ID: 961008587

View in Genome Browser
Species Human (GRCh38)
Location 3:123421530-123421552
Sequence GACCATCAGATTGAGCCATG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 142}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961008578_961008587 15 Left 961008578 3:123421492-123421514 CCTAGTCCTAAATCTAGTACCTG 0: 1
1: 0
2: 1
3: 20
4: 225
Right 961008587 3:123421530-123421552 GACCATCAGATTGAGCCATGGGG 0: 1
1: 0
2: 0
3: 13
4: 142
961008583_961008587 -4 Left 961008583 3:123421511-123421533 CCTGGGTGTGGTCCACTATGACC 0: 1
1: 0
2: 0
3: 12
4: 68
Right 961008587 3:123421530-123421552 GACCATCAGATTGAGCCATGGGG 0: 1
1: 0
2: 0
3: 13
4: 142
961008581_961008587 9 Left 961008581 3:123421498-123421520 CCTAAATCTAGTACCTGGGTGTG 0: 1
1: 0
2: 1
3: 16
4: 181
Right 961008587 3:123421530-123421552 GACCATCAGATTGAGCCATGGGG 0: 1
1: 0
2: 0
3: 13
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961008587 Original CRISPR GACCATCAGATTGAGCCATG GGG Intronic
901037093 1:6342938-6342960 GACCTTGTGTTTGAGCCATGGGG + Intronic
901133132 1:6975192-6975214 CACCATCAGTGTGAGCCTTGGGG + Intronic
901178963 1:7326843-7326865 GAACATCAGAATCAGCCCTGAGG + Intronic
901326179 1:8366570-8366592 GGCCTTCAGATGGAGCCAGGTGG - Intronic
903047199 1:20573781-20573803 GACCTTAAGACTGAGCTATGAGG + Intergenic
908676362 1:66608682-66608704 GAAAATCAGAATGAGCCAAGGGG - Intronic
916672571 1:167036222-167036244 GACCATTTGATTTAGCAATGTGG - Intergenic
917144884 1:171879049-171879071 GAGCAGCAGATTGAATCATGAGG - Intronic
918484987 1:185019210-185019232 GACCATGAGATTTAACCACGTGG - Intergenic
920161660 1:204003188-204003210 CAACAGCAGAGTGAGCCATGTGG + Intergenic
923181461 1:231523993-231524015 GACGATCAGATTTTGCAATGCGG + Intergenic
1065969099 10:30791775-30791797 GAATATCAGACTCAGCCATGTGG + Intergenic
1066281951 10:33926326-33926348 GACCATCAGATTAAGGCTGGAGG - Intergenic
1066647105 10:37621158-37621180 GACCATCAGATAAAGCTATATGG + Intergenic
1086872545 11:92056034-92056056 GACCCTCAGCTTTAGCAATGTGG - Intergenic
1087223997 11:95577630-95577652 GACCATCAGATTTAGGTCTGAGG + Intergenic
1087750499 11:102002131-102002153 GGCCACCAGCTTGAGCCATCTGG - Intergenic
1088490371 11:110381038-110381060 GACCATGACATTTAGCTATGTGG + Intergenic
1089198517 11:116709575-116709597 GACCAGGAGACTGAGACATGTGG - Intergenic
1090196708 11:124822608-124822630 GACTATTGGATTTAGCCATGTGG - Intergenic
1090223016 11:125047160-125047182 GACCATTAGATTTAGCAATGTGG - Intergenic
1096163426 12:49400215-49400237 GACCATCAGATTTAGTAATTTGG + Intronic
1096462907 12:51832480-51832502 GAGCATCAGATTCAGCTGTGTGG - Intergenic
1098340820 12:69449278-69449300 GACCATTACATTTAGCAATGTGG + Intergenic
1098393766 12:69996851-69996873 GGCCAACAGAGTGAGCCGTGAGG + Intergenic
1100817780 12:98402468-98402490 AACCATCAGACTGAGCCTTCGGG + Intergenic
1101003356 12:100378339-100378361 GACCTTTGGACTGAGCCATGAGG + Intronic
1102261223 12:111444694-111444716 GCCCATCAGATTAAGCTATATGG - Intronic
1104076314 12:125392919-125392941 GTACATCAGACTGAGCCCTGGGG + Intronic
1106373728 13:29163352-29163374 TATGAGCAGATTGAGCCATGTGG + Intronic
1111570923 13:90085089-90085111 AACCATTAGATTTAGCCATATGG + Intergenic
1116543590 14:46134082-46134104 GCCCATTAGATTTAGCAATGTGG + Intergenic
1117365202 14:55020314-55020336 CACCATTAGATTTAGCAATGTGG - Intronic
1118404412 14:65409724-65409746 AACCATCAGCTAGAGCTATGGGG - Intergenic
1120161917 14:81155072-81155094 GACCATTAGATTTAGCCATATGG - Intergenic
1122127921 14:99589152-99589174 GATCAACAGAGTGAGCCCTGAGG + Intronic
1122127933 14:99589210-99589232 GATCAACAGAGTGAGCCCTGAGG + Intronic
1122275727 14:100589773-100589795 GGCAACGAGATTGAGCCATGGGG - Intergenic
1124119484 15:26876549-26876571 GATCTTCAGATTTGGCCATGTGG + Intronic
1125294730 15:38190479-38190501 GACCATTAGATTTAGCAATGTGG - Intergenic
1127228496 15:56961627-56961649 GACCAGCAGTTTGAAACATGAGG - Intronic
1131520983 15:93114756-93114778 GACCTTCAGACTGGGGCATGGGG + Intergenic
1132308498 15:100836821-100836843 TTTCATCAGATTGAGTCATGTGG + Intergenic
1132835589 16:1951301-1951323 GACCAGCAGTCTGAGCCATGTGG - Intronic
1136618564 16:31413116-31413138 GGCCATGAGATTCAGCCCTGTGG + Exonic
1138413519 16:56858181-56858203 GACCAAGAAATTGAGCCTTGAGG - Intergenic
1140600263 16:76467489-76467511 GACCTTCAGATAGACTCATGTGG + Exonic
1141704674 16:85658253-85658275 GCCCTTCAGAGTGAGCCCTGGGG - Intronic
1141780770 16:86159170-86159192 GACCGTCAAACTGAGCCCTGAGG + Intergenic
1143276489 17:5715176-5715198 GACCATCAGACAGAGCCAGATGG + Intergenic
1143759195 17:9088782-9088804 GAACAACAGATTGAACCCTGAGG - Intronic
1144335290 17:14263359-14263381 GTCAATCTGACTGAGCCATGGGG + Intergenic
1150741726 17:67784486-67784508 GGCCACCAGCTTGAGCCATTTGG - Intergenic
1153080832 18:1222556-1222578 AACCATCAGATTTAGCAGTGTGG - Intergenic
1158817712 18:61122834-61122856 GACCTTCTGATTGAGCCGTCAGG + Intergenic
1158845366 18:61436724-61436746 GAACCTCAGATTGTACCATGTGG + Intronic
1159672468 18:71238965-71238987 GGCCACCAGCTTGAGCCATTTGG - Intergenic
1160284092 18:77523211-77523233 GACCACCAGGCTGAGCCATGGGG + Intergenic
1164148877 19:22532071-22532093 GTCCCCCAGATTGAGACATGAGG + Intronic
1164328142 19:24220838-24220860 AACCTTTAGATTGAGCCATTTGG - Intergenic
929094922 2:38254378-38254400 GACAATCAGAGTGAGCAAGGTGG + Intergenic
930727163 2:54693498-54693520 GGCCATCAGATTGAAGCAGGGGG + Intergenic
930745631 2:54880534-54880556 GAGCAGCAGATGGAGGCATGAGG + Intronic
931367992 2:61636108-61636130 GATCCTCAGAAAGAGCCATGTGG + Intergenic
931710271 2:64983757-64983779 ATCCTTCAGATTGATCCATGTGG + Intergenic
933657514 2:84901885-84901907 GAACATCAGAAAGAACCATGTGG + Intronic
933711896 2:85332900-85332922 GACAATCAAATTTAGCAATGGGG + Intergenic
936094456 2:109521279-109521301 GACCTTCAGATGAAGCCAAGAGG + Intergenic
938043151 2:128092908-128092930 GGCCAACAGAATGTGCCATGTGG - Intronic
938739861 2:134220835-134220857 CACCATCAGAATGAGCAATGAGG - Intronic
939536298 2:143434454-143434476 AACCTTCAGAATGAGCCATTTGG + Intronic
940225389 2:151395856-151395878 TCCAATCAGATTGAGCCCTGGGG - Intergenic
943801125 2:192059374-192059396 GACCATTAGAGTGGACCATGGGG + Intronic
947913596 2:233818258-233818280 GACCATCAGAGGGAGCAGTGAGG + Intronic
948270154 2:236667835-236667857 GAACATCAGATGGAGCCAAGGGG - Intergenic
1169069298 20:2712903-2712925 GACCATTAGATTTAGCAATGAGG + Intronic
1169260444 20:4134566-4134588 GACCATCGGATTTGGCCACGTGG + Intronic
1170532349 20:17307407-17307429 GGTCATAAGAATGAGCCATGGGG + Intronic
1171523640 20:25793863-25793885 GACAATCAGCTAGAGCCACGTGG + Intronic
1171531388 20:25855822-25855844 GACAATCAGCTAGAGCCACGCGG + Intronic
1171553187 20:26062020-26062042 GACAATCAGCTAGAGCCACGTGG - Intergenic
1171940366 20:31323099-31323121 GACTATCAGACTGAGCAATGAGG - Intergenic
1172892773 20:38278608-38278630 AAACATCAGAATGATCCATGGGG + Intronic
1175639928 20:60620483-60620505 GACCATTGGATTTAGCAATGGGG + Intergenic
1175781363 20:61684295-61684317 GACCATGCGACTGAGCCCTGTGG + Intronic
1176687773 21:9866715-9866737 AACTATCATATTTAGCCATGTGG - Intergenic
1179911002 21:44448855-44448877 CACCATCAGATTGTGACAGGAGG + Intergenic
1182613681 22:31570947-31570969 GACCTTTGGATTGAGCGATGTGG + Intronic
1184690052 22:46113443-46113465 TGCCTTCAGATTGTGCCATGTGG - Intronic
1184948833 22:47824780-47824802 GTGCATTAGATTGAACCATGTGG - Intergenic
949772744 3:7596656-7596678 GAGCATCCAATTGAGCAATGGGG + Intronic
950073384 3:10170239-10170261 GAACATCAGATTCAGAGATGAGG - Intronic
950830544 3:15871322-15871344 GACCATTGGATTAGGCCATGTGG + Intergenic
955025533 3:55163958-55163980 CACCATCAGAGTGGACCATGAGG - Intergenic
956692099 3:71887993-71888015 GACCATTAAATTTAGCCATGTGG - Intergenic
961008587 3:123421530-123421552 GACCATCAGATTGAGCCATGGGG + Intronic
965878033 3:173352128-173352150 GGCCAACAGCTTGAGCCATTTGG + Intergenic
966389317 3:179435210-179435232 GATCATTAGATTGAGCAAAGAGG - Intronic
968442588 4:631668-631690 GACCCTCAGATGGAGCCACATGG - Intronic
973757254 4:54087550-54087572 GAGCATCAGGGTGAGCCAAGAGG - Intronic
975598291 4:76071606-76071628 GACCATTGGATTTAGCAATGTGG - Intronic
979687940 4:123531427-123531449 GACCAACTGATAGAGCCATTGGG + Intergenic
979744406 4:124193137-124193159 AGCCATCACATTGAGGCATGAGG - Intergenic
980351126 4:131684518-131684540 AACGATCATATTTAGCCATGTGG - Intergenic
982549571 4:156780818-156780840 GACCATTGGATTCAGCCATGTGG - Intronic
983926812 4:173411515-173411537 TATCCTCAGATTGAGCAATGTGG - Intergenic
984304528 4:177970609-177970631 AACCATTAGAATGAGGCATGAGG - Intronic
985844913 5:2336822-2336844 GACCCTCAGAGAGAGCCAGGAGG + Intergenic
986888111 5:12265708-12265730 GGCCACCAGCTTGAGCCATTTGG - Intergenic
987963793 5:24846335-24846357 GAACATCATCTTGAGCCATAAGG - Intergenic
996693857 5:126371013-126371035 GACCAACAGGGTGAGCAATGTGG - Intronic
1000863291 5:166482743-166482765 AACCCTCAGATTCATCCATGAGG + Intergenic
1002365165 5:178704271-178704293 CACCATCACATTAGGCCATGGGG - Intergenic
1004290022 6:14358332-14358354 TAGCATCAAATTGAGACATGTGG + Intergenic
1005691758 6:28313260-28313282 GACCATAAGAGTGCGCCAAGGGG - Intergenic
1010616178 6:78015329-78015351 GGCCATCAGCTTGAGCCACTGGG - Intergenic
1011587535 6:88942812-88942834 GACCATTTGATTTAGCAATGTGG - Intronic
1012586536 6:100930020-100930042 GGCCATCAGCTTCAGCCATATGG + Intergenic
1014206060 6:118656538-118656560 GACCTTGATATTCAGCCATGAGG + Intronic
1016455858 6:144230144-144230166 AACCATCACATTGCACCATGAGG + Intergenic
1018259439 6:161954934-161954956 GCCTTTCACATTGAGCCATGGGG - Intronic
1020331448 7:7021249-7021271 GACCATCGGATTTTGCAATGTGG - Intergenic
1021413736 7:20358174-20358196 GATCAGGAGATCGAGCCATGTGG - Intronic
1021496968 7:21285895-21285917 ATCCATCAGATTGAGCCCTGGGG + Intergenic
1021784747 7:24140721-24140743 GGCCACCCCATTGAGCCATGTGG - Intergenic
1021797205 7:24268214-24268236 GACCACCGGCTTGAGCAATGTGG - Intergenic
1023263473 7:38381141-38381163 GGCCATCTGAATGGGCCATGGGG + Intergenic
1024883060 7:54111375-54111397 GAGCACCGGCTTGAGCCATGTGG + Intergenic
1031026282 7:116683701-116683723 GTCCATCAGATCTGGCCATGAGG - Intronic
1031636693 7:124109597-124109619 AACCACCAGTTTGAGCCATTTGG - Intergenic
1031932676 7:127702176-127702198 AACCTTCAGTGTGAGCCATGAGG + Intronic
1033780769 7:144666576-144666598 GACCATTAGATTTAGCAATATGG - Intronic
1035811739 8:2497416-2497438 GACCAGCACCTTGAGCCAGGCGG + Intergenic
1036085183 8:5605932-5605954 GACCAGCAGAGTGAGCCACACGG + Intergenic
1037745922 8:21644035-21644057 GGGCATCATATTGAGCCATGAGG + Intergenic
1038028111 8:23610221-23610243 GACCATCACATTGGGGCATAAGG + Intergenic
1043077725 8:75722984-75723006 CAACATGAGTTTGAGCCATGTGG + Intergenic
1044808194 8:96030366-96030388 GACCATTGGATTTAGCAATGTGG - Intergenic
1045857432 8:106780632-106780654 GATCATTAGATTTAGCAATGTGG - Intergenic
1047913290 8:129554424-129554446 GCCTCTCAGATTGAGACATGAGG - Intergenic
1048491802 8:134901199-134901221 TTCCATCAGCTTGAGACATGAGG - Intergenic
1052090690 9:24323345-24323367 GTCCACCTGACTGAGCCATGGGG + Intergenic
1053781584 9:41615195-41615217 AACTATCATATTTAGCCATGTGG + Intergenic
1054169532 9:61825349-61825371 AACTATCATATTTAGCCATGTGG + Intergenic
1054668006 9:67755466-67755488 AACTATCATATTTAGCCATGTGG - Intergenic
1056280232 9:85034749-85034771 GTCCACCAGCTTGAGCCATTTGG - Intergenic
1056679466 9:88704652-88704674 GGCCATCAGAATCAGCCCTGGGG + Intergenic
1060636911 9:125206573-125206595 TTCCATCAGATTGAGCTTTGGGG + Intronic
1186858433 X:13647850-13647872 GTCCATGAGAATGAGTCATGAGG + Intergenic
1192320944 X:70090134-70090156 TAGCATCAGATTGAGGAATGAGG + Intergenic
1194095501 X:89633845-89633867 TACCAGCAGATAGAGCGATGTGG - Intergenic
1195202129 X:102562246-102562268 TACACTCAGCTTGAGCCATGAGG - Intergenic
1195315765 X:103676376-103676398 GAGCATCAGGGTGAGCCAAGAGG + Exonic
1196622168 X:117836297-117836319 GAGCATCAGAATGAGCAAAGAGG - Intergenic
1197433944 X:126401382-126401404 GAATATCAGAATCAGCCATGTGG - Intergenic
1198672758 X:139099066-139099088 GACCATCATTTGTAGCCATGGGG - Intronic