ID: 961002259

View in Genome Browser
Species Human (GRCh38)
Location 3:123381965-123381987
Sequence GGGCCTTGCCCACCACCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 248}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961002259_961002271 25 Left 961002259 3:123381965-123381987 CCAGCTGGTGGTGGGCAAGGCCC 0: 1
1: 0
2: 1
3: 27
4: 248
Right 961002271 3:123382013-123382035 CTCGCTGACCTCATCTCCTGGGG 0: 1
1: 0
2: 3
3: 17
4: 161
961002259_961002270 24 Left 961002259 3:123381965-123381987 CCAGCTGGTGGTGGGCAAGGCCC 0: 1
1: 0
2: 1
3: 27
4: 248
Right 961002270 3:123382012-123382034 CCTCGCTGACCTCATCTCCTGGG 0: 1
1: 0
2: 4
3: 15
4: 228
961002259_961002268 23 Left 961002259 3:123381965-123381987 CCAGCTGGTGGTGGGCAAGGCCC 0: 1
1: 0
2: 1
3: 27
4: 248
Right 961002268 3:123382011-123382033 ACCTCGCTGACCTCATCTCCTGG 0: 1
1: 0
2: 1
3: 15
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961002259 Original CRISPR GGGCCTTGCCCACCACCAGC TGG (reversed) Intronic
900165844 1:1244025-1244047 AGGCCTCGCCCACCAGCCGCAGG + Exonic
900624633 1:3602625-3602647 GCGCCTCGGCCACCCCCAGCCGG + Intronic
900935996 1:5766605-5766627 GGGCCTGGCCCACCTTGAGCAGG + Intergenic
901023055 1:6264770-6264792 GGGCCCTGCCCCCCACCCGTGGG + Intronic
901411155 1:9085016-9085038 CGGCCTTGCACAGCACCCGCAGG + Intronic
901679989 1:10907410-10907432 GAGCCTGGCCCTCCAGCAGCAGG + Intergenic
902683956 1:18063660-18063682 AGGCCTGGCCCAGCAGCAGCTGG + Intergenic
903810561 1:26032843-26032865 GGGACTTGCCCACAACCATGCGG - Intronic
903993790 1:27292281-27292303 GGCACTTGGCCTCCACCAGCTGG - Exonic
904003893 1:27353439-27353461 GGCCCTGGCCAACCGCCAGCTGG + Exonic
904594584 1:31635368-31635390 GGGCCTTATGGACCACCAGCTGG - Exonic
904789248 1:33006262-33006284 AGGCCATGACTACCACCAGCAGG - Intergenic
904962781 1:34347832-34347854 TGGCCTTGCCCACCATGGGCAGG - Intergenic
905372041 1:37487538-37487560 GGGCCGTGCCTGCCACCTGCCGG + Intergenic
905824448 1:41017961-41017983 GGTCCTTGCCCACGATCTGCTGG + Exonic
906493808 1:46288782-46288804 AGGCCTTGCTCATCAGCAGCAGG + Intronic
906603438 1:47148632-47148654 GGGCCCTGGCCACCTTCAGCTGG - Exonic
907409547 1:54274660-54274682 GGGCCATGGCCACCTCCAGAGGG + Intronic
907554054 1:55329265-55329287 GGTCCTGGCCCTCCCCCAGCTGG - Intergenic
910868119 1:91806326-91806348 GGAGCTGGCCCACCGCCAGCAGG - Intronic
913192670 1:116426600-116426622 TGGCCCTACCCAGCACCAGCTGG - Intergenic
917135111 1:171781885-171781907 GGAGCTTGCCCACCACACGCAGG - Exonic
918463102 1:184795812-184795834 GGGCCAAGCCCACCCCCAGATGG - Exonic
918524452 1:185450586-185450608 AGGCCATGCCCATCACCAGTGGG - Intergenic
919733878 1:200932327-200932349 AGGCCATGACCAACACCAGCAGG + Intergenic
919756078 1:201066906-201066928 GGGACACGGCCACCACCAGCAGG + Exonic
920074402 1:203325975-203325997 TAGCCTTTCCCAACACCAGCTGG + Intergenic
920238934 1:204529515-204529537 GGGCCTTATGGACCACCAGCTGG - Intronic
922507055 1:226132751-226132773 GGGCCATGCCCTTCCCCAGCTGG - Intergenic
922565220 1:226597164-226597186 AGGCCTGGCCCAACACCTGCAGG + Intronic
922603007 1:226870976-226870998 GCGCCGCGCCCACCCCCAGCCGG - Intronic
1063362639 10:5470253-5470275 GGGCCTTGCAGATCAGCAGCGGG - Intergenic
1066476207 10:35749617-35749639 GGGCCTTGCCCAGCAGCTGAGGG - Intergenic
1068937145 10:62647166-62647188 CTGCCTTGCCCACCCCCATCAGG - Intronic
1072549037 10:96463368-96463390 GGTCCTGGCCCATCAGCAGCAGG + Intronic
1074058623 10:109944271-109944293 GGGGCTTGCCCTGCACCTGCTGG + Intronic
1075065813 10:119288206-119288228 CGGCCTTCCCCACCTCCATCAGG - Intronic
1076245053 10:128940504-128940526 GGGCCTTGCTTACAACAAGCAGG - Intergenic
1076424030 10:130354761-130354783 GTGCCTTCACCAGCACCAGCTGG + Intergenic
1076655321 10:132019776-132019798 GAGCCCTGCCCACCCCCATCAGG - Intergenic
1076732962 10:132447368-132447390 GGGCCTCTCCCTCCAGCAGCAGG + Intronic
1076782112 10:132730192-132730214 GGGCCCTCCCCACCACCTCCTGG + Intronic
1076871622 10:133197585-133197607 GGGCGTCCCCCACCACCCGCCGG - Intronic
1076875063 10:133211717-133211739 GGTCCATGCCCACCTCCAGGAGG - Exonic
1077197746 11:1289713-1289735 GGGTCTTGCCGCACACCAGCAGG - Intronic
1077246959 11:1544366-1544388 GGGCCATCCCCAGCACCAGAAGG + Intergenic
1077402071 11:2363896-2363918 GGGCCTTGCCCCACCCCACCAGG - Intergenic
1083796570 11:65020283-65020305 GGGCCTCTCCCACCACCACGGGG + Intronic
1083811386 11:65108686-65108708 GCGCCTGGGCCACCACCTGCAGG + Exonic
1083853086 11:65379090-65379112 GGGGCTTGCCCCCCTCCAGAGGG - Intronic
1083960399 11:66012062-66012084 GGGCCAGGCCCAGCGCCAGCGGG - Exonic
1084895339 11:72263219-72263241 GGGCCATGCTCACCATCAGTGGG - Intergenic
1085448053 11:76614551-76614573 GGCCCTTGCCCACCCCAAGCTGG - Intergenic
1088287841 11:108206367-108206389 ATGCCTGGCTCACCACCAGCAGG - Intronic
1089563830 11:119360002-119360024 GTGCTTTACCCACCCCCAGCAGG - Intronic
1092861731 12:12724845-12724867 GCCCCTTCCCCACCCCCAGCTGG - Intergenic
1095791789 12:46175596-46175618 GGCCCCTGACCACCACCAGTTGG - Intergenic
1096198242 12:49662983-49663005 GGGCCTTTCTCCCCAACAGCTGG + Intronic
1097226435 12:57479209-57479231 GCGTCTTGCCAACCACCAGTCGG + Exonic
1097226479 12:57479377-57479399 GGAACTTGGCCACCACCGGCTGG + Exonic
1097896105 12:64825616-64825638 GGGCCTTGCCTAGCACGACCAGG - Intronic
1098658106 12:73058354-73058376 GGGCCCTCTCCACCAACAGCTGG - Intergenic
1098868067 12:75784701-75784723 GCTCCCTGCCCACCACTAGCTGG - Intergenic
1102647988 12:114415989-114416011 GGGCCTTCCCCAGTACCAGAAGG + Intergenic
1102826708 12:115952978-115953000 GGGCCCTGCCCCCCACCAACTGG + Intergenic
1104362929 12:128151049-128151071 GGGACTTACCTTCCACCAGCTGG + Intergenic
1105422639 13:20266532-20266554 GGGTCTCATCCACCACCAGCAGG + Intergenic
1105605261 13:21921374-21921396 GGACCTTACCCCCCACCATCAGG - Intergenic
1105893478 13:24698866-24698888 GGGCCCTGCCCATCACCTGGTGG + Intronic
1106418408 13:29565483-29565505 GGGCCTAGACCATCAACAGCAGG - Intronic
1113557857 13:111253010-111253032 GGGCCAGGCCCAGCAGCAGCTGG + Intronic
1113849259 13:113408820-113408842 GGGCAGTGCCCACCAGGAGCAGG + Intergenic
1115514178 14:34168561-34168583 GGGCCCTGCCCACGAGGAGCTGG - Intronic
1118762357 14:68888318-68888340 TTGCCTTGCCAGCCACCAGCAGG - Intronic
1119213698 14:72851876-72851898 TGGCCAGGCCCGCCACCAGCTGG + Intronic
1119473659 14:74914359-74914381 GGCCCTTGCCCAGGACCAGGTGG - Intronic
1121457645 14:94048849-94048871 GGGCTTGGCCCACATCCAGCAGG - Exonic
1122104461 14:99441682-99441704 GGGCCCTGATCACCACCAGAGGG + Intronic
1122634388 14:103123344-103123366 GGGCCTTGGCCTCCGCCCGCGGG + Intergenic
1122778670 14:104134495-104134517 GGCTCTTGACCAGCACCAGCAGG + Intergenic
1124003203 15:25776730-25776752 GGGCCATGCCCACCGCCTTCCGG + Intronic
1124385594 15:29206005-29206027 GACCCTCTCCCACCACCAGCAGG - Intronic
1125513573 15:40305841-40305863 GGGCCTTGAGCAGGACCAGCAGG + Intronic
1129257545 15:74342631-74342653 GGGCATTGTCCTCCATCAGCAGG + Intronic
1129905517 15:79184563-79184585 GGCCCTTTCTCACCACCAGGTGG - Intergenic
1130645709 15:85724867-85724889 TCTCCTTTCCCACCACCAGCTGG + Intronic
1132602886 16:781784-781806 GGGCCCTGCCCAGCAGCAGCAGG - Intronic
1133127829 16:3657653-3657675 GGGCCTGGCTCAGCACCCGCAGG - Intronic
1133237027 16:4392218-4392240 GGGCCTCACCCAGCCCCAGCTGG + Intronic
1134634255 16:15780033-15780055 GGGCCTTGCCTGTGACCAGCCGG - Intronic
1136573556 16:31110351-31110373 GTGCCCTTCCCACCCCCAGCAGG - Intronic
1137249874 16:46733574-46733596 GGGCCTTTCCCACCTCCATCTGG - Intronic
1137712245 16:50574501-50574523 GGGCCTCGGCCACCAGCAGCAGG - Intronic
1137866911 16:51907146-51907168 GGGTTTTGCCCTCCACCATCAGG - Intergenic
1138416548 16:56874883-56874905 AGGCCCTGCCCAACACCACCTGG - Intronic
1139481252 16:67231946-67231968 AGCCCATGCCCACCACCAGAGGG + Intronic
1139718423 16:68832984-68833006 GGGGCTGCCACACCACCAGCTGG - Intronic
1141253999 16:82384000-82384022 GGGCCTTGGCCACAATCTGCAGG + Intergenic
1141666282 16:85467112-85467134 GGGCCCTGGCCTCCAGCAGCTGG + Intergenic
1141828332 16:86496152-86496174 GGGCCCTGCCTTCCACCTGCAGG + Intergenic
1141948354 16:87325090-87325112 TGGCCATGCCCAACACCAGCAGG - Intronic
1142154453 16:88526828-88526850 AGGCCTCGTCCACCAGCAGCAGG - Exonic
1142849010 17:2695385-2695407 GAGCCCGGCCCGCCACCAGCTGG - Exonic
1142878745 17:2868260-2868282 GGGCCTGGCCCTCCACCAGGGGG - Intronic
1143027680 17:3950803-3950825 TGGCTTTGGGCACCACCAGCTGG + Intronic
1143164762 17:4892319-4892341 GGGGCTTTCCCACCCCCAGGCGG - Intronic
1144702106 17:17346805-17346827 GGGCCGAGCCAACCCCCAGCTGG + Exonic
1144780681 17:17807015-17807037 GAGTCTCGCCCACCATCAGCAGG + Intronic
1146467253 17:33095942-33095964 GGGCTTGGCCCATCAGCAGCTGG + Intronic
1148344765 17:46895817-46895839 GGGGCTTGCCCAGCAGCAGATGG - Intergenic
1148865430 17:50625918-50625940 GCCCCCTGCCCACCACCACCAGG - Intronic
1150069625 17:62139924-62139946 GCCCCTCGCCCACCACCTGCTGG - Intergenic
1151215766 17:72575434-72575456 GGCCCTTGCCTTCCAGCAGCTGG - Intergenic
1151229948 17:72677327-72677349 AGGCCATGGCCAACACCAGCTGG + Intronic
1151328889 17:73395164-73395186 GGGTCCTGCCCACCACCGTCTGG + Exonic
1151700187 17:75738652-75738674 GGGCCCTGCCCGCCCGCAGCTGG + Intronic
1152236901 17:79143561-79143583 GGGCCTTGGCCACCAGAATCGGG + Intronic
1152701124 17:81820154-81820176 GGGCCTTGCCTACCTACAGCCGG - Intergenic
1154308204 18:13245753-13245775 GGGCCCTGCCCCTCACCTGCAGG - Intronic
1160728493 19:629623-629645 GCCCCTCGCCCACCACCTGCTGG - Exonic
1160805914 19:992100-992122 GCGCCTGGGCCTCCACCAGCAGG + Exonic
1161141464 19:2650706-2650728 GGGCCTTGAGCCGCACCAGCTGG + Intronic
1162087417 19:8257068-8257090 GGGTCGGGCCCACCTCCAGCAGG - Exonic
1162330785 19:10027919-10027941 TGGACTTGCGCACCAGCAGCCGG + Intergenic
1162377992 19:10316344-10316366 GGGCCTTGCCCCCAGCCAACTGG - Exonic
1162397193 19:10424095-10424117 GGGCACTGCCCACCCCCAACCGG + Intronic
1163110929 19:15160773-15160795 GGGCCATGGCCACCACCACTGGG - Exonic
1163148899 19:15399764-15399786 TGGCCCTGCCCACCCCCAACCGG + Intronic
1163266876 19:16227118-16227140 GGGCCCTGCCCAGCCCCAGGCGG - Intronic
1163826007 19:19525428-19525450 TGGCCTTGCCTTCCACCTGCTGG + Intronic
1164649667 19:29882759-29882781 GGCCCTTTCTCCCCACCAGCGGG - Intergenic
1165460239 19:35939980-35940002 GGGCCTCGACCACAACCTGCTGG + Exonic
1165994839 19:39836733-39836755 GGCCTATGCCCATCACCAGCAGG + Intronic
1166846850 19:45733707-45733729 GGGCCTCCCCCAGCACTAGCTGG + Intronic
1167043974 19:47039385-47039407 CAACCATGCCCACCACCAGCAGG + Exonic
1167485736 19:49761977-49761999 GGGCCCTCCACACCACCCGCTGG - Intronic
1168685552 19:58347279-58347301 GGGCTGTGCCCACCTCCAGGAGG - Intronic
926107826 2:10163370-10163392 GGGCCAAGCCCACCACCTGCAGG + Intronic
926302073 2:11611710-11611732 GGCCATTGCCCCCCACCATCTGG - Intronic
927155656 2:20219819-20219841 GGGCTGTCCCCACCCCCAGCAGG + Intronic
928217383 2:29373055-29373077 GCCCCTTCCCCATCACCAGCTGG + Intronic
928245765 2:29625771-29625793 GAGCCTGGCCCTCCAGCAGCAGG - Intronic
932304272 2:70690863-70690885 AGGCCATGTCCCCCACCAGCAGG + Exonic
934735589 2:96688333-96688355 GGGCCTCACCCATCACCAACAGG + Intergenic
935274405 2:101463667-101463689 GGGCCCTGAACACCACCACCGGG + Intronic
936080338 2:109428640-109428662 GAGCCTTCCTCACCACCACCTGG - Intronic
936964876 2:118117773-118117795 AGGCCTTGGCCTCCTCCAGCTGG - Intergenic
937905521 2:127051057-127051079 AGGCCTGGACCAGCACCAGCAGG + Intronic
938291620 2:130153667-130153689 GGGCCTGCCCCACCGCCATCAGG - Intronic
938464931 2:131519296-131519318 GGGCCTGCCCCACCGCCATCAGG + Intergenic
938500929 2:131831079-131831101 CCGCCTTGCCCACCCCCAGTGGG - Intergenic
946875912 2:224129776-224129798 GGTCCTTTCTCACCACCACCTGG + Intergenic
947967058 2:234290515-234290537 GGGCTATGCCCACCTCCAGGAGG - Intergenic
948047020 2:234952398-234952420 GGTCCCTGCCCACCAGCACCAGG - Intronic
948383318 2:237566603-237566625 GGGCCAGGCCCAGCATCAGCAGG - Exonic
948770075 2:240247317-240247339 GGGCTTTGTCCACCTCCAGCAGG - Intergenic
948895539 2:240925282-240925304 GGGACTTCCCCACCACAAGTAGG - Intronic
1168806934 20:676944-676966 GGGCTTTGCCCAGCACCCTCTGG - Intergenic
1168836279 20:879848-879870 GTGCCTTGCCCACCCCCTCCAGG - Exonic
1170570056 20:17627524-17627546 GCGCCTGGCCCGCCTCCAGCAGG + Exonic
1171469199 20:25356487-25356509 GGGCCTTGCTGAACAGCAGCTGG + Intronic
1172354818 20:34272336-34272358 GGGGATTTCCCCCCACCAGCAGG + Intergenic
1172578906 20:36031272-36031294 GGACCCAGCCCACCACCTGCAGG - Intergenic
1173226179 20:41163598-41163620 GCACCTTGCCCACCCCCAGTTGG + Intronic
1174138893 20:48399036-48399058 GGGCCTTTCCCACCTCCACGTGG + Intergenic
1175769068 20:61611494-61611516 GAGCCTTGCCCACATCCCGCAGG - Intronic
1175893290 20:62324722-62324744 GGTGCTGGCCCACCTCCAGCCGG - Intronic
1175954786 20:62603732-62603754 GTGCCTTGCCCAGCTCCAGAGGG + Intergenic
1175965253 20:62657117-62657139 GGGCCTGTCCCGCTACCAGCTGG + Exonic
1176156330 20:63623297-63623319 GGAAATTGCCCACCAGCAGCTGG - Intronic
1178680401 21:34669215-34669237 GGGCCTTGCGCAGGACCCGCAGG - Intergenic
1179937109 21:44612903-44612925 GGGACGTGCCCATCAGCAGCTGG - Exonic
1180825287 22:18857118-18857140 AGGCCTTGCCCATCCCCAGAGGG - Intronic
1181187443 22:21117429-21117451 AGGCCTTGCCCATCCCCAGAGGG + Intergenic
1181211755 22:21293064-21293086 AGGCCTTGCCCATCCCCAGAGGG - Intergenic
1181397751 22:22633822-22633844 AGGCCTTGCCCATCCCCAGAGGG + Intergenic
1181473793 22:23156500-23156522 GAGCCCTGCCCAGCACCACCTGG - Intronic
1181688099 22:24543097-24543119 CTGCCTTCCCCACCCCCAGCAGG - Exonic
1181705719 22:24648503-24648525 AGGCCTTGCCCATCCCCAGAGGG + Intergenic
1183231856 22:36587415-36587437 GGGCAGGGCCCACCACCAGGAGG + Intronic
1183327500 22:37202408-37202430 TGGCCTTGCACACCTCCAGGGGG + Intergenic
1183936341 22:41264573-41264595 GGCCCTTGGCCACCACCATCTGG - Intronic
1184209756 22:43028538-43028560 AGACCCTGCCCACCACCTGCCGG - Intergenic
1184275669 22:43408364-43408386 GGGCCCTGCTCACCTCCAGCAGG - Intergenic
1184417420 22:44360434-44360456 GGGCCTTGCCCTGCCCCACCCGG + Intergenic
1184778191 22:46633622-46633644 TGGCCTTGGCCTCCTCCAGCTGG - Intronic
1184903193 22:47460401-47460423 GGGCATTGCCATACACCAGCCGG - Intergenic
1184976960 22:48069164-48069186 GGACGTTGGCCACCACCACCCGG + Intergenic
1203215197 22_KI270731v1_random:2368-2390 AGGCCTTGCCCATCCCCAGAGGG + Intergenic
1203275436 22_KI270734v1_random:83021-83043 AGGCCTTGCCCATCCCCAGAGGG - Intergenic
949544136 3:5057960-5057982 GGGGCATGCACACCACCTGCTGG + Intergenic
949875730 3:8624976-8624998 GAGGCTTTCCCACCTCCAGCTGG + Intronic
950140394 3:10611250-10611272 GGGCCTTGCCCACCCCTGCCAGG - Intronic
950148050 3:10665778-10665800 GAGTCTTGCCCGCCTCCAGCAGG + Intronic
950444030 3:13025836-13025858 GGGCCTTGCCCACCCCACCCTGG - Intronic
950639945 3:14342375-14342397 GTGCCTTGCCCCCCGCCATCTGG + Intergenic
950865979 3:16189342-16189364 GTGCATTGCCCAACACCAGTGGG - Intronic
951340900 3:21485417-21485439 GGGCATTTGCCACCACCAGCTGG - Intronic
951930251 3:27957781-27957803 TGCTCTTCCCCACCACCAGCAGG + Intergenic
952865835 3:37854615-37854637 GGGCCATGCCCTCCCCCAGCCGG + Intergenic
955383499 3:58460301-58460323 GTGCCTTCTCCACCACCAGACGG - Intergenic
961002259 3:123381965-123381987 GGGCCTTGCCCACCACCAGCTGG - Intronic
961519016 3:127456220-127456242 GGGTTTGGCCCACCAGCAGCCGG + Intergenic
966849735 3:184156808-184156830 GGGCCTTCCCCACCGCCTCCAGG - Intronic
967048540 3:185760567-185760589 GGCCCCTGGCAACCACCAGCTGG + Intronic
967102028 3:186223417-186223439 GTGCCTTCCCCACCATCGGCTGG + Intronic
968288708 3:197522912-197522934 GGGCCTGGCCCACCAGCATGCGG + Intronic
969242476 4:5909258-5909280 TGGCCTTGACCACCAAAAGCAGG + Intronic
969493974 4:7515383-7515405 GTGCCCTGCCCAGCCCCAGCAGG - Intronic
979929816 4:126616962-126616984 GGGCCCTGCCCTCTCCCAGCTGG - Intergenic
980981300 4:139656704-139656726 GGGATTTCCCCACCACCAGGTGG + Intergenic
982450320 4:155544723-155544745 AGGCCATCCCCACCCCCAGCTGG - Intergenic
982724926 4:158896262-158896284 GGGCCTTTCCTGCCACCAGGTGG - Intronic
985361465 4:189179833-189179855 GGGCCCTGCCCCACACCAGAGGG - Intergenic
989433712 5:41385816-41385838 GGCCCTTGACCAAAACCAGCTGG + Intronic
990043358 5:51398896-51398918 GTGCGTTGCCCACGTCCAGCGGG + Intergenic
994212469 5:97102046-97102068 GAACCTTCCCCACCAACAGCAGG + Exonic
994865489 5:105263763-105263785 TGGCATTGCCCACCAACTGCTGG + Intergenic
998286195 5:140863130-140863152 GGTCCTTCACCAGCACCAGCAGG - Intronic
998287525 5:140877410-140877432 GGTCCTTCACCAGCACCAGCAGG - Exonic
1006435639 6:34024757-34024779 GAAACTTGCCCACCACCATCCGG - Intronic
1007752036 6:44076654-44076676 CGACCTGGCCCACCGCCAGCGGG - Intergenic
1011623927 6:89268378-89268400 GGGCTTTGCCCTCAGCCAGCAGG + Intronic
1011891991 6:92175192-92175214 GGGCCCCCCCCACCACCACCAGG - Intergenic
1014109254 6:117602254-117602276 GGTCCATGCCCAGCAGCAGCCGG - Exonic
1017250861 6:152278193-152278215 GAGCTTTGCCCTCCAGCAGCAGG + Exonic
1018864618 6:167737102-167737124 GGGCCTTGCCCTCTGCCTGCTGG + Intergenic
1019176054 6:170160087-170160109 GGGCCTCGGGCAGCACCAGCAGG + Intergenic
1019198737 6:170296944-170296966 GGGCCGTGCCCACCACAGGGAGG + Intronic
1019219895 6:170464860-170464882 GGGCCCCCTCCACCACCAGCAGG - Intergenic
1019729227 7:2621300-2621322 GGCCCTCCCCCACCTCCAGCTGG + Intergenic
1023888620 7:44377385-44377407 GGGCCTAGCTGACCCCCAGCTGG + Intergenic
1024988050 7:55212995-55213017 GCGCCTTTCCCTCCACCAGCCGG + Intronic
1027269491 7:76512053-76512075 GGGCCTTGCCCGGCCCCAGCGGG - Intronic
1027320201 7:77005947-77005969 GGGCCTTGCCCGGCCCCAGCGGG - Intergenic
1029593947 7:101526724-101526746 GGGCTCTGCCCACCCACAGCAGG - Intronic
1029709722 7:102293018-102293040 GAGCCCCGCCCACCTCCAGCTGG - Intronic
1029747680 7:102525522-102525544 GCGCCATGGCCACCCCCAGCCGG + Intergenic
1029765631 7:102624612-102624634 GCGCCATGGCCACCCCCAGCCGG + Intronic
1032441216 7:131944542-131944564 GGTCCTTGGACAGCACCAGCCGG - Intergenic
1034193712 7:149229945-149229967 GGGCCCAGACCACCAGCAGCTGG - Intergenic
1036412703 8:8517425-8517447 GGGCTTGGCCCGCCACCAGGTGG + Intergenic
1036808825 8:11853403-11853425 GGGCATTGGCCAACACCAGCAGG + Exonic
1037246000 8:16835640-16835662 GGGCCTTGCACATCTCCAGTAGG + Intergenic
1039435523 8:37556885-37556907 GGCCCTTCACCAGCACCAGCTGG - Intergenic
1040567725 8:48582343-48582365 CTGCCTTAGCCACCACCAGCGGG - Intergenic
1042194346 8:66219810-66219832 GGCCCTCTCCCAGCACCAGCTGG - Intergenic
1045528086 8:102958617-102958639 GACCCCTGCCCACCACCACCAGG + Intronic
1048223427 8:132563966-132563988 TTGCCTTCCCCTCCACCAGCAGG + Intergenic
1048963445 8:139598257-139598279 GGCTCTTGCCCATCAGCAGCTGG + Intergenic
1048992397 8:139768408-139768430 GGGCCTGGCCCACCACTGGTGGG - Intronic
1048992576 8:139770010-139770032 GGGCCTGGCCCACCACTGGCGGG - Intronic
1049279916 8:141738958-141738980 CTGCCGTGCCCACCAACAGCAGG - Intergenic
1049575867 8:143389328-143389350 AGGCCTTGCCCACAACCTGGTGG + Intergenic
1049700166 8:144007277-144007299 GGGCCCTGCCAACCAGGAGCTGG - Intronic
1049767424 8:144361380-144361402 GGTCCTTACCCACCACAGGCTGG + Intergenic
1051376771 9:16410143-16410165 AGGCCTAGTCCATCACCAGCAGG + Exonic
1053286913 9:36855641-36855663 GGGCCTTGACCGCCACCAGGCGG - Intronic
1053297295 9:36924010-36924032 GGGCTTTACCCACCACCAACAGG + Intronic
1056329713 9:85511319-85511341 GGCCCTGGCCCAGCCCCAGCTGG + Intergenic
1056504766 9:87247701-87247723 GGGCCTTCCCCACCTCCTGCAGG - Intergenic
1057047934 9:91900211-91900233 GGGCCCTGCCCCCCACCCCCTGG - Intronic
1057091597 9:92263024-92263046 GGGCCGTGGCCAGCACCAGCAGG + Exonic
1060231240 9:121827028-121827050 GGGCCTTGCCCAGCACCTGCAGG - Intronic
1060417279 9:123440407-123440429 GGTCCTTGGCCTCCACCAGTGGG + Exonic
1060530569 9:124345068-124345090 GGGCCCTGGCCCCCACCAGGAGG - Intronic
1060585463 9:124782730-124782752 GGGCCTTGGCCGCCCCCATCAGG + Intronic
1061539163 9:131268340-131268362 GGGCTGTCCCCACCACCACCGGG + Intronic
1061774005 9:132948619-132948641 GGGGGTTGCCCACCAACGGCAGG - Intronic
1061919360 9:133774282-133774304 GGGCCTTGCCGACCAGGAGCTGG - Intronic
1062498740 9:136843436-136843458 CCGCCCTGCCCACCCCCAGCGGG + Intronic
1062590485 9:137272423-137272445 GGGCCTTGGCCACCTGCATCTGG + Intronic
1185557327 X:1031725-1031747 GGGCCTGGTCCACCAGCAGCAGG + Intergenic
1187404576 X:18991701-18991723 GGGCCTTCCCCACCCCAAGCAGG + Intronic
1187454729 X:19431143-19431165 GAGCCTTGTCCACCACCACCAGG - Intronic
1189152036 X:38719161-38719183 GGGAGTGGCCCACCACCATCTGG - Intergenic
1197168121 X:123401668-123401690 GGGGCTTGTTCACCACCAGTAGG - Intronic