATCCCCTCCACCCAGGGACAGG + Intronic
1147991203 17:44334537-44334559 TAGCCACCCCTCCCAGGGGAAGG + Intergenic
1148804927 17:50259222-50259244 TATCTGCCCCTTCTAGGGACTGG - Intergenic
1151585250 17:75004696-75004718 GCTCCAGCCCTGCCAGGGACAGG + Exonic
1152128957 17:78464799-78464821 AAACCACCCCTCCCTGGCACAGG + Intronic
1153855216 18:9137594-9137616 CATCCACCTCTCCCAGGACCCGG - Intronic
1155030308 18:21978480-21978502 ACTCCACCCCTCCCATGGGCCGG - Intergenic
1156818328 18:41339790-41339812 TGTCCACCTCTGCCAGAGACAGG - Intergenic
1159912163 18:74155994-74156016 TGTCCACTCCTCCCAGGGAAGGG - Intronic
1160951931 19:1671973-1671995 TTTCCCCACCTCCCAGGGAGAGG - Intergenic
1162151619 19:8649668-8649690 TCCCCACCCTGCCCAGGGACTGG - Intergenic
1162567603 19:11453018-11453040 CATCCACCCCACCCTGGGCCTGG + Exonic
1162793314 19:13074058-13074080 TCTCCACTCCCCCCAGGGCCAGG + Intronic
1163748479 19:19061720-19061742 TACCTCCCCCTCCCAGGGCCTGG + Intergenic
1166377403 19:42335280-42335302 TATCCACCCCTCCACAGGCCAGG + Exonic
1167783115 19:51613432-51613454 AATCCACTCCTCCTAAGGACAGG + Intronic
1168106462 19:54168489-54168511 TAACCCCCACTCCCAGGGCCTGG - Exonic
925976522 2:9145952-9145974 TCTCCACCCCTCCAAAGGGCGGG + Intergenic
933620574 2:84535465-84535487 TATCCACCCCACCCAGAAAAGGG + Intronic
933738790 2:85516765-85516787 TATCCGGCTCTCCCAGGCACCGG + Intergenic
933917538 2:87011172-87011194 TACACACCCCTCAGAGGGACTGG - Intronic
934005458 2:87758745-87758767 TACACACCCCTCAGAGGGACTGG + Intronic
935666496 2:105517327-105517349 GATCCACCAAGCCCAGGGACTGG - Intergenic
935768417 2:106392837-106392859 TACACACCCCTCAGAGGGACTGG + Intronic
935911685 2:107903087-107903109 TACACACCCCTCAGAGGGACTGG - Intergenic
948185308 2:236016683-236016705 TCTCCACCCCTCCGAGGTGCTGG - Intronic
948364905 2:237448505-237448527 TCTCCAGCCCTCCGAGGAACTGG - Intergenic
1170799049 20:19575341-19575363 TATCCACCCCTCCCAAGCATGGG - Intronic
1172587036 20:36092447-36092469 TCTGCTCCCCTCCCCGGGACCGG + Intronic
1173464824 20:43272358-43272380 CTTCCACCCCTCCCTGGGACTGG - Intergenic
1174282647 20:49450374-49450396 TCCCCACCCCTCCCTGGCACAGG + Intronic
1175228584 20:57459741-57459763 TATTCACCCATCTCAGGGAGCGG - Intergenic
1175257845 20:57657710-57657732 TGTCCAGACCTGCCAGGGACAGG + Intronic
1176898917 21:14416839-14416861 CATCCCACCATCCCAGGGACTGG + Intergenic
1176898932 21:14416909-14416931 TATCCCATCTTCCCAGGGACTGG + Intergenic
1180968830 22:19804302-19804324 TCTGCACCCCTCCCATTGACTGG + Intronic
1182136081 22:27904455-27904477 TACCCACTCCTCCCAGTGCCTGG - Intronic
1184298268 22:43539936-43539958 TCTGCCCCCCTCCCAGGGAATGG + Intronic
1184375201 22:44107622-44107644 TCTCCACCCCACCCAGAGGCTGG - Intronic
954610511 3:51942455-51942477 TGTCCACCCGTCCGTGGGACTGG + Exonic
955240615 3:57174763-57174785 TCTGCACCCCTGCCTGGGACAGG + Intergenic
957146715 3:76434410-76434432 TAGCCACCCAGCCCAGGGCCTGG - Intronic
961001644 3:123378212-123378234 TATCCACCCCTCCCAGGGACTGG - Intronic
961737591 3:129011832-129011854 TTTGCACCCCTCCCAGAGAGAGG + Intronic
961813488 3:129535240-129535262 AATCCAGCCATCCCAGGGTCAGG - Intergenic
962282908 3:134065726-134065748 TAATGACCACTCCCAGGGACTGG + Intronic
963067778 3:141277620-141277642 TGTCCACCCCTGCCAGGGGGTGG + Intronic
967923793 3:194631407-194631429 CATCCACCATTCCCAAGGACAGG - Intronic
969584923 4:8085957-8085979 CACCCACCCCTGCCAGGTACAGG + Intronic
971379095 4:26080592-26080614 TATCCACTACTCACAGGGAAGGG + Intergenic
976502564 4:85808522-85808544 AGACCACCCCTCCCTGGGACAGG - Intronic
979290242 4:118971864-118971886 TGTCCACCCCTCTCATGGATGGG - Intronic
986569009 5:9146119-9146141 TACCCACCCTGCCCAGGGTCTGG + Intronic
987963086 5:24835845-24835867 TGTGCACTCATCCCAGGGACAGG + Intergenic
999388020 5:151169268-151169290 TCCCCTCCCCTCCCATGGACAGG + Intergenic
999836839 5:155382899-155382921 TATTAACCCCTCCCATGGAAAGG - Intergenic
1001513301 5:172338399-172338421 AATCCACCCTTCCCAGGAAGGGG + Exonic
1001999600 5:176190319-176190341 TATTCACCCCTCTCAGGAACGGG + Intergenic
1002470975 5:179435983-179436005 TCCCCACCCCTCCCAGGCATGGG - Intergenic
1002649551 5:180681516-180681538 TATTCACCCCTCTCAGGAACGGG - Intergenic
1004520749 6:16358975-16358997 TGGCCAACCCTCCCAGGCACAGG + Intronic
1005655964 6:27937776-27937798 ACTCCACCCCTCCCAGGGCCAGG - Intergenic
1016392773 6:143591764-143591786 TATCCATCTCTCCCAGGGTAGGG + Intronic
1016824982 6:148379903-148379925 TCACCACCCCTCCCAGGCCCAGG + Intronic
1018129255 6:160712998-160713020 TACACACCCCTCAGAGGGACTGG + Exonic
1018698577 6:166409649-166409671 TCTCCACACCGCTCAGGGACCGG + Intronic
1019422641 7:958209-958231 TCTCCACCCCGCACAGGGGCCGG + Intronic
1019749682 7:2721174-2721196 TTTCCATCCCTCCCAGGCACAGG - Intronic
1020093548 7:5355035-5355057 TCTCCACCCGCCCCAGGGCCTGG + Intronic
1020156148 7:5726447-5726469 TATCCACCCCACCCTGTAACAGG + Intronic
1022501464 7:30884642-30884664 TCTCTACCCCTCCCAGGGGGTGG + Intronic
1024797410 7:53036009-53036031 CATGCAACCCTCCCAGGCACAGG - Exonic
1029187035 7:98746770-98746792 TAGCCTCCCCTGCCAGGGGCTGG + Intergenic
1029419308 7:100464220-100464242 TTTTCTCCCCTCCCTGGGACAGG + Exonic
1029884056 7:103848447-103848469 TGTCCACCCCACCATGGGACAGG + Intronic
1032205920 7:129865296-129865318 TATAGACCCCTTCCTGGGACTGG - Intronic
1033237388 7:139649152-139649174 TTACCACCCCTCCCACAGACTGG + Intronic
1036252348 8:7173296-7173318 TATCCCCCCTTACCAGTGACTGG + Intergenic
1036365146 8:8114164-8114186 TATCCCCCCTTACCAGTGACTGG - Intergenic
1037215436 8:16445744-16445766 TATTCACCCCTCCCAAGCGCTGG + Intronic
1037446511 8:18971240-18971262 TGTCCGGCCCTCCCAGAGACAGG - Intronic
1037845619 8:22279425-22279447 TATCCACCCATCCCAGTGCCAGG + Exonic
1040512106 8:48105068-48105090 AAGCCACCCTTCCCAGGGAAAGG + Intergenic
1045651164 8:104342751-104342773 TAGCCATCTCTCCCAGGGATGGG - Intronic
1050069150 9:1792116-1792138 CATCCATCCCTCCAAGGGGCTGG - Intergenic
1051122505 9:13766557-13766579 CACCCATCCCTCCCAGAGACTGG + Intergenic
1051311785 9:15782428-15782450 CATCCATCCGTCCCAGAGACTGG - Intronic
1055432475 9:76258041-76258063 TTTCCACAGCTCCCAGGTACAGG + Intronic
1057889891 9:98861916-98861938 TCTCCTCCCCTCCCAGAGAGAGG - Intergenic
1061101050 9:128492613-128492635 TACCCAACCCTCCCTGGGAGTGG - Intronic
1062123802 9:134848705-134848727 AATCCACACCTCCCAGGGCTGGG + Intergenic
1062153233 9:135032207-135032229 TATCCCTCCCTCCCAGGGCAAGG - Intergenic
1062153376 9:135032880-135032902 TATCCTTCCCTCCCAGGGCAAGG + Intergenic
1062454351 9:136628698-136628720 TATCCAACCCTCCCTTGTACAGG - Intergenic
1062622521 9:137429260-137429282 TACCCACCCCCTCCAGAGACGGG + Exonic
1188048997 X:25461261-25461283 TACCCACCCTTCCCAGCCACTGG - Intergenic
1190263902 X:48816278-48816300 AATCCACCCACCCCAGGCACCGG - Intronic
1199578017 X:149333579-149333601 AATCTACCACTCCCAGGCACAGG + Intergenic
1200115731 X:153768953-153768975 TCTCCACGGCTCCCAGGGCCAGG + Exonic