ID: 961003265

View in Genome Browser
Species Human (GRCh38)
Location 3:123388306-123388328
Sequence CTGTATGACCAACTGAAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 123}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961003261_961003265 -8 Left 961003261 3:123388291-123388313 CCAAACCCATCAGCACTGTATGA 0: 1
1: 0
2: 0
3: 12
4: 253
Right 961003265 3:123388306-123388328 CTGTATGACCAACTGAAAGTGGG 0: 1
1: 0
2: 0
3: 11
4: 123
961003257_961003265 29 Left 961003257 3:123388254-123388276 CCGCGGAGGTTGGAGGAATGGAG 0: 1
1: 0
2: 0
3: 12
4: 183
Right 961003265 3:123388306-123388328 CTGTATGACCAACTGAAAGTGGG 0: 1
1: 0
2: 0
3: 11
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961003265 Original CRISPR CTGTATGACCAACTGAAAGT GGG Intronic
902433864 1:16384491-16384513 CTGTATTCCCAAGTGAAATTGGG + Intronic
905450301 1:38051799-38051821 CTGTATCCTCATCTGAAAGTTGG + Intergenic
908263112 1:62353924-62353946 CTGTATTTCCAGCTGAAACTGGG - Intergenic
910163071 1:84294549-84294571 GTGAATGACCAAGTGGAAGTTGG - Intergenic
912478909 1:109962612-109962634 ATGAATGACCAACAGAAAGGTGG + Intergenic
913439764 1:118885095-118885117 CTGCATGACATACTGAAACTGGG + Exonic
918024963 1:180734318-180734340 CTCTCTGACCAACTAAAATTAGG + Intronic
918623784 1:186635123-186635145 CTTTGTGACCAATAGAAAGTAGG + Intergenic
918652450 1:186982597-186982619 CTGAATGAACAAATGAAGGTAGG + Intronic
918898179 1:190375691-190375713 GTGTATGAACAACTGTAATTAGG - Intronic
923728751 1:236530568-236530590 CTGGCTGAGCAACTGAGAGTTGG - Intronic
923921750 1:238573816-238573838 CTCCATGACCAACTAAAACTAGG + Intergenic
924320487 1:242843714-242843736 CTCCCTGACCAACTAAAAGTAGG + Intergenic
924439228 1:244072755-244072777 CTGTATTTCCAGCTGAAAATGGG + Intergenic
924657945 1:245990438-245990460 CTGTGTGACCAAAAGGAAGTAGG - Intronic
1063496243 10:6511599-6511621 CTCCATGACCAACTAAAACTAGG + Intronic
1067755314 10:49000508-49000530 ATGAATGACAAACTGAAAGGAGG + Intergenic
1068309414 10:55259015-55259037 CTGCCTGACCAATTGAAATTGGG - Intronic
1070093262 10:73310576-73310598 CTGCAGGACCACCTGAAAGAAGG - Intronic
1071446173 10:85749702-85749724 CTGTCTGAGGAACAGAAAGTGGG - Intronic
1073885238 10:108031677-108031699 CTTGATGACAAACTGAGAGTTGG - Intergenic
1077761658 11:5106676-5106698 CTGTCTGACCAACTGTAAATAGG - Intergenic
1085303558 11:75472721-75472743 CTGAATGAACAACTGGAAGGAGG - Intronic
1086395583 11:86412031-86412053 CTCCTTGACCAACTAAAAGTAGG - Intronic
1089935870 11:122363460-122363482 CTGTAAGACCAAATGGAAGGAGG - Intergenic
1090223540 11:125053296-125053318 CTGTATGACACACAGGAAGTGGG + Intergenic
1099563135 12:84204561-84204583 CTGTATGAAAAACTGACATTAGG - Intergenic
1102789441 12:115632340-115632362 CTGTTTGAACAACTGCAACTAGG - Intergenic
1111197077 13:84888869-84888891 CTCCCTGACCAACTAAAAGTAGG + Intergenic
1113596837 13:111539650-111539672 CAGTCTGACCAACTGAAAGAAGG - Intergenic
1114389679 14:22293662-22293684 CTGTATAATCTACTGAAATTAGG + Intergenic
1115876649 14:37868992-37869014 TCGTATGGCCAATTGAAAGTTGG + Intronic
1119068549 14:71556495-71556517 CTGACTGACCAACTTTAAGTTGG + Intronic
1121038526 14:90726490-90726512 CTGACTTACCAGCTGAAAGTGGG - Intronic
1122346450 14:101064005-101064027 CTCTATGACCAAATGACATTCGG - Intergenic
1124818566 15:33020127-33020149 CTGACTGACCAACTTCAAGTAGG - Intronic
1128652201 15:69425557-69425579 CTGTATGACAAGATGAAGGTTGG - Intronic
1130536126 15:84786249-84786271 GTATATGGCCAACTGAGAGTGGG + Intronic
1133643679 16:7742902-7742924 CTCTACCACCAACTGAAAGCTGG - Intergenic
1138457424 16:57129378-57129400 CTGTGTGACCAAGTGAGTGTGGG + Intronic
1139000663 16:62506290-62506312 CTGACTGACCAACTTCAAGTTGG - Intergenic
1144608513 17:16688880-16688902 CTCTCTGACCAACTAAAATTAGG - Intergenic
1144815640 17:18032558-18032580 CTGAATGACCCACTGACACTTGG + Intronic
1145128284 17:20319802-20319824 CTCTCTGACCAACTAAAATTAGG - Intergenic
1145196323 17:20897406-20897428 CTCTCTGACCAACTAAAATTAGG + Intergenic
1152284448 17:79404148-79404170 CTGTGTGTTCAACTGAGAGTGGG - Intronic
1152473068 17:80500905-80500927 CTGTATTCTCAACTGTAAGTGGG - Intergenic
1156925310 18:42570480-42570502 CTGCATGACCAACTTCAAATAGG - Intergenic
1156972998 18:43180358-43180380 CTCTATAACCACCTGGAAGTTGG - Intergenic
1157140189 18:45098043-45098065 CTGCAAAATCAACTGAAAGTGGG - Intergenic
1160891500 19:1381005-1381027 CTGTGTGACCAACAGAATGGCGG - Intergenic
1164230775 19:23286025-23286047 CTGTGGAACAAACTGAAAGTGGG + Intergenic
1164230866 19:23287071-23287093 CTGTGGGACAAACTGAAAGTGGG + Intergenic
926144729 2:10389877-10389899 ATGTATGTCCAACAGAAAGAAGG - Intronic
928834776 2:35530352-35530374 CTCTCTGACCAACTAAAAGTAGG + Intergenic
928898152 2:36288486-36288508 ATGTATGTCCAAAAGAAAGTTGG + Intergenic
930449144 2:51512008-51512030 CTGGATAAGCAACTTAAAGTGGG + Intergenic
933145146 2:78842716-78842738 TTGTATGGGCAACTGAAAGAGGG + Intergenic
934132765 2:88965405-88965427 CTCTCTGACCAACTGAAATTAGG - Intergenic
934140185 2:89039366-89039388 CTCCCTGACCAACTGAAATTAGG - Intergenic
934229052 2:90161171-90161193 CTCCCTGACCAACTGAAATTAGG + Intergenic
937785154 2:125887349-125887371 CAATATGTCCACCTGAAAGTGGG - Intergenic
938715713 2:134019831-134019853 CTGCATGAAAAACTGGAAGTGGG + Intergenic
940254390 2:151713679-151713701 CACCATGACCAGCTGAAAGTGGG - Intronic
942623892 2:177878097-177878119 CTGTGTGACCAGATGAATGTAGG + Intronic
943030710 2:182682301-182682323 CTTCCTGACCAACTAAAAGTAGG + Intergenic
947478446 2:230473548-230473570 CTGGATCACCAACAGGAAGTGGG + Intronic
949305512 3:2636030-2636052 CTGTCTCACCAACTAAAATTAGG - Intronic
952647600 3:35680527-35680549 CTTTATTTCCAACTGAAAATAGG - Intronic
953375132 3:42422023-42422045 CTGAATGAACATCTGAGAGTAGG + Intergenic
954321325 3:49833864-49833886 TTGTAGGACAAACAGAAAGTGGG - Intronic
956589875 3:70903424-70903446 CTGAATATCCAAATGAAAGTAGG - Intergenic
960017532 3:112909215-112909237 CAGTATGAACCACTGGAAGTGGG - Intergenic
960141343 3:114154490-114154512 CTGTCTGACCAAATAAAAGATGG - Intronic
961003265 3:123388306-123388328 CTGTATGACCAACTGAAAGTGGG + Intronic
961380410 3:126492920-126492942 CTGTATGGCACACTGAGAGTGGG - Intronic
963519202 3:146344350-146344372 CTATATGACCAGGTGAAAATAGG - Intergenic
964758473 3:160110794-160110816 CAGTAGGAACAACTGAAACTGGG - Intergenic
966550050 3:181194817-181194839 CTGACTGACCAACTGGAAGTTGG + Intergenic
970501611 4:16682923-16682945 CTGTATGTCAAAATGAAAGTGGG - Intronic
976190337 4:82480886-82480908 CAGTGTGAGCAACTGAAAGACGG + Intergenic
976962314 4:90992960-90992982 CGGCATGAACAACTGGAAGTGGG + Intronic
979178914 4:117701032-117701054 CTTTATGACCAACTGACAAAAGG + Intergenic
979260201 4:118637428-118637450 CTGGGTGACCGACTGAGAGTGGG - Intergenic
983653571 4:170057181-170057203 CTGTTTGTCCAACTGAAAAAGGG + Intergenic
995385284 5:111581840-111581862 CTGTGTGCCCAACTAAAACTTGG + Intergenic
995911017 5:117186772-117186794 CTGTAGGACCCACAGTAAGTTGG - Intergenic
996655732 5:125933633-125933655 CTTTCTGACCAACTAAAATTAGG - Intergenic
1001061041 5:168488969-168488991 CTGTTTGGCTAACTTAAAGTAGG + Intronic
1001321081 5:170682121-170682143 CTAAAATACCAACTGAAAGTGGG + Intronic
1005529308 6:26686693-26686715 CTGAGTGACCAACTGAATGAAGG - Intergenic
1005541488 6:26814953-26814975 CTGAGTGACCAACTGAATGAAGG + Intergenic
1008178870 6:48303033-48303055 CTCTCTGACCAACTAAAATTAGG - Intergenic
1010748569 6:79592423-79592445 ATGTATTACAAAGTGAAAGTAGG + Intergenic
1011196033 6:84780230-84780252 CTGAATCACCAATTGAAAGAAGG - Intergenic
1015864575 6:137714813-137714835 CTGTAGCAACAACTTAAAGTAGG + Intergenic
1017799274 6:157877878-157877900 TTGGATAACCAACTGAATGTGGG - Intronic
1018641873 6:165911478-165911500 CTGTGTAACCAGATGAAAGTTGG - Intronic
1022270843 7:28806415-28806437 TTGTATGATTATCTGAAAGTAGG + Intronic
1022772600 7:33490587-33490609 CTCAATGAGCAACTGAAACTGGG - Intronic
1022807666 7:33838906-33838928 CTGTAGGAAAAACTGAATGTTGG + Intergenic
1023357286 7:39379886-39379908 CTGTATGACTTTCTGAAAGAGGG + Intronic
1023426064 7:40037559-40037581 CTGTGTGACCAACAGAATATTGG - Intronic
1024027566 7:45425668-45425690 CTCTATGAGCAACTGAAACTCGG - Intergenic
1028720492 7:94025347-94025369 ATGAATGAGCAAATGAAAGTGGG - Intergenic
1028728008 7:94111010-94111032 CTGTTTGACCAACAGAATATGGG + Intergenic
1030310520 7:108064345-108064367 CTCTAGGATCAACTGAGAGTGGG - Intronic
1030474383 7:110010949-110010971 CTTTTTTACCAACAGAAAGTAGG - Intergenic
1033524228 7:142194408-142194430 CTGAGTCACCAACTGAAAGCAGG - Intronic
1035932540 8:3798855-3798877 CTGTATGAACAAAGGAAAATAGG - Intronic
1036985416 8:13523333-13523355 CTTTATGAGCAACTGAAAGATGG + Intergenic
1038669083 8:29567235-29567257 CTGGATGACCCACTCACAGTAGG + Intergenic
1042656031 8:71097497-71097519 GTGTAGGACCAAATGAAATTAGG - Intergenic
1042971115 8:74409874-74409896 CTTTCTGACCAACTAAAATTTGG - Intronic
1045477259 8:102563964-102563986 CTGCAGGACCAACAGAAAGGAGG - Intergenic
1046016626 8:108613248-108613270 CAGTAGCACCAACTGAAAGTAGG - Intronic
1046964261 8:120145774-120145796 CTGTATTTCCAAATAAAAGTAGG + Intronic
1047334834 8:123925528-123925550 CTGTGTGCCCAGCTGAAAATTGG + Intronic
1047561525 8:125992069-125992091 CTGTATGAACAGCTGAATGGGGG + Intergenic
1048380747 8:133862877-133862899 CTGTATGGCTAGCTGAAGGTGGG - Intergenic
1050218040 9:3350812-3350834 GCGTATGACCAAGTGAAAGAAGG + Intronic
1051146365 9:14031866-14031888 CTTGATGATCAACTGCAAGTGGG - Intergenic
1051433750 9:17007857-17007879 CTGTATAACCAGCTGAAGGAGGG + Intergenic
1053130767 9:35614039-35614061 CTGTATGGCCAAATGGAAGAGGG + Intronic
1053873057 9:42513867-42513889 GTGAATGAACAACTGAAAGAGGG + Intergenic
1053899695 9:42782053-42782075 GTGAATGAACAACTGAAAGAGGG - Intergenic
1054261950 9:62875540-62875562 GTGAATGAACAACTGAAAGAGGG + Intergenic
1054269273 9:62952885-62952907 GTGAATGAACAACTGAAAGAGGG - Intergenic
1055367880 9:75565137-75565159 CTCTCTGACCAACTAAAATTAGG + Intergenic
1055670906 9:78605355-78605377 CTGCATGACAAACTGAAAGCTGG + Intergenic
1059643423 9:116239551-116239573 CTGTATGCCCTACTGAAATGTGG + Intronic
1194392127 X:93332030-93332052 ATGTATAACCAACTGCAAGAGGG + Intergenic
1195611416 X:106871720-106871742 CTGGCTGACCAACTTCAAGTTGG + Intronic
1199866701 X:151856992-151857014 ATTTATGACCAATTGAAATTTGG + Intergenic
1201723470 Y:17129791-17129813 CTCCCTGAACAACTGAAAGTAGG - Intergenic