ID: 961007930

View in Genome Browser
Species Human (GRCh38)
Location 3:123417245-123417267
Sequence GCCTCCTGCCCTGGATCACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 303
Summary {0: 1, 1: 1, 2: 1, 3: 15, 4: 285}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961007930_961007934 -4 Left 961007930 3:123417245-123417267 CCATGTGATCCAGGGCAGGAGGC 0: 1
1: 1
2: 1
3: 15
4: 285
Right 961007934 3:123417264-123417286 AGGCATGAAAAGGCCACAGGTGG 0: 1
1: 0
2: 1
3: 30
4: 309
961007930_961007933 -7 Left 961007930 3:123417245-123417267 CCATGTGATCCAGGGCAGGAGGC 0: 1
1: 1
2: 1
3: 15
4: 285
Right 961007933 3:123417261-123417283 AGGAGGCATGAAAAGGCCACAGG 0: 1
1: 0
2: 2
3: 28
4: 287
961007930_961007936 11 Left 961007930 3:123417245-123417267 CCATGTGATCCAGGGCAGGAGGC 0: 1
1: 1
2: 1
3: 15
4: 285
Right 961007936 3:123417279-123417301 ACAGGTGGCTCTGCATCTTCAGG 0: 1
1: 0
2: 1
3: 12
4: 175
961007930_961007937 25 Left 961007930 3:123417245-123417267 CCATGTGATCCAGGGCAGGAGGC 0: 1
1: 1
2: 1
3: 15
4: 285
Right 961007937 3:123417293-123417315 ATCTTCAGGAAGTCAGTGAGAGG 0: 1
1: 0
2: 0
3: 24
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961007930 Original CRISPR GCCTCCTGCCCTGGATCACA TGG (reversed) Intronic
900151376 1:1180641-1180663 GCCTCCTGGGCCGGAGCACAGGG + Intronic
900300553 1:1974666-1974688 GCCACATGTCCTGGATGACAGGG + Intronic
900397062 1:2457385-2457407 GCCTCGTGGCCGTGATCACAAGG + Intronic
900420957 1:2555763-2555785 GCCTCGCTCCCTGCATCACATGG - Intronic
900437079 1:2635840-2635862 CCCTCCTGCCCTGGATACCCAGG - Intergenic
901680258 1:10908990-10909012 CCATCCTTCCCTGGAACACACGG - Intergenic
901808173 1:11750663-11750685 GCCTCCAGCCCTGCATCCCTAGG - Exonic
901875663 1:12165796-12165818 TCCTCCAGCCCTGGATTACGGGG - Intergenic
902828450 1:18994076-18994098 ACTTCCTGCCCTGGGGCACAAGG + Intergenic
902926350 1:19698270-19698292 GCCTCTTGTCCTGGGTTACAAGG + Intronic
903071988 1:20731280-20731302 TCCACCTGCCCTGGGCCACAGGG + Intronic
903268670 1:22174165-22174187 CCCTCCAGCCCTGGACCACCCGG + Intergenic
903661222 1:24980030-24980052 GCCTTCTGCCCTTGGTGACAGGG - Intergenic
903672662 1:25045867-25045889 GCCCCCTGCCCACGACCACAAGG + Intergenic
903832207 1:26182223-26182245 GCCCCCTGCCCAGAACCACAGGG - Intronic
904255785 1:29253955-29253977 GCCACCTGCCCCTGGTCACAAGG + Intronic
904279755 1:29410606-29410628 GCCACCTGCCATGAGTCACAGGG + Intergenic
904353979 1:29926707-29926729 GCCTCCTGCCCTGGAAAAGGGGG - Intergenic
904538816 1:31219040-31219062 TGCTCCTGCCCTGGTCCACAAGG - Intronic
904983449 1:34525648-34525670 CCCTCCTCCCCTGGGTCACCTGG - Intergenic
905174563 1:36127463-36127485 GCCTCCTGGCCTGAACTACAGGG + Intergenic
906578258 1:46910619-46910641 CTCACCTGCCCTGCATCACAAGG - Intergenic
908400700 1:63770527-63770549 GCCTCTTGCACTGGCACACACGG - Intergenic
910788118 1:91022107-91022129 GCCTCCAGCCCCGGTTCCCACGG + Exonic
912381503 1:109250195-109250217 GCCTCGTCCCCTGGACCCCAAGG - Exonic
912445408 1:109732273-109732295 TCCTGCTGCCCTGGAGCACGGGG - Intronic
917504918 1:175618856-175618878 GCCTTCTGCCCAGGAGCACCTGG + Intronic
918472068 1:184885005-184885027 GCCTCCTACCCAACATCACAGGG + Intronic
919730321 1:200909356-200909378 CCCTCCTCCCCTGTATCTCAGGG - Exonic
922325389 1:224523801-224523823 GCCTCTTGCCCTGCAGCTCAGGG - Intronic
923769791 1:236928461-236928483 ACCTCCTTCCCTGCCTCACACGG + Intergenic
924499217 1:244620839-244620861 CCCTGGTGACCTGGATCACAAGG + Intronic
1067039165 10:42939909-42939931 GCCTCCTGCCCTGGATGGAGAGG + Intergenic
1067341231 10:45405987-45406009 TCCTCCTGACTTGGATGACAGGG + Intronic
1067830774 10:49610123-49610145 GCCTCCAGCCCTGGAGCATCTGG + Intronic
1068117768 10:52752789-52752811 ACCACCTGCCCTTGATCACCTGG - Intergenic
1069635927 10:69924870-69924892 GCCTCCTGGCCCTTATCACATGG + Intronic
1069783097 10:70969241-70969263 GCCCCCTCCCCTGGACCCCAGGG + Intergenic
1069801795 10:71086248-71086270 GTCGCCTGCCAAGGATCACAAGG - Intergenic
1069916655 10:71790778-71790800 GCCTCCTGTCCAGGACCAGACGG - Intronic
1070552457 10:77501561-77501583 GCCTCCTTCCCTGATGCACACGG + Intronic
1070752089 10:78969929-78969951 GCCTGCTGCCCTGTACCTCAGGG - Intergenic
1072574820 10:96689939-96689961 GCCTCCAGCCCTGCCTGACATGG + Intronic
1073625752 10:105095191-105095213 GCCTCCATCTCTGGAGCACAAGG + Intronic
1074386487 10:113020483-113020505 TCCTCCAGCCCTGGATGAAAGGG - Intronic
1074824531 10:117205075-117205097 GCTTCCTGCCCTGCATCTCTGGG + Intronic
1076107345 10:127834267-127834289 TCCTCCTGCCCAGGGACACAGGG + Intergenic
1076577433 10:131478975-131478997 TCCTCCTCCCCAGGATCACTGGG - Intergenic
1076887015 10:133267587-133267609 GCCCCCAGCTCGGGATCACACGG - Intronic
1076890113 10:133279216-133279238 GCCTCCTGCCCTGGACCAGTTGG + Exonic
1077305504 11:1867027-1867049 GCCTCCTCCCCAGGTCCACAGGG - Intronic
1077473388 11:2775327-2775349 GTCCCCTGCCCTGCCTCACATGG + Intronic
1077844810 11:6013091-6013113 GACTCCTGCCCAAGAGCACAGGG + Intergenic
1081110858 11:39131345-39131367 GCTTCCTGCCCTGGAACATCTGG + Intergenic
1082784065 11:57307261-57307283 GCAACCTGCCCAGGACCACAAGG + Intronic
1083297088 11:61720641-61720663 GCCACCTGGCCTTGCTCACACGG + Intronic
1083784248 11:64934735-64934757 CCTTCCTCCCCTGGGTCACAGGG - Exonic
1084166784 11:67378831-67378853 GAGTCCTGGCCTGGAGCACAGGG + Intronic
1084245068 11:67851407-67851429 GCCTCCTGCTCTGAGTCACCTGG + Intergenic
1084687915 11:70708090-70708112 GCCTTCTGCCCTCGATGACCAGG + Intronic
1084827622 11:71743171-71743193 GCCTCCTGCTCTGTGTCACCTGG - Intergenic
1084916294 11:72431559-72431581 GCCTCCTGGCCTAGATTCCAGGG + Intronic
1085171025 11:74450002-74450024 GCCTGTTGCCCTGGGACACAGGG - Intergenic
1085388073 11:76168474-76168496 GCCCCCAGCCCTGGCTCCCATGG + Intergenic
1085699057 11:78729965-78729987 GCCTCCTGCTCTGTACAACAGGG + Intronic
1086810387 11:91302491-91302513 GCTTTCTGCCCTGGTTTACATGG + Intergenic
1086936233 11:92748201-92748223 GCCTGCTGCCATGGAAGACACGG - Intronic
1088749898 11:112834711-112834733 GCCTCCCTCCCTTGTTCACATGG - Intergenic
1088770044 11:113025627-113025649 GCCTCCTGGGCTGAATCAGAGGG - Intronic
1090182621 11:124714085-124714107 GCCTCCCTCCCTGGTTCTCATGG + Intergenic
1090422033 11:126582015-126582037 GCAGCCTGCCCAGGGTCACACGG + Intronic
1090944924 11:131421201-131421223 GCCTCCTCCCCTGGAGCCTAGGG + Intronic
1091992019 12:4963049-4963071 GCAACCTGCCCAAGATCACACGG - Intergenic
1092280015 12:7091632-7091654 GCCTCCTGCCCTGCAGAACAGGG + Exonic
1092415640 12:8288537-8288559 GCCTCCTGCTCTGAGTCACCTGG + Intergenic
1092831365 12:12447523-12447545 TCATCCTGCCCGGGAGCACAAGG + Intronic
1096766240 12:53892705-53892727 AGCTCCTGCCCTGGATAGCAGGG + Intergenic
1101039285 12:100737542-100737564 GCCTTGTGTCCTGGGTCACAAGG + Intronic
1102254964 12:111410003-111410025 GGCTCCAGGCCTGGCTCACAAGG - Intronic
1102508289 12:113397692-113397714 GCCTTCTGCACTGGCTCCCAGGG + Intronic
1102551481 12:113695148-113695170 GCCGCCTGGCCTGGTTCACCCGG + Intergenic
1102714469 12:114958143-114958165 GCCTCCTACCTTGGCTCCCAAGG + Intergenic
1103366660 12:120389132-120389154 GCCTCCTTCCCGGGTTCCCAGGG - Intergenic
1103884188 12:124188603-124188625 GTCTCATGCCCTGGGGCACATGG - Intronic
1105421750 13:20258569-20258591 GCCTCCTGTTCTGGGTCACCTGG - Intergenic
1106435600 13:29720848-29720870 GGCTTCTGCCCTGGATCCCAAGG + Intergenic
1108357890 13:49643599-49643621 GCCTTCTGCCCGGGAGCAGAGGG - Intergenic
1113565239 13:111315811-111315833 GTCTCCTGGCCTGGAGCCCAGGG + Intergenic
1113954390 13:114089401-114089423 GCCTCCTGCCCTCCATGCCAGGG - Intronic
1117339947 14:54784220-54784242 ACCTCCTGCCCTGGCCCATAAGG - Intronic
1117731009 14:58721720-58721742 GTCTCCTGCCCTGGGTGTCAGGG - Intergenic
1119522110 14:75294138-75294160 GCGACCTGCCCTGGAGCAAAGGG - Intergenic
1120532583 14:85650879-85650901 GCATCCTAGCCTGGATGACAGGG - Exonic
1121611356 14:95283020-95283042 GCATCATGCCATGGAGCACAGGG - Intronic
1125792090 15:42374584-42374606 GCCTCAGGCTCTGGATCACTTGG - Intronic
1127711575 15:61604415-61604437 GCCACCTGCCTTGATTCACAAGG + Intergenic
1128496965 15:68204243-68204265 GGACCCTACCCTGGATCACAAGG + Intronic
1128550821 15:68596886-68596908 GCCTCCTGACCTGGGGCCCATGG + Intronic
1129230048 15:74192094-74192116 CACTCCTGCCCGGGATCCCAGGG - Intronic
1129283664 15:74506228-74506250 GCATCTTGCCCTGAAGCACAGGG - Intergenic
1130423747 15:83774829-83774851 GCCTCCTCCCCTTGCCCACAGGG - Intronic
1132243403 15:100277061-100277083 GCCTTCTGGCTTGGATCAAAAGG + Intronic
1132332790 15:101024428-101024450 TCCTCTTGCCCTGGCACACAGGG + Intronic
1132553833 16:564243-564265 CCCTCCTGCCCTGGGTCCCTGGG - Exonic
1133326344 16:4944609-4944631 GCCACCTGCCCAAGGTCACACGG - Intronic
1133724338 16:8523401-8523423 CTCACCTGCCCTGCATCACAAGG - Intergenic
1134667320 16:16028300-16028322 GCCTCCTGCCCTGGGGAAGATGG - Intronic
1136059744 16:27718370-27718392 GCCTCCTGCCCTGGCACCGAGGG + Intronic
1137403361 16:48171195-48171217 GGAGCCTGCCCTGGAACACATGG - Intronic
1137598997 16:49743629-49743651 GCCTGCTGCCCCGGGACACAGGG + Intronic
1137980653 16:53066554-53066576 GGCTCCTGCCCGGTCTCACAGGG + Intronic
1138524258 16:57592827-57592849 CCCTCCTGCCCTGCACCACCCGG - Intergenic
1139516977 16:67458016-67458038 TCCCCCTTCCCTGGGTCACAGGG - Intronic
1139658680 16:68405195-68405217 TCCTGCTGGCCTGGACCACACGG + Intronic
1140874485 16:79138089-79138111 GGCCCCTGCTGTGGATCACAGGG - Intronic
1141468212 16:84221102-84221124 GCCTCCTCCCCTGGATGCAAAGG + Exonic
1141690585 16:85594174-85594196 GCCTCCTGCCCTGGCCCATCGGG - Intergenic
1142241645 16:88950161-88950183 GGTTCCTGCCCTGGAGAACAGGG - Intronic
1143345169 17:6243926-6243948 GTCTCCTGCCCTCTATAACAGGG - Intergenic
1143474261 17:7193843-7193865 GGCTCCAGCTCTGGATCGCAGGG - Exonic
1143783923 17:9243196-9243218 GCCTCCTGCCCTGCTTTCCAAGG - Exonic
1143972178 17:10803769-10803791 GCCTACTGCTCTGGATCATCTGG - Intergenic
1144467753 17:15509811-15509833 TGCTCCTTCCCTGGCTCACATGG + Intronic
1144646623 17:16979224-16979246 GTCTCCTTCCCTGGTTCCCATGG + Intergenic
1145007626 17:19346440-19346462 GGCTGCTGCCCTGGAACCCAGGG + Intronic
1146637379 17:34516556-34516578 GCCTTATGCCCTGGGTCAGAAGG + Intergenic
1146939788 17:36836510-36836532 TGCTCCTCCCCTGGATCTCAGGG + Intergenic
1147185568 17:38711473-38711495 ACCTCCTTCCCTGGAGCAGAGGG - Intronic
1147317527 17:39627888-39627910 TACTCCTGCCCTGGGTGACAAGG - Intronic
1148382359 17:47209303-47209325 GGCTCCTGCCCAGGATAAAAGGG + Intronic
1148895590 17:50837389-50837411 GCCTTCTGCTCTGTATCAGAGGG + Intronic
1149512614 17:57256214-57256236 CCCGACTTCCCTGGATCACATGG - Intronic
1149634173 17:58153247-58153269 GCTTCCTGCCCTGGTGCACTGGG + Intergenic
1149682343 17:58514909-58514931 GACGCCTGCTCTGGATCCCAAGG + Intronic
1151812199 17:76451094-76451116 GCCTCCTGCCCTAGGACTCAGGG - Intronic
1152280519 17:79382499-79382521 GGCTCCTGCCCTAGAGGACATGG - Intronic
1152305206 17:79516378-79516400 GCCCCCTGCCCTGGAGAACCAGG + Intergenic
1153178785 18:2409120-2409142 GCCTCCAGCTCTGGAGCCCAGGG + Intergenic
1153773112 18:8431225-8431247 GTCACATGCCCTAGATCACATGG - Intergenic
1154162603 18:11991179-11991201 GCCACGGGCCCTGGAACACAGGG + Intronic
1154377535 18:13822484-13822506 GCATCCTGCCCTGGCTTGCAGGG + Intergenic
1157549771 18:48573373-48573395 GACCCCTGGCCTGGGTCACATGG - Intronic
1157578779 18:48761263-48761285 GCCTACTTCCCTGGATCTGAGGG - Intronic
1157855271 18:51099646-51099668 GCATCCTGCACTGGATGAGAGGG + Intergenic
1158470282 18:57729894-57729916 GCCTTCTGCCTTGAATCAGAAGG - Intronic
1161446739 19:4322965-4322987 CCCTCCTGCCCTGCGCCACAGGG + Exonic
1162472270 19:10879533-10879555 GCCACCTGGCTTGGAGCACAGGG + Intronic
1163554811 19:17985791-17985813 GCCCCTTGCCCTGGATCCAAAGG - Intronic
1163599362 19:18239421-18239443 GCCGCTTGCCCTGGACCACGTGG - Intronic
1164941068 19:32252573-32252595 CCCTCCCGCCCTGCACCACAGGG - Intergenic
1165419824 19:35717365-35717387 GCCTCCTCTCCGGGAGCACACGG + Intergenic
1166837051 19:45673898-45673920 GCCTCGTGCCCTGGAGCTGAAGG + Intronic
1167117821 19:47498291-47498313 GCCTCCAGCGCTGTCTCACAAGG + Intronic
1167235383 19:48311522-48311544 GTCTCCTCCCCTGGATTTCAGGG + Intronic
925080612 2:1061239-1061261 GCGTCCAACCCAGGATCACACGG - Intronic
925711623 2:6746666-6746688 AAGTGCTGCCCTGGATCACAGGG - Intergenic
926691011 2:15733414-15733436 GCCTCCTGCCTTGCATCCCTAGG + Intronic
926730917 2:16034716-16034738 GACTACTGGCCCGGATCACATGG + Intergenic
927792065 2:26018119-26018141 GGTTGCTGCCCTGGATGACAAGG + Intergenic
930198479 2:48530747-48530769 CCCTCCTGCCCTGGAAGGCAAGG + Exonic
930353769 2:50291557-50291579 CCATCCTCCCATGGATCACAAGG + Intronic
931157780 2:59654820-59654842 GCCTCCTGTCCTTGTTCCCAAGG - Intergenic
931706634 2:64951741-64951763 CCCAGCTGCCCTGGCTCACAGGG - Intergenic
932774565 2:74519963-74519985 GCGTCGGGCCCTGGAACACACGG - Exonic
933652756 2:84862426-84862448 GCCTCCTGCCCTGGTGAACTAGG - Intronic
933746603 2:85576387-85576409 GCCCCCTGCTCTGGTTCACTGGG + Intronic
934649402 2:96082386-96082408 ACCTCTTGCCCAGGATCACAGGG - Intergenic
935128220 2:100242401-100242423 GCCTCTCGCCGTGGATCTCATGG + Intergenic
937636627 2:124163307-124163329 GCCTCCAGCCCTGGAGAATAGGG + Intronic
938670227 2:133579516-133579538 GCCTCCTGCCCTGCAAAAGAAGG - Intergenic
939215374 2:139230769-139230791 GTCTCCTGCCCTGGAAAGCATGG - Intergenic
940793818 2:158055887-158055909 GCCTCCTTCCCTGGATGGCAAGG + Intronic
945470681 2:210225022-210225044 GCCTCCTTTCCTGGATCCCGCGG - Intronic
945790117 2:214294041-214294063 GCATCCTGCCCTGGAGCTGATGG - Intronic
946066539 2:216992446-216992468 GCCTTCTGCTCTGAAGCACAAGG + Intergenic
946198984 2:218060086-218060108 CCCTCCTGCCCTTGAGCTCATGG - Intronic
947507511 2:230720304-230720326 GCATCCTGGCTTAGATCACAGGG + Intronic
947751915 2:232537324-232537346 GCCTCCTGCACAGGCTCCCAGGG + Intergenic
949072810 2:242036269-242036291 ACATCCTCCCCTGGAACACAAGG - Intergenic
1168827549 20:823655-823677 GTGACCTGGCCTGGATCACACGG - Intergenic
1170412236 20:16104262-16104284 GCCTCCTACCCTGAAGAACAAGG + Intergenic
1172824226 20:37766796-37766818 GCTTCCTGCCATGGTTTACAAGG - Intronic
1174576553 20:51541901-51541923 GCCTCCTACCCTTGATAACTGGG + Intronic
1175143466 20:56878216-56878238 TCCTCTCGCCCTGGCTCACACGG - Intergenic
1175624981 20:60482523-60482545 CTCTCCTGCCCTCGATCCCATGG + Intergenic
1175844895 20:62053011-62053033 GCCACCTGCCTTGGGTCACATGG - Intronic
1176253872 20:64140470-64140492 GCCCCCAGCCCTGGGTCAGAGGG - Intergenic
1179625941 21:42649846-42649868 GCCTCCTTCCCTGTGACACACGG + Intergenic
1179681123 21:43022048-43022070 CTCTCCTGCCCTGGATCAGCAGG - Intronic
1180956592 22:19743983-19744005 CACTCCTGCCCTGGCTCTCAGGG - Intergenic
1180985410 22:19901254-19901276 GCCTCCTGTCCTGGCACCCACGG + Intronic
1181493467 22:23275055-23275077 TCCTCCTGCCCTGGGCCACCAGG + Intronic
1181522917 22:23459779-23459801 GCCTCCTGCCCTGTGTCCCCTGG + Intergenic
1182127663 22:27828007-27828029 GCTGCCTGCTCTGGAGCACAGGG - Intergenic
1182298956 22:29327420-29327442 GCCTTCTGGCCAGCATCACAAGG + Intergenic
1183608851 22:38883927-38883949 GACTCCTGCCCTGGAGCAGAGGG + Intergenic
950285184 3:11739247-11739269 GCCTCCTCCCCTAGATGATAAGG + Intergenic
953911820 3:46897064-46897086 GCCTCCTGTCCATGATCCCAGGG + Intronic
954446360 3:50549001-50549023 GCCTGCTGCACTGGATCACCGGG + Intergenic
954446365 3:50549026-50549048 CCCTGCTGCACTGGATCACCAGG + Intergenic
954578682 3:51691286-51691308 GCTTCCCTCCCTGGATCTCAAGG + Intronic
954711601 3:52507724-52507746 GGTTTCTGCCCTGGGTCACAGGG + Intronic
954751468 3:52816607-52816629 GCTGCCTGCCCAGGGTCACAAGG + Intronic
956173504 3:66452044-66452066 GACTCACGCCCTGGCTCACATGG + Intronic
956264518 3:67381999-67382021 GCCTCCTGCCTTTTATCATAAGG + Intronic
956349633 3:68320621-68320643 ACCTCTGGCCCTGGGTCACAGGG - Intronic
960603313 3:119479578-119479600 GGCTCCTGATGTGGATCACATGG - Intronic
961007930 3:123417245-123417267 GCCTCCTGCCCTGGATCACATGG - Intronic
961071346 3:123930875-123930897 ACCCCCTGCCCAGAATCACATGG + Intronic
961074264 3:123967012-123967034 CTCTCCTGCCCTGGCTCACTGGG - Intergenic
961309362 3:125985118-125985140 CTCTCCTGCCCTGGCTCACTGGG + Intergenic
961665189 3:128489929-128489951 GCCTCCCGCGCTGGGTCCCAGGG - Intronic
961893187 3:130147146-130147168 GCCTCCTGCTCTGAGTCACCTGG + Intergenic
963839876 3:150094379-150094401 GCCACCCGCCCTGGATCCTAAGG + Intergenic
964727170 3:159825563-159825585 CACTCCTGCCCTCGATCCCAAGG + Intronic
966849776 3:184157023-184157045 ACCTTCTGCCCTGGAACTCAGGG + Intronic
969539547 4:7778447-7778469 GTCTCCTGACCTGGAGCCCAGGG + Intronic
970155691 4:13139809-13139831 GCCTCCTTCACAGGAGCACAAGG + Intergenic
972763885 4:42133502-42133524 GTAACCTGCCCAGGATCACATGG - Intronic
973757798 4:54092390-54092412 GCCTCCTGCCCTGTGTCCCCGGG - Intronic
978986995 4:115024995-115025017 GCCTTCTGCCGTGGGTGACACGG + Intronic
979425766 4:120563653-120563675 GCCCCCTGCCCTGTCCCACATGG + Intergenic
983514020 4:168638252-168638274 GCATCTTGCCCAAGATCACATGG + Intronic
983634413 4:169882859-169882881 GCCTGCTCCCATGGCTCACATGG - Intergenic
985638334 5:1051309-1051331 TCCTCCTTCCCTGGAGCACCGGG + Exonic
986233184 5:5885486-5885508 GCCTCCAGCCCTGGAGCAGCTGG + Intergenic
986709251 5:10476166-10476188 GCCACATGCCCTTGATCACATGG + Intergenic
988361059 5:30237129-30237151 GCTTCCTGCCCTCGAACATAAGG + Intergenic
990696741 5:58426582-58426604 GCCTTCTTCCCTGGCTAACAAGG + Intergenic
991263532 5:64691009-64691031 GCCTCCTGTCCTGGCTCCCGGGG - Intronic
991343844 5:65641674-65641696 GCATCCTAGCCTGGATGACAGGG + Intronic
991550215 5:67827254-67827276 GCCTCTTGCTCTGGATTATAAGG - Intergenic
991647915 5:68819615-68819637 ACATCCCGCCATGGATCACACGG + Intergenic
995452020 5:112312767-112312789 GCCTCCTGCCCTTATACACATGG + Intronic
995557175 5:113341661-113341683 GCCTTCTGGCCTGGTTCAGATGG + Intronic
996315035 5:122152242-122152264 GCCTGCGGGCCGGGATCACAGGG - Exonic
997370492 5:133356746-133356768 GCCTCCTGGCCTGCCTCGCAGGG + Intronic
998477324 5:142432740-142432762 GCCTCCTGCCTGGGCTCACCCGG + Intergenic
998789700 5:145752782-145752804 GCCTCCTGTCCTGGGGCCCAGGG + Intronic
999245577 5:150152773-150152795 GCCTCCTGCATTGGAACACTTGG - Intronic
1000754449 5:165139996-165140018 GCTTCCTCCCTTGGATCACATGG + Intergenic
1001107912 5:168871150-168871172 TCCTCCTTCCCTGAATCACGTGG + Intronic
1001278236 5:170366465-170366487 GCCTGCTGGCCTGTCTCACAGGG + Intronic
1001649108 5:173302587-173302609 GCCTCCAGCCATGGATCTGAGGG - Intergenic
1001939823 5:175732610-175732632 GCCACCTCCCCTTGAGCACAGGG + Intergenic
1002353619 5:178604790-178604812 GACCCCTGCACTAGATCACAAGG + Intronic
1006278077 6:33022117-33022139 CCCAACTTCCCTGGATCACATGG + Intergenic
1009763757 6:68040920-68040942 GGCACCTCCTCTGGATCACAAGG + Intergenic
1011004525 6:82629187-82629209 TCCTCCTGCCCTGGTCTACAGGG + Intergenic
1011554476 6:88560334-88560356 GTAGCCTGCCCAGGATCACATGG + Intergenic
1013549455 6:111192737-111192759 GCCTCCTGCCGTGTAAGACATGG - Intronic
1015357496 6:132296307-132296329 CCCTCCTGGACTGGCTCACACGG + Exonic
1017461313 6:154653517-154653539 GCCCCCTGCTCTGGTTCCCAGGG - Intergenic
1018101894 6:160447406-160447428 GCCTCCTCTCCTGCATCACAGGG - Intronic
1018133759 6:160757803-160757825 GCCTCCCCTCCTGCATCACAGGG + Intergenic
1018181432 6:161226778-161226800 CCCTCCTGCCCGGCAGCACAGGG - Intronic
1018999145 6:168733299-168733321 TCATCCTGCCCTGAATCAAATGG + Intergenic
1019314676 7:379024-379046 GGCTCCTTCCCTGGGTCGCAGGG + Intergenic
1019574987 7:1733318-1733340 GCCACCAGCCCTCGCTCACACGG - Intronic
1020275423 7:6621915-6621937 GCCTCCTCCCCTGGAGCCCGAGG + Exonic
1024548717 7:50542860-50542882 GCCTCAGGCCCTGGACCTCAGGG - Intronic
1024797863 7:53038972-53038994 GCCTCCTTCCTTGTAGCACAAGG + Intergenic
1026774614 7:73223676-73223698 CCCTCTTGCCCTGGGTCTCAAGG + Intergenic
1027015472 7:74777065-74777087 CCCTCTTGCCCTGGGTCTCAAGG + Intronic
1027072559 7:75168890-75168912 CCCTCTTGCCCTGGGTCTCAAGG - Intergenic
1028037424 7:86002889-86002911 GTCTTCTGCCCTGGGTCCCAGGG - Intergenic
1029188039 7:98753441-98753463 CTCACCTGCCCTGCATCACAAGG - Intergenic
1029955115 7:104630573-104630595 GTCTCCTGCCTTGGATCACATGG - Intronic
1032077654 7:128843683-128843705 GCCTCCTGCCCTCACTCTCATGG + Intronic
1034459899 7:151192450-151192472 CCCTCCTCCCCTGGAGCAGATGG - Exonic
1035694439 8:1584434-1584456 GCCTCCTCCCCAGGAGCATATGG - Intronic
1036773867 8:11596787-11596809 GCCCCCTGCCCTGGGTGCCATGG - Intergenic
1036774006 8:11597656-11597678 TCCCCCTGCCCTGGATCCCAAGG + Intergenic
1036816969 8:11909529-11909551 GCCTCCTGCTCTGAGTCACCTGG + Intergenic
1036820273 8:11934418-11934440 GCCTCCTGCTCTGAGTCACCTGG + Intergenic
1038096849 8:24322589-24322611 TCCTTCTGCCCTTGAACACAGGG - Intronic
1040925699 8:52679994-52680016 GGAAGCTGCCCTGGATCACAGGG - Intronic
1042022312 8:64380579-64380601 GGCTCCTGCCCTGTTTCACCTGG - Intergenic
1043374661 8:79635141-79635163 GCCTCCTGCCCTGGTAAACTTGG - Intronic
1043383659 8:79728449-79728471 GCCTTCTGCCCTGGACCAAAAGG + Intergenic
1043771290 8:84204970-84204992 GCTTCTTGCCCAGGATGACAGGG + Intronic
1044935986 8:97293790-97293812 GCTCCCTGCCCAGGATCACCAGG + Intergenic
1047105307 8:121724869-121724891 CCCTCCTGACCTGGATCTCAGGG - Intergenic
1047811003 8:128409193-128409215 GCCTCCAGCCCTGGCTCTCAAGG - Intergenic
1048868853 8:138780893-138780915 TCCGTCTGCCCTGGCTCACAAGG - Intronic
1049229065 8:141472776-141472798 GCCTCCTGCCCTGGATCGCAAGG - Intergenic
1049239381 8:141529179-141529201 GCCACCTGCCTGGAATCACACGG - Intergenic
1049275796 8:141719545-141719567 TTGTCCTGCCCTGGGTCACACGG - Intergenic
1049367723 8:142248808-142248830 TCCTGCTGCCCTGTATCACTCGG + Intronic
1052473776 9:28932374-28932396 GACTCCAGTCCTGGATCAGATGG - Intergenic
1053286424 9:36852243-36852265 CCCACCTGCCCAGGATCAAAGGG - Intronic
1053372461 9:37574523-37574545 TCCTTCTGCCCTGGAGCACTTGG - Intronic
1057524512 9:95786694-95786716 GGCTTCTGCCCTCGGTCACAAGG - Intergenic
1059395874 9:114033706-114033728 CCCTCCTGCCCTGCCTCTCAGGG - Intronic
1060425957 9:123505913-123505935 GCCTGCTCCTCTTGATCACAGGG - Intronic
1061564178 9:131426658-131426680 ACCTCCTGCACTGGAGCAAAGGG - Intronic
1061790619 9:133057123-133057145 GTCTCCTGCCCCGGACCGCAGGG - Intronic
1061920200 9:133778468-133778490 CCCTCCTGCCCTGGCACCCAAGG - Intronic
1062358695 9:136177349-136177371 GCCGCCCTCCCTGGAGCACAGGG - Intergenic
1186026691 X:5321100-5321122 CCCTCTTGCCCTGGAAAACAGGG + Intergenic
1194380157 X:93181287-93181309 GCCTCCTGCACTGGACAGCAGGG + Intergenic
1195615589 X:106909543-106909565 GCCTCCTGCCCTCAACCCCAGGG - Intronic
1199858323 X:151778100-151778122 GCCTCCTGGCTTGGCTCACTTGG + Intergenic