ID: 961008583

View in Genome Browser
Species Human (GRCh38)
Location 3:123421511-123421533
Sequence GGTCATAGTGGACCACACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 68}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961008583_961008585 -6 Left 961008583 3:123421511-123421533 CCTGGGTGTGGTCCACTATGACC 0: 1
1: 0
2: 0
3: 12
4: 68
Right 961008585 3:123421528-123421550 ATGACCATCAGATTGAGCCATGG 0: 1
1: 0
2: 0
3: 7
4: 135
961008583_961008586 -5 Left 961008583 3:123421511-123421533 CCTGGGTGTGGTCCACTATGACC 0: 1
1: 0
2: 0
3: 12
4: 68
Right 961008586 3:123421529-123421551 TGACCATCAGATTGAGCCATGGG 0: 1
1: 0
2: 0
3: 6
4: 88
961008583_961008590 9 Left 961008583 3:123421511-123421533 CCTGGGTGTGGTCCACTATGACC 0: 1
1: 0
2: 0
3: 12
4: 68
Right 961008590 3:123421543-123421565 AGCCATGGGGAGTTCTCACAGGG 0: 1
1: 0
2: 2
3: 14
4: 133
961008583_961008592 30 Left 961008583 3:123421511-123421533 CCTGGGTGTGGTCCACTATGACC 0: 1
1: 0
2: 0
3: 12
4: 68
Right 961008592 3:123421564-123421586 GGCAATTGCTCCCTGTACCCTGG 0: 1
1: 0
2: 1
3: 7
4: 131
961008583_961008587 -4 Left 961008583 3:123421511-123421533 CCTGGGTGTGGTCCACTATGACC 0: 1
1: 0
2: 0
3: 12
4: 68
Right 961008587 3:123421530-123421552 GACCATCAGATTGAGCCATGGGG 0: 1
1: 0
2: 0
3: 13
4: 142
961008583_961008589 8 Left 961008583 3:123421511-123421533 CCTGGGTGTGGTCCACTATGACC 0: 1
1: 0
2: 0
3: 12
4: 68
Right 961008589 3:123421542-123421564 GAGCCATGGGGAGTTCTCACAGG 0: 1
1: 0
2: 2
3: 13
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961008583 Original CRISPR GGTCATAGTGGACCACACCC AGG (reversed) Intronic
913452630 1:119002303-119002325 GCACATAGTGGACCATTCCCAGG - Intergenic
921174605 1:212583296-212583318 GCTCATAGTGCACTACACTCTGG + Intronic
1062907383 10:1187847-1187869 GGACACATGGGACCACACCCTGG - Intronic
1064973296 10:21088182-21088204 GGACACAGTGTACCACATCCTGG + Intronic
1065639270 10:27765454-27765476 GGTCATAGTGGCTGAAACCCGGG - Intergenic
1067710981 10:48651042-48651064 GGATATAGTGGACCAAGCCCAGG - Intronic
1070279108 10:75036035-75036057 GGTCATAGTGGCCCCAACCTAGG - Intergenic
1070751811 10:78968315-78968337 GCCCATCGTGGACCAGACCCAGG + Intergenic
1080990878 11:37533274-37533296 GGTCTTATTGGACCCCACCCAGG - Intergenic
1081810636 11:45912154-45912176 GCTCCTTCTGGACCACACCCTGG - Intronic
1085715654 11:78870955-78870977 GGTCTTAGTAGAGCCCACCCGGG - Intronic
1104876136 12:132036125-132036147 GAGCATTGTGGAACACACCCAGG + Intronic
1113515807 13:110897190-110897212 AATCATAGTTCACCACACCCTGG + Intronic
1113635181 13:111914532-111914554 GGAGATACTGGACCACCCCCAGG + Intergenic
1121506551 14:94482095-94482117 GGTCAAACTGGACCACACCAAGG + Intergenic
1122034614 14:98938261-98938283 GGCCACACTGGACCACACTCAGG + Intergenic
1124954414 15:34350724-34350746 GGTCATAGTGGGCTTCAGCCGGG - Exonic
1124984314 15:34591432-34591454 GATGATAGTGTACCACACCCGGG - Intergenic
1127877328 15:63122293-63122315 GGGCTGAGTGGACCCCACCCGGG + Intronic
1129332702 15:74835903-74835925 GGTCATTGCTGCCCACACCCAGG - Intergenic
1130642022 15:85685757-85685779 GGGCACGGTGGATCACACCCAGG - Intronic
1133678333 16:8096921-8096943 GGCCATAGCTGACCACACCGAGG - Intergenic
1134092039 16:11396645-11396667 GGTCGTCGGGGAGCACACCCTGG - Exonic
1137927275 16:52552322-52552344 GGTCTTTGTGGACAACACCAGGG - Intergenic
1140761384 16:78112028-78112050 GGTGGTAGTGGCCCCCACCCTGG + Intronic
1140868282 16:79083299-79083321 GGTCAGGGTGAACCACACACTGG - Intronic
1141504428 16:84465298-84465320 GGTCAGAGTGGACCCCTGCCAGG + Intergenic
1142668018 17:1473491-1473513 GGGCACAGTGAGCCACACCCTGG + Intronic
1149965576 17:61160712-61160734 GATTATAGTGGACCACACTATGG + Intronic
1155468112 18:26161670-26161692 GATCATAGTGCACTACAGCCTGG - Intronic
1157718172 18:49903592-49903614 GGTCAGGGTGGAGCACACCCTGG - Intronic
1157802981 18:50635912-50635934 AGGCCTAGTGGACCACACCATGG - Intronic
1163543513 19:17926502-17926524 GGTTATAGAGGCCCACAGCCTGG - Intergenic
1163594053 19:18210736-18210758 GGTCAGAGTGGACCCCAGCCAGG + Exonic
1166689092 19:44812225-44812247 GGTCACAATGCACGACACCCGGG + Exonic
929879845 2:45826071-45826093 AGTCAAAGTAGACCCCACCCAGG + Intronic
932464423 2:71907204-71907226 GGTCTTATTGAACCAGACCCAGG + Intergenic
934991517 2:98925023-98925045 GGTCGTCCTGGACCGCACCCTGG - Intronic
938229422 2:129645754-129645776 GGAGGTAGTGGACCTCACCCTGG - Intergenic
940291171 2:152078924-152078946 AGACATGGTGGACCACACACTGG - Intronic
944311383 2:198237414-198237436 GATCATAGTGCACCACAGCCTGG + Intronic
946308596 2:218870556-218870578 GGTCCTAGTGGACCACAAGCTGG - Intronic
1175967005 20:62664786-62664808 GGTCAGAGTGGGCCAGACCCAGG - Intronic
1176008615 20:62880194-62880216 GGTCAGAGAGGACCACCCCCTGG - Exonic
1181345179 22:22214852-22214874 GGTGAGAGTGGACCTTACCCAGG + Intergenic
950536582 3:13582416-13582438 GGTCCTAGAGGCCCACAGCCTGG - Intronic
954510786 3:51123102-51123124 GGTTATGGCTGACCACACCCTGG - Intronic
957045504 3:75370990-75371012 GGTCATAGGCCACCACACTCAGG + Intergenic
961008583 3:123421511-123421533 GGTCATAGTGGACCACACCCAGG - Intronic
961684811 3:128622444-128622466 GGTCAGAGTGGACCCAAGCCTGG - Intronic
962616978 3:137136067-137136089 GGCAATAGTGGAGCACTCCCAGG + Intergenic
967598561 3:191357104-191357126 TGTCCTGGAGGACCACACCCTGG + Exonic
969662396 4:8537924-8537946 GGTCATTGTGGATCAGACCCCGG + Intergenic
972072425 4:35038414-35038436 GGGCAGAGTGGATCACTCCCCGG - Intergenic
975803825 4:78091721-78091743 GGTCATAGTGCCCTACAGCCCGG + Intronic
977265137 4:94844901-94844923 GATAATAGTGGGCCAGACCCTGG + Intronic
978850743 4:113332921-113332943 GGACATAGTGGGCCATCCCCTGG - Intronic
980848054 4:138348011-138348033 GTTAACTGTGGACCACACCCAGG + Intergenic
982398544 4:154940311-154940333 GGTCACAGTGGAATACAGCCTGG - Intergenic
983939517 4:173525391-173525413 GGTCATAGTGGACACCAGCTAGG + Intronic
990660530 5:58009315-58009337 GGTCATAGGGGAGCACAACGTGG - Intergenic
998181814 5:139951397-139951419 GGACATAGTGGATCACAGCCAGG + Intronic
1003413315 6:5885447-5885469 GGGCCTAGTGGACCACACTGAGG - Intergenic
1007398983 6:41593072-41593094 GGTCAAAGTGGACCTCAAGCTGG - Intronic
1019783488 7:2958771-2958793 TGGCAGAGTGGACCACACCAGGG + Intronic
1023880814 7:44320316-44320338 GGTCAGAGTAGACCACAAGCTGG + Intronic
1026841539 7:73671955-73671977 GGTGAGAGTGGGCCATACCCAGG + Exonic
1033501048 7:141950091-141950113 GGTCATAGTGGAACTCAGACTGG - Intronic
1033570441 7:142623139-142623161 GAGCCTAGTTGACCACACCCGGG - Intergenic
1034398978 7:150848881-150848903 TGTCACAGAGGACCACACACAGG - Intronic
1035770639 8:2143914-2143936 GGTCATTGTGGAACACATCGTGG + Intronic
1036409311 8:8484084-8484106 GATCATAGTGCACTACAGCCTGG - Intergenic
1044481863 8:92699819-92699841 GGCCAGAGTGGCCCACAGCCGGG - Intergenic
1049592417 8:143468680-143468702 GGTCATAGCAGGCCACAGCCTGG + Intronic
1053069714 9:35093965-35093987 GGCCACAGTGGTCCACACCCAGG + Exonic
1056040306 9:82658895-82658917 GGGCATAGTGGCGCACACCATGG - Intergenic
1056910713 9:90697757-90697779 TGTCATTGTGGAGCACACACTGG + Intergenic
1061325618 9:129862251-129862273 GTTAATAATTGACCACACCCAGG + Intronic
1062536779 9:137024513-137024535 GGTCAGAGTAGACCACAAGCTGG - Intronic
1196749510 X:119102442-119102464 GATCATAGTGCACTACAGCCTGG + Intronic
1198610306 X:138392314-138392336 GGCCATAGTTTACCAAACCCTGG + Intergenic