ID: 961008585

View in Genome Browser
Species Human (GRCh38)
Location 3:123421528-123421550
Sequence ATGACCATCAGATTGAGCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 135}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961008578_961008585 13 Left 961008578 3:123421492-123421514 CCTAGTCCTAAATCTAGTACCTG 0: 1
1: 0
2: 1
3: 20
4: 225
Right 961008585 3:123421528-123421550 ATGACCATCAGATTGAGCCATGG 0: 1
1: 0
2: 0
3: 7
4: 135
961008581_961008585 7 Left 961008581 3:123421498-123421520 CCTAAATCTAGTACCTGGGTGTG 0: 1
1: 0
2: 1
3: 16
4: 181
Right 961008585 3:123421528-123421550 ATGACCATCAGATTGAGCCATGG 0: 1
1: 0
2: 0
3: 7
4: 135
961008583_961008585 -6 Left 961008583 3:123421511-123421533 CCTGGGTGTGGTCCACTATGACC 0: 1
1: 0
2: 0
3: 12
4: 68
Right 961008585 3:123421528-123421550 ATGACCATCAGATTGAGCCATGG 0: 1
1: 0
2: 0
3: 7
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961008585 Original CRISPR ATGACCATCAGATTGAGCCA TGG Intronic
901037091 1:6342936-6342958 ATGACCTTGTGTTTGAGCCATGG + Intronic
901178238 1:7320821-7320843 ATGACCATCAGTTGGGCCCATGG + Intronic
903812430 1:26042218-26042240 ATGCCCATCACATAGAGGCAGGG - Intronic
907597193 1:55730919-55730941 ATGACCATAAGATGAATCCAGGG - Intergenic
910826923 1:91419208-91419230 ATGAACATAATATTGAGCAAAGG - Intergenic
913143136 1:115961947-115961969 AGGACCATCAGGTTGGGTCAGGG - Intergenic
914705830 1:150169151-150169173 ATGACCACCAGGTGGAGCCACGG - Intergenic
920954031 1:210601049-210601071 ATGACCATCAGACTGATTCTCGG - Intronic
923961101 1:239084784-239084806 AGGACCCTCAGATGGAGGCAGGG + Intergenic
1073372797 10:103005954-103005976 ATAACCATGAGCTTGAGCCCAGG - Intronic
1074702530 10:116104927-116104949 ATGACCATCAGTTTGCGCATTGG - Intronic
1074986253 10:118662540-118662562 AAGACCATCAGGTTGGGGCAGGG + Intergenic
1075203338 10:120424755-120424777 TGGGGCATCAGATTGAGCCAGGG - Intergenic
1076591534 10:131587047-131587069 ATGACCATCAAAGCTAGCCAAGG + Intergenic
1078441482 11:11372217-11372239 AGGCCCATCAGAGTGAGCAAAGG - Intronic
1080923388 11:36731200-36731222 AAGACCATCAGGTGGAGGCAGGG - Intergenic
1082858436 11:57830070-57830092 ATGAGAATCAGGTTGAGCCAGGG - Intergenic
1086452708 11:86932984-86933006 CTGACCCTCAGATTGTGCCAGGG - Intronic
1086661409 11:89423525-89423547 ATGACTAACACATTGAACCAAGG - Intronic
1086825415 11:91489800-91489822 AGGACCATCAGGTTGAGGCAGGG + Intergenic
1087902475 11:103657211-103657233 ATGACCAACAGATAAAACCAGGG - Intergenic
1088413780 11:109567199-109567221 AAGATCATCAGATGGAGGCAGGG + Intergenic
1088899508 11:114104593-114104615 ATGACTATCAGATTCAGTGAAGG + Intronic
1090582304 11:128173527-128173549 ATGTACATCATATTGCGCCAGGG + Intergenic
1091778940 12:3201797-3201819 AGGTCCATCGGCTTGAGCCAGGG - Intronic
1093010533 12:14102045-14102067 AGGACCATCAGGTTGGGGCAGGG - Intergenic
1093664293 12:21793996-21794018 ATAATCATCAGATTGAACCAAGG - Intergenic
1095094757 12:38140609-38140631 AGGACCATCAAGTTGAGACATGG - Intergenic
1095166164 12:38974560-38974582 GTGACCATCAGGTTGATCAAAGG - Intergenic
1096537954 12:52287358-52287380 ATGAGCATCAGAGAGACCCAGGG - Intronic
1096538473 12:52289959-52289981 ATGACCACTAGATTGACCGAGGG - Intronic
1096540306 12:52303405-52303427 ATGACCACTAGATTGACCGAGGG + Intronic
1098475170 12:70892740-70892762 ATGGCCAGCAGATTGAGAGACGG + Exonic
1098832061 12:75375220-75375242 ATGACCACAAGATTCATCCAGGG + Intronic
1102171747 12:110847746-110847768 ATGTGGATCATATTGAGCCAGGG - Intronic
1105314456 13:19244350-19244372 AGGACCATCAGGTTGGGGCAGGG - Intergenic
1106848075 13:33759273-33759295 AAAACCATAACATTGAGCCAAGG - Intergenic
1108825557 13:54408300-54408322 AGGACCATCAGATGGGGTCAGGG - Intergenic
1109047933 13:57437580-57437602 AGGACCATCAGGTGGGGCCAGGG + Intergenic
1110375963 13:74794258-74794280 AAGACCACCAGATGGAGGCAGGG + Intergenic
1113534947 13:111058688-111058710 AAGACCATCAGGTGGAGGCAGGG + Intergenic
1116326599 14:43538622-43538644 AGGACCAGCAGGTTGAGACAGGG - Intergenic
1126333361 15:47558344-47558366 ATGAGCATCAGCTTCAGACAAGG - Intronic
1126577511 15:50211018-50211040 AGGACCATCAGGTGGGGCCAGGG - Intronic
1131520981 15:93114754-93114776 ATGACCTTCAGACTGGGGCATGG + Intergenic
1134295696 16:12943646-12943668 CTGAGCATCAGATTGAGCTCTGG + Intronic
1140228219 16:73096020-73096042 AAGACGATGTGATTGAGCCAAGG + Intergenic
1145230157 17:21168059-21168081 ATGACCATGAGAGCTAGCCATGG - Intronic
1145905194 17:28512454-28512476 CTCACCATCAGACTCAGCCATGG + Intronic
1156212602 18:34962249-34962271 ATGACCATAACCTTGAACCAGGG + Intergenic
1156757656 18:40548451-40548473 AAGAACTTCAGAGTGAGCCATGG + Intergenic
1158377215 18:56884676-56884698 AAGACCATCAGGTTGGGGCAGGG - Intronic
1159906563 18:74097643-74097665 AGGACCATCAGGTGGAGACAGGG - Intronic
1163628938 19:18406832-18406854 ATGACCATGAGTCTGGGCCAGGG + Intergenic
928844415 2:35652997-35653019 ATGACTTTCAGATTGAGGTATGG - Intergenic
930469605 2:51795513-51795535 AAGACCATCAGTTTGGGGCAGGG - Intergenic
931997111 2:67849273-67849295 ATGAACATCAGGTTGATCCCTGG + Intergenic
936164462 2:110107574-110107596 AGGACCATCAGATAGGGGCAGGG - Intronic
938911535 2:135889781-135889803 ATGACCATAAGTTTGAGCTGAGG + Intergenic
940431351 2:153593462-153593484 AGGACCATCAGGTTGGGGCAGGG - Intergenic
941063037 2:160869463-160869485 CTGTCCATCAGATGAAGCCAAGG + Intergenic
941702124 2:168614754-168614776 AGGACCATCAGGTTGGGGCAAGG - Intronic
944602125 2:201313594-201313616 AGGACCATCAGGTTGGGGCAGGG - Intronic
945661779 2:212694931-212694953 ATGATCATCAGTTTGAGAGAGGG - Intergenic
945718177 2:213384370-213384392 ATGACCATCAGATGGGTTCATGG + Intronic
948270156 2:236667837-236667859 GAGAACATCAGATGGAGCCAAGG - Intergenic
1169942358 20:10950874-10950896 GTTAGCATGAGATTGAGCCATGG + Intergenic
1172145310 20:32753492-32753514 ATGTCCAACAGAGTGAGGCATGG + Intergenic
1175509688 20:59515457-59515479 GTGACCCTCGGACTGAGCCACGG - Intergenic
1184039429 22:41934236-41934258 AACACCATCAGATTGAGGCCAGG + Intergenic
1184647828 22:45905814-45905836 CAGACCATCAGCTTGAGCCGGGG - Intergenic
952970231 3:38646051-38646073 GTGTCCATTAGATCGAGCCATGG - Intronic
956821900 3:72961560-72961582 TTGACAATCAGGTTGGGCCATGG - Intronic
958787410 3:98612990-98613012 AAGACCATCAGGTTGGGGCAGGG + Intergenic
961008585 3:123421528-123421550 ATGACCATCAGATTGAGCCATGG + Intronic
961773721 3:129268885-129268907 ATGACCAACAGCTGGAGTCACGG - Intronic
962086816 3:132199988-132200010 AAGCCCATCAGAGTGGGCCATGG - Intronic
962764585 3:138549595-138549617 AGGACCATCATGTTGGGCCAGGG - Intronic
962830432 3:139134419-139134441 ATGGCCATCAGCTGGATCCACGG - Intronic
964690810 3:159447696-159447718 GTAACCATCATATTGAGCCTGGG - Intronic
965216877 3:165874829-165874851 AGGACCATCAGGTTGGGGCAGGG + Intergenic
969062071 4:4444355-4444377 ATGACCATCAGTTTGACCTCTGG + Intronic
975951023 4:79771678-79771700 AAGACCATCAAGTTGAGGCAGGG - Intergenic
976230995 4:82842795-82842817 GTGACCACCAGATGGAACCAGGG + Intronic
977762768 4:100759233-100759255 ATTACCATCAGGTGGGGCCAGGG - Intronic
978821179 4:112968388-112968410 ATGGCCATCATCTTCAGCCAAGG - Intronic
986372601 5:7094799-7094821 GGGACCAGCAGAATGAGCCATGG + Intergenic
987074605 5:14369239-14369261 AAGACCATAAGAAGGAGCCATGG - Intronic
987284005 5:16438187-16438209 ATGACCACCAGGTGGATCCATGG + Intergenic
987436888 5:17905835-17905857 AAGACCATCAGATGGGGGCAGGG + Intergenic
990243522 5:53838946-53838968 ATGACCATCATGTTGGGGCAGGG - Intergenic
990864678 5:60367693-60367715 ATGACAAGCATACTGAGCCAGGG - Intronic
991151643 5:63377514-63377536 ATAATCATCAGATTCACCCAAGG + Intergenic
991638676 5:68732273-68732295 ATGACCCTCAGAGTGCTCCAAGG + Intergenic
995317896 5:110797265-110797287 AGGACCATCAGATGGGGACAGGG + Intergenic
996124135 5:119706048-119706070 AGGACCATCAGGTGGAGGCAGGG + Intergenic
1000022105 5:157327057-157327079 ATGACCATGAGATGGGGCAAAGG - Intronic
1002985739 6:2189458-2189480 ATGACCATCAGAATCAGCTGGGG + Intronic
1004031974 6:11879569-11879591 ATTTCCGTCATATTGAGCCAGGG + Intergenic
1005191420 6:23228431-23228453 AGGACCATCAGATTGGGGCAGGG + Intergenic
1005197761 6:23309184-23309206 AAGACCATGAAATTGACCCAAGG - Intergenic
1005441602 6:25875174-25875196 ATGAGCATTAGAGTCAGCCATGG + Intronic
1005691760 6:28313262-28313284 AAGACCATAAGAGTGCGCCAAGG - Intergenic
1011319971 6:86080435-86080457 ATGACCATTAGATGGGGTCAGGG + Intergenic
1014474546 6:121856278-121856300 TTGACCATCAAAATGAGCCTAGG - Intergenic
1016824582 6:148376633-148376655 AAGAGCATCACATTGAGCCCAGG + Intronic
1016851280 6:148621684-148621706 AGGACCATTAGAAGGAGCCAAGG + Intergenic
1017037710 6:150281399-150281421 ATGACCTTCAGATAGGGTCAAGG - Intergenic
1018596747 6:165488955-165488977 AAGACCATCAGGTGGAGGCAGGG - Intronic
1021483036 7:21139135-21139157 TAGACCATCAGGTTCAGCCATGG + Intergenic
1021496966 7:21285893-21285915 AAATCCATCAGATTGAGCCCTGG + Intergenic
1022671699 7:32462027-32462049 ATGACCAACAGGATGGGCCAAGG + Intergenic
1028261696 7:88674245-88674267 AAGACCATCGGATGGAGGCAGGG - Intergenic
1028792861 7:94873351-94873373 AAGACCATCAGGTGGAGGCAAGG + Intergenic
1030455813 7:109772676-109772698 AAGACCATCAGGTTGGGGCAGGG - Intergenic
1031866919 7:127047600-127047622 AGGAGTATCAGATTGAGCCCAGG + Intronic
1033769557 7:144534311-144534333 ATGGCCATGACTTTGAGCCAAGG - Intronic
1034705474 7:153139410-153139432 AGGACCATCAGATGGGGGCAGGG + Intergenic
1038056639 8:23864734-23864756 ATGAGAATCAGACTGAGCCTGGG + Intergenic
1042304130 8:67313874-67313896 AGGACCATCAGGTGGAGGCAGGG + Intronic
1043925717 8:86034446-86034468 ATGACCTTCAATTTGAGGCAGGG - Intronic
1043941406 8:86199432-86199454 ATGTCCATCATTTTTAGCCACGG - Intergenic
1044227620 8:89737053-89737075 AGGACCATCAGGTTGGGGCAGGG - Intergenic
1045382537 8:101641675-101641697 ATAACCACCACATTGTGCCAGGG + Intronic
1047781483 8:128115186-128115208 ATAACCATTAGATTCATCCATGG + Intergenic
1052859296 9:33427059-33427081 ATGACCATCAAGGTGACCCAGGG + Intergenic
1053908904 9:42875290-42875312 ATGGAGATCAGAGTGAGCCAAGG - Intergenic
1057003837 9:91538095-91538117 AGGACCATCAGATGGGGGCAGGG - Intergenic
1057068025 9:92073311-92073333 ATCAGCATAAGATTGAGCTAGGG - Intronic
1057494833 9:95552938-95552960 ATGAACATCAAATGGATCCACGG + Intergenic
1058133068 9:101275407-101275429 ATCAGCATCATATTGAGACACGG + Intronic
1058312472 9:103521344-103521366 ATGAACATCAAATTTAGCAAAGG + Intergenic
1058396249 9:104557292-104557314 AAGACCATCAGGTAGAGGCAGGG - Intergenic
1060506632 9:124202727-124202749 TTGACAATCAGATAGGGCCAGGG - Intergenic
1188160919 X:26801122-26801144 ATGACCATAATATTGAGATATGG + Intergenic
1188738000 X:33742047-33742069 AGGACCATCAGGTTGGGGCAGGG + Intergenic
1191021071 X:55860573-55860595 AAGCCCATCATATAGAGCCAAGG - Intergenic
1191100310 X:56719471-56719493 AGGACCATCAGGTGGAGCCACGG - Intergenic
1191586067 X:62827949-62827971 AAGAATATCAGAGTGAGCCAGGG - Intergenic
1192994547 X:76498936-76498958 AAGACCATCAGGTGGGGCCAGGG + Intergenic
1193791654 X:85821902-85821924 AGGACCATCAGGTTGGGGCAGGG - Intergenic
1195061863 X:101203956-101203978 ATGACTAGCAGCCTGAGCCAAGG - Intergenic
1198513651 X:137381171-137381193 GTGACCATGAGTTTGAGCCCAGG + Intergenic