ID: 961008586

View in Genome Browser
Species Human (GRCh38)
Location 3:123421529-123421551
Sequence TGACCATCAGATTGAGCCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 88}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961008581_961008586 8 Left 961008581 3:123421498-123421520 CCTAAATCTAGTACCTGGGTGTG 0: 1
1: 0
2: 1
3: 16
4: 181
Right 961008586 3:123421529-123421551 TGACCATCAGATTGAGCCATGGG 0: 1
1: 0
2: 0
3: 6
4: 88
961008578_961008586 14 Left 961008578 3:123421492-123421514 CCTAGTCCTAAATCTAGTACCTG 0: 1
1: 0
2: 1
3: 20
4: 225
Right 961008586 3:123421529-123421551 TGACCATCAGATTGAGCCATGGG 0: 1
1: 0
2: 0
3: 6
4: 88
961008583_961008586 -5 Left 961008583 3:123421511-123421533 CCTGGGTGTGGTCCACTATGACC 0: 1
1: 0
2: 0
3: 12
4: 68
Right 961008586 3:123421529-123421551 TGACCATCAGATTGAGCCATGGG 0: 1
1: 0
2: 0
3: 6
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961008586 Original CRISPR TGACCATCAGATTGAGCCAT GGG Intronic
901005980 1:6171698-6171720 TCCCCACCAGATGGAGCCATAGG - Intronic
901037092 1:6342937-6342959 TGACCTTGTGTTTGAGCCATGGG + Intronic
901178239 1:7320822-7320844 TGACCATCAGTTGGGCCCATGGG + Intronic
912220828 1:107673266-107673288 TGATGAACAGATTGAGCCTTTGG - Intronic
912436408 1:109665015-109665037 TGACCATCACATTATGCCACAGG - Intronic
914736528 1:150422744-150422766 TGATGATCATATTGAACCATGGG + Intronic
922558867 1:226552763-226552785 TAATCATCAGTTTGAGCCTTGGG - Intronic
924623271 1:245680490-245680512 TTACCATGTGATTGAGTCATGGG + Intronic
1069777781 10:70936863-70936885 AGACCATCAGATAGGGCTATGGG - Intergenic
1073338194 10:102726448-102726470 TGGTCATCAGATTGAGCAACTGG - Intronic
1074702529 10:116104926-116104948 TGACCATCAGTTTGCGCATTGGG - Intronic
1092967073 12:13654470-13654492 AGACCATCAGAGTCAGCAATGGG - Intronic
1095094756 12:38140608-38140630 GGACCATCAAGTTGAGACATGGG - Intergenic
1095166163 12:38974559-38974581 TGACCATCAGGTTGATCAAAGGG - Intergenic
1096443920 12:51671232-51671254 TGAGCATCAGTGTGAGCTATTGG + Intronic
1100064008 12:90617992-90618014 TGATCATTAAATTGAGCCAATGG - Intergenic
1100817779 12:98402467-98402489 CAACCATCAGACTGAGCCTTCGG + Intergenic
1101777631 12:107808166-107808188 TGAGCATCAGAGTGAGCTCTTGG - Intergenic
1107162191 13:37243437-37243459 TGACAATCAGCTGGAGACATTGG + Intergenic
1107284874 13:38779780-38779802 TGATCATCAGATTTAGCAAATGG - Intronic
1114253427 14:20981196-20981218 TGATCATCACATTGAGCTAATGG + Intergenic
1114921456 14:27336344-27336366 TGAGAATCAGATTGAGCAATCGG - Intergenic
1115961150 14:38837184-38837206 TGAACATCAGATTGATTCCTGGG - Intergenic
1117765701 14:59079915-59079937 TGACCTTCAGATGTGGCCATAGG - Intergenic
1118404413 14:65409725-65409747 TAACCATCAGCTAGAGCTATGGG - Intergenic
1118560357 14:67073288-67073310 TGACCAACAAATTCACCCATTGG + Intronic
1122802645 14:104239352-104239374 TGATCACCAGCTTGAGCCAAAGG - Intergenic
1124250452 15:28103673-28103695 TGCCCACCAGATTGGCCCATGGG - Intergenic
1131520982 15:93114755-93114777 TGACCTTCAGACTGGGGCATGGG + Intergenic
1144302028 17:13930241-13930263 TGACCAAAAGATTGATCCTTTGG - Intergenic
1144335289 17:14263358-14263380 TGTCAATCTGACTGAGCCATGGG + Intergenic
1150284013 17:63945404-63945426 TGACCTTGACATTGAGCCAGCGG + Exonic
1153949125 18:10043320-10043342 TGACCATCACATAGATGCATTGG + Intergenic
1160284091 18:77523210-77523232 GGACCACCAGGCTGAGCCATGGG + Intergenic
1161876675 19:6917170-6917192 TGACAACCAGATTGGCCCATAGG + Intronic
925129902 2:1487431-1487453 TGAGGATAAGATTGAGCTATTGG + Intronic
925678254 2:6389033-6389055 TGCCCATCACATTCAGACATTGG - Intergenic
925693948 2:6554319-6554341 TGACCCTCCGATGGAGCCATTGG + Intergenic
931997112 2:67849274-67849296 TGAACATCAGGTTGATCCCTGGG + Intergenic
932156337 2:69421430-69421452 TGGCAATCAGATTGAGGCTTCGG + Intronic
935637172 2:105258249-105258271 TGACCATCACATTCATCCAGTGG - Intergenic
942357725 2:175137017-175137039 TGACCATAAGGTGAAGCCATTGG - Intronic
942593312 2:177568706-177568728 TGAGGATCAGACTAAGCCATTGG + Intergenic
946495316 2:220190633-220190655 TGACCACCAGATTCAGCTAATGG + Intergenic
948270155 2:236667836-236667858 AGAACATCAGATGGAGCCAAGGG - Intergenic
1169394131 20:5214762-5214784 TGACCATCAGAGTTGGCTATCGG + Intergenic
1170486385 20:16820758-16820780 TTACTATAAGATTAAGCCATAGG - Intergenic
1171164827 20:22960423-22960445 TGACCTTCAGACTGAGGCAATGG - Intergenic
1178583191 21:33853083-33853105 TAGCCATCAAATTGACCCATGGG - Intronic
1181787514 22:25237731-25237753 TGACCATCTGTATGAGCCTTGGG + Intergenic
1183457543 22:37930813-37930835 TGACCAGCAGATGGAGTCAGAGG - Intronic
949390116 3:3552202-3552224 ATTCCATCAGACTGAGCCATAGG - Intergenic
952099323 3:29993431-29993453 TGACCATTTGACTGAGCCACAGG + Intronic
956821899 3:72961559-72961581 TGACAATCAGGTTGGGCCATGGG - Intronic
957754108 3:84465262-84465284 TAACCATCACATTGACCCACTGG - Intergenic
960039405 3:113134365-113134387 TGAATATCAGATGGAGCTATAGG + Intergenic
961008586 3:123421529-123421551 TGACCATCAGATTGAGCCATGGG + Intronic
961307264 3:125967480-125967502 TGACCAACAGAGTGTGCCTTAGG - Intergenic
964940037 3:162147955-162147977 TGAGAACCAGATTGAGCTATAGG + Intergenic
970244351 4:14043525-14043547 TGGGCATCAGATTGATACATTGG + Intergenic
975259919 4:72286408-72286430 TGACCATGAGAGGGAGACATAGG - Intronic
977654106 4:99502398-99502420 GGGCCATCAGAGTGAGACATTGG - Intergenic
977724101 4:100274689-100274711 TGAACATTAGATTTAGCCATTGG - Intergenic
979118990 4:116868829-116868851 CAACCTTCTGATTGAGCCATTGG + Intergenic
979551683 4:121998251-121998273 TGACCTGCAGATGGTGCCATTGG + Intergenic
979687939 4:123531426-123531448 GGACCAACTGATAGAGCCATTGG + Intergenic
981979024 4:150769446-150769468 TGACCTTCAGACTGTGCCATTGG - Intronic
982890333 4:160840881-160840903 TCACACTGAGATTGAGCCATAGG - Intergenic
987074604 5:14369238-14369260 AGACCATAAGAAGGAGCCATGGG - Intronic
990103604 5:52226720-52226742 TGACTATTAGATTTAGCAATGGG - Intergenic
996311713 5:122113412-122113434 TGGCCACCAGCTTTAGCCATTGG + Intergenic
996707866 5:126515010-126515032 TGGCCACCAGCTTGAGGCATTGG + Intergenic
999350299 5:150863973-150863995 TCACCATTATCTTGAGCCATAGG + Intronic
1002166413 5:177350279-177350301 TGGCCAACAGCTTAAGCCATGGG + Intronic
1002618713 5:180471146-180471168 TGACCACCAGGTGGTGCCATTGG - Intergenic
1009851254 6:69202001-69202023 TGATGTTCAGATTGTGCCATAGG + Intronic
1010616179 6:78015330-78015352 TGGCCATCAGCTTGAGCCACTGG - Intergenic
1013661406 6:112300398-112300420 TGACCATCAGAGGGATCCACAGG - Intergenic
1015396312 6:132738361-132738383 TGACCATCAGACTTAGTAATAGG - Intergenic
1021496967 7:21285894-21285916 AATCCATCAGATTGAGCCCTGGG + Intergenic
1023757430 7:43432500-43432522 TGTCCATCAGGCTGAGCCTTTGG + Intronic
1027133023 7:75604810-75604832 TGACCACAAGTTTGAGCAATTGG - Intronic
1028399029 7:90404498-90404520 TAAGTATCAGGTTGAGCCATTGG + Intronic
1045891516 8:107163640-107163662 TGAATAACAGGTTGAGCCATAGG + Intergenic
1048067200 8:130982396-130982418 TGAGCATCAGATTGGGGCGTTGG + Intronic
1052090689 9:24323344-24323366 TGTCCACCTGACTGAGCCATGGG + Intergenic
1055986520 9:82060168-82060190 TGAGCCTCAGCCTGAGCCATAGG + Intergenic
1056794110 9:89645318-89645340 TGACCATCAGATGCAGCTACAGG - Intergenic
1060506631 9:124202726-124202748 TGACAATCAGATAGGGCCAGGGG - Intergenic
1061253168 9:129438124-129438146 TGACCTTCAGATGGAGCCCATGG + Intergenic
1194463490 X:94202156-94202178 TGACCATCAGCTAGAGCTAGTGG + Intergenic
1195667989 X:107448166-107448188 TGACTAGCAGATTTGGCCATCGG - Intergenic
1199900178 X:152165404-152165426 TGACAAACAGACTGAGCCCTTGG - Intergenic
1200749769 Y:6934178-6934200 TGACCATCAGATTGAAGCCAAGG - Intronic
1201555072 Y:15258762-15258784 TGACCTTCAGAACCAGCCATGGG + Intergenic