ID: 961008589

View in Genome Browser
Species Human (GRCh38)
Location 3:123421542-123421564
Sequence GAGCCATGGGGAGTTCTCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 166}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961008584_961008589 -4 Left 961008584 3:123421523-123421545 CCACTATGACCATCAGATTGAGC 0: 1
1: 0
2: 0
3: 10
4: 83
Right 961008589 3:123421542-123421564 GAGCCATGGGGAGTTCTCACAGG 0: 1
1: 0
2: 2
3: 13
4: 166
961008583_961008589 8 Left 961008583 3:123421511-123421533 CCTGGGTGTGGTCCACTATGACC 0: 1
1: 0
2: 0
3: 12
4: 68
Right 961008589 3:123421542-123421564 GAGCCATGGGGAGTTCTCACAGG 0: 1
1: 0
2: 2
3: 13
4: 166
961008578_961008589 27 Left 961008578 3:123421492-123421514 CCTAGTCCTAAATCTAGTACCTG 0: 1
1: 0
2: 1
3: 20
4: 225
Right 961008589 3:123421542-123421564 GAGCCATGGGGAGTTCTCACAGG 0: 1
1: 0
2: 2
3: 13
4: 166
961008581_961008589 21 Left 961008581 3:123421498-123421520 CCTAAATCTAGTACCTGGGTGTG 0: 1
1: 0
2: 1
3: 16
4: 181
Right 961008589 3:123421542-123421564 GAGCCATGGGGAGTTCTCACAGG 0: 1
1: 0
2: 2
3: 13
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961008589 Original CRISPR GAGCCATGGGGAGTTCTCAC AGG Intronic
900776964 1:4592811-4592833 GGGCCACGGGGAGGTCTCACTGG - Intergenic
901629630 1:10641837-10641859 GAGCCACGAGGAGTTGTCCCTGG + Intronic
901853618 1:12030824-12030846 GAGTCAGGGGGAGTTGCCACTGG - Intronic
904002380 1:27346100-27346122 GAGCCAGGGGAAGTTTTCAGCGG - Intronic
907834283 1:58094156-58094178 GAGCAATGGGGTGGTGTCACTGG - Intronic
910287209 1:85569052-85569074 GATTCTTGGGGAGTTCACACAGG - Intronic
912570451 1:110617448-110617470 GAGCCATTGAGAGTTCTGAGTGG + Intronic
914995645 1:152541223-152541245 GAGCCATGGGCAGTGCTCACTGG + Intronic
917639969 1:176973897-176973919 GAGCAAAGGGGAGTTTGCACTGG - Intronic
918972703 1:191440283-191440305 GAACCATTTGAAGTTCTCACTGG - Intergenic
923195826 1:231666441-231666463 GGGCCATGGGAACTTCTCCCTGG + Intronic
923207460 1:231772866-231772888 GAGCCATGGAGAGTTCTGCCTGG - Intronic
924655573 1:245972313-245972335 GAGCCATGTGGAGTTTACAGAGG - Intronic
1063608127 10:7540918-7540940 AAGCCATGGGGTTTTCTCCCAGG - Intergenic
1065834775 10:29646744-29646766 GACCCACGGGGAGCTGTCACTGG - Intronic
1069566474 10:69466663-69466685 GAGACACTGGGAGTTCTCAGTGG + Intronic
1071816977 10:89242108-89242130 AAGTCATGGGGAGTTAGCACTGG - Intronic
1073443025 10:103564091-103564113 GGGCCATGGGGAGGTCACTCCGG + Intronic
1074065421 10:110008429-110008451 GGGCCAAGGGGACTTCTCATTGG + Intronic
1074941160 10:118236906-118236928 GGGCGATGGGGAGGTCTCAATGG + Intergenic
1075232933 10:120699539-120699561 GAGCCAGTGGGTGGTCTCACTGG - Intergenic
1076076050 10:127534659-127534681 GAGCCCTGGGGAGTTATCTTTGG - Intergenic
1076152976 10:128178232-128178254 GAGCCAAGGGGGGTGGTCACTGG + Intergenic
1076551333 10:131279823-131279845 GAGCTATGGGTGGTTTTCACAGG - Intronic
1076612966 10:131737872-131737894 GTGCCATGGGGGGGTGTCACTGG - Intergenic
1077075722 11:701071-701093 GAGCCCTGGAGAGTTCTGCCAGG + Intronic
1077273014 11:1690601-1690623 GGGCCATGGGGAGTTTTGACAGG + Intergenic
1077396642 11:2327090-2327112 GGGCCATGGAGAGTCCCCACAGG - Intergenic
1081680815 11:45001115-45001137 GAGCCATGGGGAGATCTGGGAGG - Intergenic
1085313679 11:75530881-75530903 GAGCCATGGGAGGGTTTCACAGG + Intergenic
1085663959 11:78395658-78395680 GAGCAGTTGGGAGTTCTGACTGG + Intronic
1088792345 11:113236915-113236937 GAGCCATGGGCATGTCCCACAGG + Intronic
1092845106 12:12577508-12577530 TAGCCTTGGGGAACTCTCACTGG - Intergenic
1092943125 12:13428868-13428890 GAGCCAGGGGTAGTTCTAAATGG + Intergenic
1093005058 12:14042519-14042541 GAGGCATGGGGAGTTTTGAATGG + Intergenic
1093272616 12:17082826-17082848 GAGCAATGGGGAGAGCACACTGG + Intergenic
1097803272 12:63938422-63938444 GAGCCATGGTGGGTTTTTACTGG + Intronic
1099994982 12:89768744-89768766 GAGGCATGGGGAGTTCAAAGTGG + Intergenic
1103575857 12:121876695-121876717 GGGCAATGGGGAGTTCTCTTTGG + Intergenic
1105255698 13:18742990-18743012 GAGCCATGGGGGCTTCCCATGGG - Intergenic
1105881267 13:24608427-24608449 CAGCCATGGTGCGTTCACACCGG - Intergenic
1112462524 13:99615134-99615156 TATCCATGGGGAGTGCTCTCAGG + Intronic
1113558640 13:111258586-111258608 GACCCATGGTGAGTTCTGCCTGG - Intronic
1113602970 13:111584209-111584231 AAGCCATGGGGTGTTGTCACGGG - Intergenic
1114457617 14:22866747-22866769 CAGCCATGGGGAGTACCCATGGG - Intergenic
1116722006 14:48509072-48509094 ATGCCATGGGGAGTTCCCACAGG + Intergenic
1118803116 14:69209180-69209202 GAGCCATGGGGAACTGTCAGAGG + Intronic
1122126623 14:99581923-99581945 AAGCCAAGGGGGGTTCACACCGG - Intronic
1122587935 14:102823508-102823530 GGGAGAGGGGGAGTTCTCACAGG + Intronic
1122830559 14:104393619-104393641 GAGCCCTGGGGTTTTCACACAGG - Intergenic
1123115894 14:105893886-105893908 GAGCCATGCGCAGTTCTGCCGGG - Intergenic
1125523627 15:40361941-40361963 GGGCCATGGGGGGTTCCCAGAGG - Intronic
1125573350 15:40737994-40738016 GAGCCATGGGGTTTTCTGGCTGG + Exonic
1127798443 15:62457575-62457597 GACCCAGGGAGAGTTCTTACTGG + Intronic
1131204620 15:90432430-90432452 GAGCCCTGGGGAGATCTGACTGG - Intronic
1132928428 16:2445620-2445642 GGGCCAAGGGGGCTTCTCACCGG - Exonic
1133906524 16:10027638-10027660 GAGACATGAGGAGTCCTCGCTGG + Intronic
1135034708 16:19067531-19067553 GAGCTAGGGGGCGTTCCCACCGG + Intergenic
1135074733 16:19383406-19383428 GGGCCATGGGGAGTGCTCATAGG - Intergenic
1136994453 16:35179827-35179849 GGGCCATTGGGAGGTCTTACAGG + Intergenic
1137700095 16:50491298-50491320 AAGGCATGGGGAGATGTCACTGG + Intergenic
1138012175 16:53392298-53392320 GAAACATGGCCAGTTCTCACTGG + Intergenic
1140961566 16:79917929-79917951 GAGCCACGGGGACTTCACAACGG - Intergenic
1141371343 16:83488970-83488992 GAGCCTTGGGAAGTCATCACTGG - Intronic
1145004291 17:19328734-19328756 GACCCATGGGGGGTGCCCACTGG + Exonic
1146906427 17:36621227-36621249 AAGCCATGGGGAGCAGTCACAGG - Intergenic
1147982406 17:44282610-44282632 GAGCTCTGGGGAGACCTCACAGG + Intergenic
1150590261 17:66556068-66556090 CAGCCATGGGGACTCCTCCCTGG + Intronic
1152191242 17:78889256-78889278 GAGCCATGGAGACCTCACACTGG - Intronic
1152254045 17:79227148-79227170 GAGCCATGGAGACTTCTTGCTGG + Intronic
1152319977 17:79603326-79603348 GAGGCATGGGGAGAGCACACCGG + Intergenic
1154018646 18:10643454-10643476 GGGCCATGGGCAGTTCTGTCAGG - Intergenic
1154185582 18:12179968-12179990 GGGCCATGGGCAGTTCTGTCAGG + Intergenic
1160911022 19:1473859-1473881 GGGCCCTAGGGACTTCTCACTGG - Exonic
1162844496 19:13381918-13381940 GAGCCATGGAGGGTTCTGAGGGG + Intronic
1163345565 19:16739739-16739761 GTGCCATGGGGAGCTGTCCCCGG - Intronic
1165102916 19:33449441-33449463 GATCCATGAGGAGAGCTCACCGG + Intronic
1168297589 19:55384933-55384955 GAGCCCTGGGGAGGTGACACAGG + Intergenic
925155181 2:1643542-1643564 GAACCCTGGGGTGTTCTCCCCGG - Exonic
926429590 2:12772454-12772476 GAGGCTTGGGGAGGTCACACCGG + Intergenic
928434957 2:31248924-31248946 GAGCCAGGGGGTCTTCTCATTGG + Intronic
931388664 2:61820300-61820322 GAGCAATGGGGAATGCTCACAGG + Intergenic
931819507 2:65937082-65937104 TAGCAAAGGGGAGTTCTGACAGG + Intergenic
931942705 2:67270448-67270470 GAGCAATGGGAAGCTCTCAGAGG - Intergenic
934276786 2:91579778-91579800 GAACCATTGGGAGCCCTCACAGG + Intergenic
934651116 2:96091878-96091900 GAGCCATGGGTCGGTCGCACGGG + Intergenic
935848977 2:107198262-107198284 GAGCCATGTGGAATACTTACTGG - Intergenic
936529449 2:113265578-113265600 GAGGCATGGTGAGCTCTGACCGG - Intronic
940951952 2:159685644-159685666 TGGCCATGGGGAGTTCTCTGTGG - Intergenic
944175186 2:196821033-196821055 GAGGCAGGGGGAGATTTCACAGG + Intergenic
945289390 2:208112523-208112545 GAGGCAAGGCGAGGTCTCACAGG + Intergenic
946176761 2:217927108-217927130 CAGGCATGGGGACTTCTCAATGG - Intronic
947582867 2:231332545-231332567 GAGCCAACGGGAGCTCTCACAGG - Intronic
947687084 2:232097530-232097552 GACCCATGGGGAGTACTGCCAGG + Intronic
948588151 2:239034267-239034289 GAGCGATGGGCAGGCCTCACTGG - Intergenic
1170135667 20:13070912-13070934 GATGCTTGGGGAGTTCTCAGGGG - Intronic
1171880494 20:30614794-30614816 TAGCCATGGGGGCTTCCCACGGG - Intergenic
1175624766 20:60481253-60481275 GGGCCATGGGGAGATACCACTGG + Intergenic
1175824621 20:61930291-61930313 AAGCAATGGAGTGTTCTCACTGG + Intronic
1176268697 20:64224132-64224154 GAGCCATGGGGAGCTCCTCCTGG + Intronic
1176841717 21:13848020-13848042 GAGCCATGGGGGCTTCCCATGGG - Intergenic
1180784148 22:18537494-18537516 GAGCCAGGGAGAGTGCCCACAGG - Intergenic
1180823282 22:18846692-18846714 GAGCAACGGGGAGATCCCACAGG - Intronic
1181123708 22:20689791-20689813 GAGCAACGGGGAGATCCCACAGG - Intergenic
1181127716 22:20711543-20711565 GAGCCAGGGAGAGTGCCCACAGG - Intronic
1181189461 22:21127854-21127876 GAGCAACGGGGAGATCCCACAGG + Exonic
1181241050 22:21476846-21476868 GAGCCAGGGAGAGTGCCCACAGG - Intergenic
1181399773 22:22644303-22644325 GAGCAACGGGGAGATCCCACAGG + Intergenic
1181649638 22:24251765-24251787 GAGCAACGGGGAGATCCCACAGG - Intergenic
1183278549 22:36918476-36918498 AAGCCATGCCTAGTTCTCACTGG - Intronic
1183305356 22:37080148-37080170 CAGCCATGGCCAGATCTCACGGG + Intronic
1183564172 22:38601325-38601347 GAGCCATGGGAAGGTCTATCAGG + Intronic
1184566568 22:45295559-45295581 GGGACATGGGGAGTTCTGATGGG + Exonic
1185333602 22:50262021-50262043 GAGCCGTGGGGAGTTAGGACTGG - Intergenic
1203217207 22_KI270731v1_random:12792-12814 GAGCAACGGGGAGATCCCACAGG + Intergenic
1203273423 22_KI270734v1_random:72598-72620 GAGCAACGGGGAGATCCCACAGG - Intergenic
950095374 3:10326394-10326416 GAGCCAGGAGGGGTTCTCAGTGG - Exonic
953636705 3:44670655-44670677 AAGCTATGGGGAGTTTTCTCTGG + Intergenic
955472534 3:59300831-59300853 GTGCAATGGGAAGTTCTCAGTGG + Intergenic
956452275 3:69386307-69386329 GCGCCAGGGGGAGTCCTCGCCGG - Intronic
956968621 3:74494172-74494194 GAGCCATGGAATGTTCTGACTGG - Intronic
957041720 3:75341044-75341066 GAGCCATGGGGAGGTTTCCACGG + Intergenic
961008589 3:123421542-123421564 GAGCCATGGGGAGTTCTCACAGG + Intronic
961046432 3:123711837-123711859 GAGCCATGGGGAGGTTTCCAGGG + Intronic
961630351 3:128294153-128294175 GAGCCATTAGGGGTCCTCACTGG + Intronic
962767625 3:138580066-138580088 GACCCATGGGGAGTACTGCCAGG - Intronic
963853101 3:150227086-150227108 GAGAGATGGGGAGTTTTCAGTGG + Intergenic
966926848 3:184649982-184650004 GAGCCATGGGGAGGAGGCACAGG + Intronic
967303823 3:188041834-188041856 GAGAAATGGGGAGTTCTCAGAGG - Intergenic
968283877 3:197496861-197496883 GAGCCCTGGGAAGTACTCAGAGG + Intergenic
969608336 4:8213256-8213278 CAGCCATGGGGAGGTCTGCCAGG - Intronic
971742637 4:30539915-30539937 GAGCCATGGTGAGTGCTTTCTGG + Intergenic
973748093 4:53984351-53984373 GACTCATGGGGAGTTTTCATAGG - Intronic
974178832 4:58359519-58359541 GAGAGATGTGGAGTTATCACAGG + Intergenic
975938705 4:79613919-79613941 GAGCCATGGTTAGTTCACGCTGG + Intergenic
978715839 4:111841326-111841348 GAGCCATAGGAAATTCTCACAGG + Intergenic
979960738 4:127018234-127018256 TAGCCATGGTGAGTTCACAGAGG - Intergenic
981503301 4:145475125-145475147 GAGCAGTGGGGTTTTCTCACTGG + Intergenic
983980792 4:173994227-173994249 GAGCCATTTTGAGTTCCCACTGG - Intergenic
992005861 5:72476699-72476721 CAGCAGTGGGGAGTGCTCACAGG + Intronic
993089222 5:83403110-83403132 GAGCCATGGGGATTTTGCCCAGG - Intergenic
994226223 5:97254310-97254332 GGCCCATGGGGAGTTCTGCCAGG - Intergenic
995046221 5:107651501-107651523 GAGCCATAGGGGGTCCTCGCAGG + Intronic
995557582 5:113345119-113345141 GACCCATGGTGAGTTCTGCCAGG - Intronic
995829095 5:116334165-116334187 GAGCCAAGGGGACTTCTTATGGG + Intronic
996210193 5:120798820-120798842 GACCCATGGGGAGTACTGCCAGG - Intergenic
998238806 5:140423853-140423875 GAGTCATTAGGACTTCTCACAGG + Intronic
1003073252 6:2960904-2960926 GAGGGAGGGGGAGATCTCACGGG + Exonic
1003086176 6:3063489-3063511 GACCCATGGGGCCTTCCCACTGG + Intergenic
1005476068 6:26209233-26209255 GAGCCATGGGGAGATCACTTTGG + Intergenic
1005970551 6:30757729-30757751 GAGCTAGGGGCAGTTCTCAAGGG - Intergenic
1008159285 6:48057774-48057796 GAGCTAAGGGAAGTTCTCAGTGG + Intronic
1014186912 6:118445310-118445332 GGCCCATGGGGAGTTCTACCAGG + Intergenic
1014786584 6:125626337-125626359 GTGCCATGGGCAGTTCACACTGG - Intergenic
1019488101 7:1298718-1298740 GGGCCATGTGGATTTCTCAAAGG + Intergenic
1020429607 7:8105569-8105591 GAGCCATGCTCAGTCCTCACGGG + Intergenic
1021963721 7:25897122-25897144 AAGCCCTGAGAAGTTCTCACTGG - Intergenic
1023957571 7:44899340-44899362 GAGCCATGGTGAGTTCTCTCTGG + Intergenic
1024914428 7:54483684-54483706 GAGTAATGAGGTGTTCTCACGGG + Intergenic
1025014709 7:55429968-55429990 GAGCCACTGGGAGGGCTCACTGG + Intronic
1027514455 7:79124835-79124857 GAGCAATGGGGAATGCTCATGGG + Intronic
1028075949 7:86515278-86515300 GAGTCAGGGGTACTTCTCACGGG - Intergenic
1033357307 7:140610732-140610754 GTCCCAAGGGCAGTTCTCACAGG + Intronic
1035170395 7:157014231-157014253 CAGCCCTGGAGAGTTCTCCCTGG + Intergenic
1037095143 8:14977257-14977279 TAGCAAGGGTGAGTTCTCACCGG - Intronic
1039551284 8:38444910-38444932 GAGCCACAGGTAGTTGTCACTGG + Intronic
1043684941 8:83073035-83073057 GAGCCTTTGGGAACTCTCACAGG + Intergenic
1045567841 8:103339548-103339570 GAGCCAAGGGGAGTTTGAACTGG - Intergenic
1048972993 8:139655603-139655625 GAGAAATAGGGATTTCTCACAGG - Intronic
1049136835 8:140909785-140909807 GATCCATGGGAAGGTCTCAGTGG - Intronic
1052732930 9:32310883-32310905 GGGCCATGGGGAGTACTACCAGG - Intergenic
1053494904 9:38542878-38542900 GAGCCATGGGGGCTTCCCATGGG - Exonic
1056762386 9:89424744-89424766 GAGCCAGGTGGAGGCCTCACAGG - Intronic
1056887524 9:90457620-90457642 GAGCCATTGGGTGTTTTGACAGG - Intergenic
1060993145 9:127860436-127860458 GAGCCAGGGGGAGTTCTGGCTGG - Intergenic
1187844970 X:23525414-23525436 GGCCCATGGGGAGTTCTGCCAGG - Intergenic
1188964753 X:36537309-36537331 CCCCCATGGAGAGTTCTCACTGG + Intergenic
1193980854 X:88180507-88180529 GACCCATGGGGAGTACTGCCAGG + Intergenic
1194479314 X:94400908-94400930 GATCCATAGGGAGTTCTGCCAGG + Intergenic
1198293065 X:135257374-135257396 GGTCCATGGGGAGTTCTGTCAGG - Intronic
1198601884 X:138293030-138293052 CAGCTATGGGAAGTTCACACAGG + Intergenic
1199854182 X:151746453-151746475 GAGCAATGGGGAATTTTTACTGG - Intergenic