ID: 961001999

View in Genome Browser
Species Human (GRCh38)
Location 3:123380259-123380281
Sequence GTGGTGAACAGGCTTGAGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 180}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961001989_961001999 28 Left 961001989 3:123380208-123380230 CCAATGCCATCCATGTGATTATC 0: 1
1: 0
2: 1
3: 10
4: 129
Right 961001999 3:123380259-123380281 GTGGTGAACAGGCTTGAGTAGGG 0: 1
1: 0
2: 1
3: 19
4: 180
961001991_961001999 18 Left 961001991 3:123380218-123380240 CCATGTGATTATCAACCACAAAC 0: 1
1: 0
2: 1
3: 8
4: 103
Right 961001999 3:123380259-123380281 GTGGTGAACAGGCTTGAGTAGGG 0: 1
1: 0
2: 1
3: 19
4: 180
961001994_961001999 3 Left 961001994 3:123380233-123380255 CCACAAACGTTTACAGGGAGCCA 0: 1
1: 0
2: 0
3: 3
4: 89
Right 961001999 3:123380259-123380281 GTGGTGAACAGGCTTGAGTAGGG 0: 1
1: 0
2: 1
3: 19
4: 180
961001990_961001999 22 Left 961001990 3:123380214-123380236 CCATCCATGTGATTATCAACCAC 0: 1
1: 0
2: 1
3: 12
4: 139
Right 961001999 3:123380259-123380281 GTGGTGAACAGGCTTGAGTAGGG 0: 1
1: 0
2: 1
3: 19
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961001999 Original CRISPR GTGGTGAACAGGCTTGAGTA GGG Intronic
904145758 1:28390175-28390197 GTGTTGCCCAGGCTGGAGTACGG + Intronic
904619647 1:31767519-31767541 GTGGTGAACAGGGCTGAGTGAGG - Intergenic
906998099 1:50819587-50819609 CTGTTGACCAGGCTGGAGTATGG - Intronic
907571405 1:55487495-55487517 GTGGTGAATAGGCTTGGGGGAGG + Intergenic
912944123 1:114070449-114070471 CTGGAGAACAGGCATGAGAATGG - Intergenic
913158295 1:116121807-116121829 GTGGTTTACAGGTTTAAGTAAGG - Intronic
914912132 1:151796158-151796180 CTGGTGAAGAGGCTTAAGTGGGG - Intergenic
914952771 1:152131942-152131964 GTGCTGCACAGGCTTGGGTAAGG - Intergenic
915270733 1:154751534-154751556 GTGGTGAAAAGCCTTGGGTTAGG - Intronic
915337006 1:155149872-155149894 GTCGTGCCCAGGCTGGAGTACGG - Intergenic
917261212 1:173172208-173172230 CTGGTGTACAGGCATGTGTAGGG + Intergenic
919241508 1:194922233-194922255 CTGGAGAACAGGCATGAGAATGG + Intergenic
922322605 1:224501940-224501962 GTGGTGAGGAGGCTGGAGGAAGG + Intronic
923866973 1:237949920-237949942 TTTGTGAATAGGCTTGAGTGGGG + Intergenic
924459488 1:244245803-244245825 GTGTTGCACAGGCTGGAGTATGG - Intergenic
1064893507 10:20207791-20207813 GTGTTGAACAAGCTTAAGTGTGG - Intronic
1065342048 10:24716713-24716735 GTGGAGAACAGGCTTTAGGCTGG + Intronic
1065852760 10:29804640-29804662 GTGGAGAACAGGCTGGATTTAGG + Intergenic
1065988430 10:30981261-30981283 GGGGTGAGCAGCCTGGAGTAAGG - Intronic
1066564525 10:36707318-36707340 GTGTTGGCCAGGCTGGAGTATGG - Intergenic
1067332852 10:45337946-45337968 CTGGAGAACAGGCATGAGAATGG + Intergenic
1070564243 10:77591352-77591374 GAGGTGGTCAGGCTTGAGTAGGG - Intronic
1070819332 10:79345899-79345921 GAGGTGAGCAGGCCTGAGTGGGG - Intergenic
1073402012 10:103265526-103265548 GTGGAGAACAGCCTTTAGGAGGG + Intergenic
1073483370 10:103800990-103801012 GTGGTGAAGAGGCGGGAGGATGG - Intronic
1074171783 10:110947097-110947119 GTGCTGCACAGGCTTGGGAAGGG - Intronic
1074451052 10:113559961-113559983 ATGGTGAAGTGGCTTGTGTAAGG - Intronic
1075429311 10:122367029-122367051 GTGGTGATCAGGCTTCTGTATGG + Intergenic
1078158410 11:8818224-8818246 GTGTTGCCCAGGCTGGAGTACGG - Intronic
1080866860 11:36203137-36203159 GTGTTGCCCAGGCTGGAGTACGG + Intronic
1081717077 11:45258022-45258044 GTGGTGATCAGGCTAGAATCAGG - Intronic
1085178163 11:74508729-74508751 GTGGAGAACAGGCTTGAGGAAGG + Intronic
1085249187 11:75130945-75130967 GTGGAGAACAGGTGTGAGAATGG + Intronic
1085968300 11:81555702-81555724 CTTGTGAATGGGCTTGAGTAAGG - Intergenic
1086609362 11:88736087-88736109 GTGGTGAACAGGTTTTTCTAAGG - Intronic
1087751655 11:102013473-102013495 GTGGTGGAAAGGCCTCAGTAGGG + Intergenic
1088114551 11:106300098-106300120 GTGTTGGACTGGCTTGACTAGGG + Intergenic
1088264849 11:107979259-107979281 GTGGAGAACAGGCATGGGAATGG + Intergenic
1096879115 12:54653232-54653254 GAGATGGAGAGGCTTGAGTATGG + Intergenic
1099440545 12:82693929-82693951 TTGTTGACCAGGCTGGAGTATGG - Intronic
1100083025 12:90875943-90875965 CTGGAGAACAGGCTTGGGAATGG + Intergenic
1101799824 12:108011508-108011530 GTGGTGAACAGGAGTGAGGAAGG - Intergenic
1102149836 12:110681331-110681353 GAGATGACCAGGCTTGAATATGG + Intronic
1110310135 13:74039491-74039513 GTGTTGCCCAGGCTGGAGTATGG - Intronic
1112230167 13:97581985-97582007 TGTGTGGACAGGCTTGAGTAAGG + Intergenic
1112339161 13:98538260-98538282 CTGTTGACCAGGCTTGAGTACGG + Intronic
1113455342 13:110444885-110444907 GTGTTGCCCAGGCTGGAGTATGG + Intronic
1114588614 14:23838091-23838113 CTGGTGACCAGGCTTCATTAAGG + Intergenic
1119706722 14:76787706-76787728 GTGGTCAAGAGACTTGAGTTCGG - Exonic
1119834762 14:77738541-77738563 GTGTTGCCCAGGCTGGAGTACGG - Intronic
1119907866 14:78321976-78321998 GTGGTGAACAGTCCAAAGTAGGG - Intronic
1121057254 14:90867860-90867882 GTGGACAACAGCCTTGTGTAGGG + Exonic
1121131392 14:91450678-91450700 GTGTTGCCCAGGCTGGAGTATGG + Intergenic
1122511553 14:102272438-102272460 GTGTTGCACAGGCTGGAGTGTGG - Intronic
1127649595 15:60994435-60994457 GTTTTGAATAGGCTTGAGAATGG - Intronic
1128419972 15:67482771-67482793 GTGGGAAACGGGCCTGAGTAGGG + Intronic
1129714434 15:77838761-77838783 GTAGTCCACAGCCTTGAGTAGGG - Intergenic
1130090674 15:80818641-80818663 GTGGTGCACTGGCTTCAGTTTGG - Intronic
1135403371 16:22181479-22181501 GTGATAAACAGGCTTGTGTCCGG - Intronic
1139679374 16:68549141-68549163 GTGGTGACAAGGCTTCAGTGAGG + Intronic
1140473260 16:75226433-75226455 GTGGTGGGCAGGCTAGAGTTGGG + Intergenic
1141091772 16:81135301-81135323 GTGTTGCCCAGGCTGGAGTACGG + Intergenic
1142885518 17:2910042-2910064 GTGGTGAGCAGGCTGGTGTAAGG - Intronic
1144108035 17:12003861-12003883 ATGTTGAACAGGCTTGAGTCAGG + Intergenic
1144956867 17:19023073-19023095 GTGGTGAACAGGGAGGAGGATGG + Intronic
1145744546 17:27305607-27305629 GAGGTTAACAGGCTTGCCTAGGG + Intronic
1146668379 17:34720017-34720039 TTGGTGAACTGGCTGGAGAAGGG + Intergenic
1150150730 17:62807380-62807402 GTGGGGAACAGACTTGTGTTTGG + Intronic
1152175404 17:78783504-78783526 GTGTTGCTCAGGCTAGAGTACGG + Intergenic
1152741523 17:82020505-82020527 GTGGTCCACAGGCTGGAGTGAGG + Intronic
1153364140 18:4235110-4235132 CTGGAAAACAGGTTTGAGTAGGG - Intronic
1154938649 18:21088728-21088750 ATGATGAACAGGTTTGATTAGGG + Intronic
1155066929 18:22276124-22276146 GTGGTGCACAGGCCTGGGAAGGG - Intergenic
1157909512 18:51602291-51602313 TTGGAGAACAGGCATGAGAAGGG - Intergenic
1159444240 18:68521075-68521097 TTGGTGAACATTATTGAGTATGG - Intergenic
1159467526 18:68803993-68804015 GTGGAGAACATACTGGAGTAGGG + Intronic
1161025374 19:2034359-2034381 GTGTTGCCCAGGCTGGAGTACGG + Intronic
1161398411 19:4056988-4057010 GTGTTGCCCAGGCTGGAGTACGG - Intronic
1163015738 19:14452987-14453009 CTGTTGCACAGGCTGGAGTACGG - Intronic
1163348650 19:16761298-16761320 GTTGTGAACATGCATGTGTAAGG + Intronic
1164069411 19:21752863-21752885 GTGTTGTCCAGGCTGGAGTATGG + Intronic
1165737061 19:38183513-38183535 GTGGGGAGCAGGCTTGGGGAAGG + Intronic
1165750026 19:38253773-38253795 GTGGTGAAGGGGCTTCAGCAAGG + Intronic
1165968552 19:39605272-39605294 GTCATGAACAGGCGTGAGTTTGG + Exonic
1165982209 19:39734377-39734399 GTCATGAACAGCCGTGAGTATGG - Exonic
1166559641 19:43723782-43723804 CTGGTGCCCAGGCTGGAGTACGG + Intergenic
1166952323 19:46437757-46437779 GTGGTGATCAGGATTGGTTACGG + Intergenic
925878860 2:8333821-8333843 GGGGTGAAAGGGCTTGGGTAGGG - Intergenic
926084229 2:10010829-10010851 TAGGTGGACAGGCTTGAGTATGG + Intergenic
926084423 2:10011815-10011837 CAGGTGGACAGGATTGAGTACGG + Intergenic
926085119 2:10015278-10015300 CTGGTGGACAGGATTGCGTACGG + Intergenic
926814124 2:16783527-16783549 GTGGTGAGCTTGCTAGAGTATGG + Intergenic
929597582 2:43186071-43186093 CTGGTGGACTGGCTTGAGTGAGG - Intergenic
930053610 2:47235706-47235728 GAGGTGAAGCTGCTTGAGTAGGG + Intergenic
931951565 2:67369226-67369248 GTAGTGAACAGACTTGAAGATGG + Intergenic
935305722 2:101734642-101734664 GCGGTGCACAGGCTAGAGTGTGG - Intronic
937800036 2:126072456-126072478 CTGGAGAACAGGCTTGGGAATGG + Intergenic
937922558 2:127141485-127141507 GTGTTGAACAGAGTTGAGTTAGG - Intergenic
940562228 2:155313229-155313251 CTTGTGGACAGGCTTGAGTGGGG - Intergenic
941166725 2:162090805-162090827 GTGGTGACCAGGTTTGGGGATGG + Intergenic
942299131 2:174545464-174545486 GTTGTAAAAAGGCTTGGGTAGGG - Intergenic
944156911 2:196617133-196617155 TTGGTCAACAGGGTAGAGTATGG - Intergenic
946056646 2:216908624-216908646 GTGTTGAGGAGGCTTGAGAAAGG - Intergenic
946439204 2:219680753-219680775 GTGGGGAAGCGGCTGGAGTAGGG + Intergenic
947818356 2:233053408-233053430 GAGGTGAACAGGGTTGAGTTAGG - Intergenic
948406322 2:237722757-237722779 GTGGTGAAGAGGCCTGCGTGGGG + Intronic
949017243 2:241720387-241720409 GTGGGGAACAGGCCTGAAGAGGG - Intronic
1170460249 20:16571142-16571164 GAGGTGAACAGGTTTGAGGAAGG - Intronic
1176997858 21:15577933-15577955 CTGGAGAACAGGCATGAGAATGG + Intergenic
1177265853 21:18782767-18782789 GTGGTGAAGAGGCTTGATAAAGG - Intergenic
1178536088 21:33411454-33411476 ATGGTGAACAGGCGTGTGGAGGG + Intronic
1179269689 21:39841098-39841120 GTCGTGCACAGGATTGAGTGTGG - Intergenic
1181764256 22:25079872-25079894 GTGGGGAACAGACTCAAGTAAGG + Intronic
1183034250 22:35129179-35129201 GAGGTGTACAGGCTTGAGCCTGG - Intergenic
1184040504 22:41940287-41940309 GTGGTAAACAGGCAAGAGTTAGG - Intronic
949219521 3:1614250-1614272 GTGGGGATAAGGTTTGAGTAGGG - Intergenic
949438230 3:4051868-4051890 GTGGTAAACCGGTCTGAGTAAGG + Intronic
949838215 3:8291971-8291993 GTGGGGAGCAGGTTTGAGGAAGG + Intergenic
950044877 3:9943227-9943249 ATGGTGAAGAGGCTGGAATATGG + Intronic
950305053 3:11910797-11910819 GTGGGGAGCAGGCCTGAGCAGGG + Intergenic
950416814 3:12873507-12873529 GTGGGGAGCAGGCCTGAGAAGGG + Intergenic
950549535 3:13657881-13657903 CTGTGGAACGGGCTTGAGTAAGG - Intergenic
951692615 3:25412488-25412510 CTGGTCAACAGTCTTGAGAATGG - Intronic
955592492 3:60552612-60552634 GCAATGAACAGGCTGGAGTAAGG - Intronic
960970538 3:123136368-123136390 GTGGTGACCAGCCCTGAGAAGGG - Intronic
961001999 3:123380259-123380281 GTGGTGAACAGGCTTGAGTAGGG + Intronic
964669123 3:159205917-159205939 GTGGTGTCCAGGGTTGGGTAGGG - Intronic
968205050 3:196792071-196792093 GTGCTGACCTGGCTTGAGTTAGG + Intronic
970850589 4:20598166-20598188 GAGGTGAACAGGTTTTACTATGG - Intronic
971240910 4:24887950-24887972 GAGGTGAAGAAGCTTGAGTGTGG - Intronic
971685256 4:29757289-29757311 CTGGAGAACAGGCATGAGAATGG + Intergenic
971911773 4:32803734-32803756 ATGTTGTACAGGTTTGAGTAGGG - Intergenic
972506401 4:39724142-39724164 GTTGTCACCAGGCTGGAGTACGG + Intronic
976126187 4:81835825-81835847 GTGTTGCCCAGGCTAGAGTACGG - Intronic
977313167 4:95412243-95412265 GTGGTGAAGAGGATTGAGAAGGG - Intronic
979407498 4:120331387-120331409 GTGGTCATCAGCCTTTAGTAGGG + Intergenic
980532169 4:134070408-134070430 GTGGTGAACTGGCCTGTGCAAGG + Intergenic
981266092 4:142785005-142785027 TTGCTGTACAGGTTTGAGTAGGG - Intronic
981513663 4:145584554-145584576 GTGGTGAAAATCCTTCAGTAAGG + Intergenic
981783289 4:148449577-148449599 GTGTTGCCCAGGCTGGAGTACGG - Intergenic
982316489 4:154037290-154037312 ATGGTTAACTGGCGTGAGTAGGG + Intergenic
982905603 4:161066152-161066174 GTAGTGATCAGGCCAGAGTAAGG + Intergenic
984816402 4:183841238-183841260 GTGTGGCTCAGGCTTGAGTATGG + Intergenic
984846337 4:184111102-184111124 GTGGAAAACAGGCTTAGGTAGGG - Intronic
986185870 5:5437216-5437238 GTACTTAACAGGCTTCAGTAGGG + Intronic
989178156 5:38550074-38550096 GCGGTGAACATGCCTGACTAAGG + Intronic
991565315 5:67998583-67998605 CTGTTGCACAGGCTGGAGTACGG - Intergenic
992173526 5:74127302-74127324 GAGATGCACAGGCTTGAGTGTGG - Intergenic
992351810 5:75937670-75937692 GTGTTGCACAGGCTGGAGTGTGG - Intergenic
992795711 5:80253701-80253723 GTGGTAAGCAGCCTTGAGGAGGG - Intronic
997344482 5:133176808-133176830 CTGTTGCACAGGCTGGAGTATGG + Intergenic
1003148740 6:3530976-3530998 TTGGTGAAGAGGCAGGAGTATGG + Intergenic
1003163700 6:3657918-3657940 GTAGTAAACATGCTTGAGTCAGG - Intergenic
1006062047 6:31430862-31430884 GTGGAGAACAGGCATGGGAATGG + Intergenic
1009349957 6:62661658-62661680 GTGGTTTCCAGGCTTGAGGATGG + Intergenic
1011007054 6:82657339-82657361 GTGGTTGACAGGCTGGAGTGAGG - Intergenic
1016561100 6:145395939-145395961 CTAGTGGACAGGCTTGAGTGAGG - Intergenic
1016926627 6:149356635-149356657 GAGGTGATCAGGTTTGAGTGTGG - Intronic
1023943052 7:44782328-44782350 CTGGTTAACTGGCTGGAGTAGGG + Intergenic
1024911879 7:54455990-54456012 GTGAAGATCAGGCTTGAGTGTGG + Intergenic
1024960301 7:54967710-54967732 GTGGTGAACATCCATAAGTAAGG + Intergenic
1026525512 7:71150109-71150131 ATGGTGAACAGGAATGAGAAGGG - Intronic
1030674815 7:112373529-112373551 TTTGTGAATAGGCTTGAGTGGGG - Intergenic
1030726813 7:112936497-112936519 GTGATGAACAGGCTTGGGGTGGG - Intronic
1031105451 7:117536241-117536263 GAGGTGAAGTGGCTTGACTAAGG - Intronic
1032142267 7:129342770-129342792 GTGGTGAACAGAGGTGAGTAGGG - Intronic
1033423099 7:141219891-141219913 TTGATGAACATGCTTGAGTTAGG + Intronic
1033653872 7:143361193-143361215 GTGGTGAACCGGACTGAGGAGGG + Intronic
1033716954 7:144011968-144011990 GTGAAGAACAGGCTTGCATAAGG + Intergenic
1038064979 8:23954509-23954531 CTGGAGAGCAGGCTTGGGTAGGG + Intergenic
1041596031 8:59654178-59654200 ATGGTGATCAGGCTGAAGTATGG + Intergenic
1042760710 8:72268853-72268875 GTGTTGTATAGGTTTGAGTAGGG - Intergenic
1043425832 8:80147768-80147790 GTCTTGAAGAGGCTTGATTAGGG - Intronic
1043503674 8:80881570-80881592 GAGGTGAACAGGCTTCAGGGAGG + Intergenic
1043543399 8:81288477-81288499 ATGGTGAACAAGATAGAGTAGGG + Intergenic
1045540583 8:103080656-103080678 GTGGTAAACAGGCATCAGAATGG - Intergenic
1047768315 8:128008495-128008517 GTAGGGAACAGGCATGAGAAGGG - Intergenic
1048084181 8:131159446-131159468 CTGGAGAACAGGCATGAGAAAGG - Intergenic
1048804606 8:138228432-138228454 GTGGTAAACAACCTTGAATATGG - Intronic
1050081671 9:1922000-1922022 GTGGTGGACAAGTTTGAGTAAGG + Intergenic
1050087308 9:1979365-1979387 TTGGTGAACAGTCTTCAGTGTGG + Intergenic
1050321551 9:4457987-4458009 GTGTTGAACAGCTTTGAGTGGGG - Intergenic
1051245464 9:15106316-15106338 TTGTTGACCAGGCTGGAGTACGG - Intergenic
1058177124 9:101748818-101748840 GTGGTGAATAGACTTCAGGATGG - Intergenic
1058906509 9:109486484-109486506 GTGGTGGACAGGCTTGTCCAGGG + Intronic
1059740850 9:117148061-117148083 ATGGTGGACAGTCTTGAGCAAGG - Intronic
1060984894 9:127814236-127814258 ATGGTGAACAGGCTTCAGTCTGG - Intronic
1061272132 9:129549747-129549769 CTGGTTTACAGCCTTGAGTAGGG - Intergenic
1188322725 X:28759770-28759792 TTGGTGGAGATGCTTGAGTATGG + Intronic
1190154090 X:47973655-47973677 GTGGTGAACAGGGAAGAGTAGGG - Intronic
1191047215 X:56151434-56151456 GAAGTGAACAGACTTGAGAAAGG + Intergenic
1192916390 X:75655853-75655875 GTGGTGAGCAGACCTGTGTAGGG - Intergenic
1194032294 X:88832157-88832179 CTGGAGAACAGGCATGAGAATGG - Intergenic
1195587794 X:106585746-106585768 GTGGTGTACACCTTTGAGTATGG - Intergenic
1195782672 X:108482171-108482193 CTGGAGAACAGGCATGAGAATGG - Intronic
1198272168 X:135065266-135065288 GTGTTGTACAGGTTTGAGTAGGG - Intergenic
1199627374 X:149752896-149752918 CTGGAGAACAGGCATGAGAATGG - Intergenic
1199995397 X:153021598-153021620 GTGGTGAACAGGAGGGAGGAGGG - Intergenic
1200958350 Y:8973025-8973047 GTGCTGGACAGGCTATAGTAAGG + Intergenic
1201463912 Y:14258888-14258910 GTGTTGCCCAGGCTGGAGTATGG + Intergenic
1201677797 Y:16606738-16606760 GTGGTGAACAGACTCCAGTGTGG - Intergenic