ID: 961003878

View in Genome Browser
Species Human (GRCh38)
Location 3:123391662-123391684
Sequence GCAATGGGCTTAGCTTTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 115}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961003870_961003878 22 Left 961003870 3:123391617-123391639 CCACAGTACAGAAATATTACCAA 0: 1
1: 1
2: 1
3: 18
4: 210
Right 961003878 3:123391662-123391684 GCAATGGGCTTAGCTTTTCCAGG 0: 1
1: 0
2: 1
3: 8
4: 115
961003871_961003878 3 Left 961003871 3:123391636-123391658 CCAAAATATTCTCATCCTCACCC 0: 1
1: 0
2: 0
3: 42
4: 310
Right 961003878 3:123391662-123391684 GCAATGGGCTTAGCTTTTCCAGG 0: 1
1: 0
2: 1
3: 8
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961003878 Original CRISPR GCAATGGGCTTAGCTTTTCC AGG Intronic
900717197 1:4152788-4152810 GCACTGGGCTCAGGCTTTCCTGG - Intergenic
902660389 1:17896797-17896819 GAAATGGACTTAGTTTTCCCAGG + Intergenic
902697241 1:18148483-18148505 GCAAGTGACTTAGCTTCTCCGGG - Intronic
906082184 1:43099986-43100008 GCATTTGGTTTAGCTTTTGCAGG + Intergenic
906095877 1:43223555-43223577 GCTTTGAACTTAGCTTTTCCAGG - Intronic
907012480 1:50977290-50977312 GCTATGGGCAGAGCTTTACCCGG - Intergenic
910519636 1:88105250-88105272 GCAAGGGGCTAAGTTTTTTCAGG - Intergenic
912900417 1:113641570-113641592 GCAATGTGCCTAGCTTTGCATGG + Intronic
918345123 1:183600816-183600838 GGGTTGGGCTTAGCTTGTCCAGG + Intergenic
919790747 1:201289253-201289275 GCTGTGGGCCTAGCTTTTCTGGG + Intronic
920508784 1:206535492-206535514 GCCCTGGGCTTGGCATTTCCAGG + Intronic
921724711 1:218511107-218511129 TAAATGGGCTTAGCTTTACCAGG - Intergenic
924392128 1:243573189-243573211 GCAGCTGGCTTATCTTTTCCAGG + Intronic
1063286040 10:4689561-4689583 GCAATGAGTTTTTCTTTTCCTGG + Intergenic
1069267671 10:66482941-66482963 CCATTGGGCTTAGCTTTCCTGGG - Intronic
1070842060 10:79494270-79494292 GGACAGGGCTTGGCTTTTCCAGG + Intergenic
1072773501 10:98165405-98165427 GGATAGGGCTTATCTTTTCCAGG + Intronic
1075711691 10:124534082-124534104 GCAAAGGGCTCTGCTTTGCCTGG - Intronic
1076136357 10:128047653-128047675 GCAACAGGAGTAGCTTTTCCCGG + Intronic
1077282136 11:1750626-1750648 GCAGAGGGCTGGGCTTTTCCAGG - Intronic
1077768628 11:5190358-5190380 GCAGTGGCCTTAGCTGTTCTTGG - Intergenic
1079025386 11:16943807-16943829 GCCCTGGGCTTAGTTTCTCCTGG - Intronic
1080829265 11:35876322-35876344 ACTGTTGGCTTAGCTTTTCCTGG - Intergenic
1081658819 11:44875277-44875299 GCAGAGGGCTTAGCTTTCTCTGG + Intronic
1081769075 11:45636161-45636183 GCATTGAGTGTAGCTTTTCCAGG - Intergenic
1084089449 11:66870468-66870490 AAACTGGGCTTAGCTTTTACTGG + Intronic
1084466798 11:69328062-69328084 GGAATGGGCACAGCTTTGCCCGG - Intronic
1086073438 11:82824288-82824310 GCACTGGGCTTAGCTGTTTTTGG - Intronic
1086604093 11:88674182-88674204 GCCATGGGATGAGATTTTCCAGG - Intronic
1087658573 11:100957497-100957519 GAATTGGCCTTAGGTTTTCCTGG + Intronic
1091120156 11:133050618-133050640 GCCATGGGCTCACCATTTCCTGG + Intronic
1096025543 12:48357878-48357900 GTAAGGGGCTTAGTTTGTCCTGG + Intergenic
1106734774 13:32577938-32577960 GCAATGGCCTGAGCTGTACCTGG - Intergenic
1108488530 13:50953761-50953783 GCAAAGGGCTTACTTTTTACAGG - Intronic
1110474978 13:75903145-75903167 GCTATGGCCATAGCTTCTCCCGG - Intergenic
1110831426 13:80036049-80036071 GAAAAGGGTTTAGCTCTTCCAGG - Intergenic
1113512523 13:110867501-110867523 GCATTGGGTTTTGCTTTTCCAGG + Intergenic
1115048843 14:29030741-29030763 GTTATGGCCATAGCTTTTCCTGG - Intergenic
1115340727 14:32290929-32290951 GCAATGGCCTGAGCTGTACCTGG - Intergenic
1117488507 14:56223155-56223177 GCAATTTGCTTGGGTTTTCCAGG - Intronic
1119159723 14:72442821-72442843 GCAAAGGGCTTAGCTGTAGCTGG + Intronic
1123720912 15:23061370-23061392 TCAATGGCTTTGGCTTTTCCAGG + Intergenic
1125128325 15:36251552-36251574 CCAATTGGCTTAGCTATTCAAGG + Intergenic
1125158210 15:36613805-36613827 GCAATGTGCTTAGCTTCTTTGGG - Intronic
1128831559 15:70773907-70773929 GCAAAGGGATTAGCTTGTACAGG + Intergenic
1131368125 15:91856434-91856456 GCTATGGGCTTTGCTCTTCTGGG + Intronic
1141514475 16:84534685-84534707 GCTATGGGCTCAGCATGTCCTGG + Intronic
1146636650 17:34511424-34511446 GCACTGGGCCAAGCTGTTCCAGG - Intergenic
1146928885 17:36764067-36764089 GCAAAGGGCTTAGCATGGCCTGG - Intergenic
1159036021 18:63277657-63277679 CCAATGGGCTTAGCTTCCCCAGG + Intronic
1159994173 18:74946361-74946383 AAAATGTGGTTAGCTTTTCCTGG - Intronic
1161332781 19:3696296-3696318 GCACTGTGCTGAGCTCTTCCGGG + Intronic
1161749124 19:6081417-6081439 GCAATGGGCTTAGTGTTACTTGG - Intronic
1162588941 19:11578358-11578380 CCAACGGGCTTCCCTTTTCCAGG + Intronic
1168386075 19:55964249-55964271 GCAATGGGCTGAGAATTTCATGG + Intronic
933605391 2:84377067-84377089 GCATTTGGTTTAGCTTTTCCAGG + Intergenic
933647891 2:84827168-84827190 ACCATGGGCTTAGCTTTTGTGGG - Intronic
933865045 2:86508566-86508588 GCAAGGGACTTAGTTTTTTCAGG - Intronic
934663017 2:96153180-96153202 GTGATGGCCTCAGCTTTTCCAGG - Intergenic
935069466 2:99681338-99681360 GTAATGGGTTTAGCATTACCTGG + Intronic
941313975 2:163969455-163969477 GTAATGGGATTAGCATTGCCAGG + Intergenic
944997229 2:205307579-205307601 GCAATGGGCTTGTCTTTTAAAGG - Intronic
946146188 2:217732921-217732943 GCCATGGTCTTAGCTTCTGCAGG + Intronic
947830348 2:233135717-233135739 GAGCTAGGCTTAGCTTTTCCAGG - Intronic
948630716 2:239300958-239300980 GCTCTGGGCTTCTCTTTTCCTGG + Intronic
1171971070 20:31565607-31565629 GCACTGAGCTTAGCCTTCCCAGG - Intronic
1172791463 20:37508764-37508786 GCTCTGAGCTTAGCTATTCCCGG + Intronic
1176237744 20:64062116-64062138 GGAATGGGCTGAGCATTTCTTGG - Intronic
1184117163 22:42428933-42428955 GCTGGGGGCTTGGCTTTTCCAGG - Intronic
1184352619 22:43954717-43954739 GCCATGGGCTTAGGTTTTGGTGG - Intronic
950168393 3:10818509-10818531 GAAAGGGTCTTAGCTTTTCTGGG - Intronic
950708512 3:14798639-14798661 GCCATGCCCTTAGCTTCTCCAGG + Intergenic
951908412 3:27725449-27725471 GAAATGGGCTTTCCTTTTGCTGG + Intergenic
952412442 3:33061786-33061808 TCAATGGCTTTAGCTTTTTCAGG + Intronic
952907800 3:38154309-38154331 GCACTGTGCTAAGCATTTCCAGG + Intergenic
955809564 3:62772513-62772535 GCGATGCTCTTAGCCTTTCCTGG - Intronic
956366877 3:68513883-68513905 GGAATTGTCTTAGTTTTTCCAGG + Intronic
957843391 3:85699576-85699598 GCAGTGGCCTGAGCTTTACCTGG + Intronic
961003878 3:123391662-123391684 GCAATGGGCTTAGCTTTTCCAGG + Intronic
961764428 3:129197981-129198003 GCCAAGGTCTTAGCATTTCCAGG + Intergenic
963850543 3:150206518-150206540 GCAAATGGCTTAGCTTCTCCAGG - Intergenic
966132907 3:176664660-176664682 ACAATGAGCTAAGCTTTTCAAGG - Intergenic
972430136 4:38973590-38973612 GGAATTGTCTTAGGTTTTCCAGG + Intronic
978613320 4:110568216-110568238 GACATAGGCTTTGCTTTTCCTGG - Intergenic
978726745 4:111977901-111977923 GAAAAGGGCTTAGTTCTTCCCGG + Intergenic
979060903 4:116059304-116059326 GCAATGGCCTGAGCTTACCCTGG + Intergenic
987083770 5:14449542-14449564 GCTATAGGCTCATCTTTTCCTGG + Intronic
988467208 5:31502217-31502239 GAAATGGCCTCAGCTGTTCCAGG + Intronic
992893936 5:81231173-81231195 GCAATGGACTGAGCTGTTCCAGG - Intergenic
993659252 5:90610408-90610430 AGAAGGGGCTTAGCTTTTTCAGG + Intronic
993751230 5:91670882-91670904 GCAAGGGGGTTGGCATTTCCAGG + Intergenic
996735343 5:126753411-126753433 GCAATTAGCTTCTCTTTTCCAGG - Intergenic
1001398640 5:171433715-171433737 GCAATGGACTTAACTTTTCTGGG + Intronic
1005184098 6:23144086-23144108 CCATTTGGCTTAGCTTTCCCAGG + Intergenic
1006594609 6:35183779-35183801 GCCATGGGCTTTGCTTTTCCAGG + Intergenic
1007487370 6:42190675-42190697 GCAAGTGGCAGAGCTTTTCCAGG + Intronic
1008195963 6:48521138-48521160 CCACTGCTCTTAGCTTTTCCAGG - Intergenic
1013979404 6:116111968-116111990 GCTATGTGCCTGGCTTTTCCAGG - Intronic
1014177816 6:118349343-118349365 GCAAGAGGCTTGGCTTATCCAGG + Intergenic
1016295974 6:142574046-142574068 GCAATGACCTGAGCTTTACCTGG - Intergenic
1016619743 6:146094346-146094368 GTCAGGGGCATAGCTTTTCCTGG + Intronic
1019001532 6:168757300-168757322 GCTATGGCCTTAGCTTCCCCAGG - Intergenic
1026680722 7:72464625-72464647 GCAGTGGGCTTTGCTCTTGCAGG - Intergenic
1028613710 7:92740260-92740282 GCAATGCTATTTGCTTTTCCTGG + Intronic
1029286279 7:99468394-99468416 GCAATGGGCAGGGTTTTTCCTGG - Intergenic
1034924511 7:155110487-155110509 GCAATGGTCTTTGGTTTCCCCGG - Intergenic
1035417901 7:158704957-158704979 GCACTGGGCTTAGCTGCTCGAGG - Intergenic
1036219711 8:6911097-6911119 GCGCTGGGCTTACATTTTCCTGG - Intergenic
1038618382 8:29116706-29116728 GCACTGAGCTTTTCTTTTCCAGG - Intronic
1040834952 8:51722122-51722144 GCAGTCGGCTGAGCTTTCCCTGG + Intronic
1043251768 8:78083807-78083829 GCAATGGGCTTTGCTTATATGGG - Intergenic
1047788417 8:128177121-128177143 GAAATGGACTGAGCTTTTCCTGG - Intergenic
1048448166 8:134508397-134508419 GGAAGGGGGTTAGCTTTTCTTGG - Intronic
1048516156 8:135113547-135113569 GCAATGGCCTGAGCTGTACCTGG - Intergenic
1049835629 8:144733855-144733877 GCAACGGTGTTAGCTGTTCCAGG - Intronic
1061293106 9:129663564-129663586 TCAGTGGGCTGTGCTTTTCCTGG + Intergenic
1061785188 9:133023550-133023572 GCGCTGGGCTTCGTTTTTCCCGG + Intergenic
1062071917 9:134560361-134560383 GCCATGGCCTTGGCTTTCCCAGG - Intergenic
1187110488 X:16293590-16293612 GCAATGGTCTTTGCTTATTCAGG - Intergenic
1188991645 X:36827872-36827894 GCAAGGTGCATAGCTTTTGCAGG - Intergenic
1193154712 X:78159620-78159642 GCATTGGGCTTTGCTTTCTCTGG - Intergenic
1195160095 X:102162502-102162524 GCAATGGACTAAGCTGTACCTGG + Intergenic
1196088082 X:111708040-111708062 GCAATGGACTTGGCTTGCCCAGG - Exonic
1196498553 X:116350908-116350930 GCAATGGCCTGAGCTGTTCATGG - Intergenic
1199236988 X:145503847-145503869 GGACTGGGTTGAGCTTTTCCAGG - Intergenic