ID: 961008590

View in Genome Browser
Species Human (GRCh38)
Location 3:123421543-123421565
Sequence AGCCATGGGGAGTTCTCACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 133}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961008581_961008590 22 Left 961008581 3:123421498-123421520 CCTAAATCTAGTACCTGGGTGTG 0: 1
1: 0
2: 1
3: 16
4: 181
Right 961008590 3:123421543-123421565 AGCCATGGGGAGTTCTCACAGGG 0: 1
1: 0
2: 2
3: 14
4: 133
961008578_961008590 28 Left 961008578 3:123421492-123421514 CCTAGTCCTAAATCTAGTACCTG 0: 1
1: 0
2: 1
3: 20
4: 225
Right 961008590 3:123421543-123421565 AGCCATGGGGAGTTCTCACAGGG 0: 1
1: 0
2: 2
3: 14
4: 133
961008584_961008590 -3 Left 961008584 3:123421523-123421545 CCACTATGACCATCAGATTGAGC 0: 1
1: 0
2: 0
3: 10
4: 83
Right 961008590 3:123421543-123421565 AGCCATGGGGAGTTCTCACAGGG 0: 1
1: 0
2: 2
3: 14
4: 133
961008583_961008590 9 Left 961008583 3:123421511-123421533 CCTGGGTGTGGTCCACTATGACC 0: 1
1: 0
2: 0
3: 12
4: 68
Right 961008590 3:123421543-123421565 AGCCATGGGGAGTTCTCACAGGG 0: 1
1: 0
2: 2
3: 14
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961008590 Original CRISPR AGCCATGGGGAGTTCTCACA GGG Intronic
902696369 1:18143430-18143452 AGCCATGGAGAGTTCTAAGCAGG - Intronic
905266885 1:36760445-36760467 AGCCATGGGAAGTTTTCAGCAGG - Intergenic
907775516 1:57510456-57510478 AGCCATGGTGAGCTCACTCAAGG - Intronic
914995646 1:152541224-152541246 AGCCATGGGCAGTGCTCACTGGG + Intronic
916659376 1:166907337-166907359 GGCCATGGGGAATTTTCAAAAGG - Intergenic
918325204 1:183403480-183403502 AGCCATGGGGAGCCCCCACTCGG + Intronic
922593238 1:226794681-226794703 AGGCCTGAGGAGTCCTCACATGG + Intergenic
923211143 1:231805527-231805549 TGCCATAGTGAGTTATCACAAGG - Intronic
1068570117 10:58618547-58618569 AATCATGGGGAGTTGTGACATGG - Intronic
1069608775 10:69758246-69758268 AGCCATGGGCAGTATGCACACGG + Intergenic
1070661654 10:78310861-78310883 AGCCATGTAGAGAACTCACATGG - Intergenic
1073105279 10:101029353-101029375 AGCCCTGGGGAGGTGTTACAAGG - Intronic
1073434531 10:103508168-103508190 GGGCTTGGGGACTTCTCACAGGG + Intronic
1075948770 10:126459798-126459820 AGACATAGGGACTTCTGACATGG - Intronic
1076551332 10:131279822-131279844 AGCTATGGGTGGTTTTCACAGGG - Intronic
1076679301 10:132163468-132163490 AGCCAGGGGGGGTCCTCCCACGG + Intronic
1077228271 11:1447695-1447717 AGCCACGTGGAGTTCTTACCCGG + Intronic
1077273015 11:1690602-1690624 GGCCATGGGGAGTTTTGACAGGG + Intergenic
1082846073 11:57726587-57726609 AGCCATAGGGAGTCCTGCCAAGG + Intronic
1085313680 11:75530882-75530904 AGCCATGGGAGGGTTTCACAGGG + Intergenic
1086407261 11:86509073-86509095 GGCCATGGGGTGTGCCCACATGG + Intronic
1086854436 11:91849452-91849474 AGCCATGGGGAGCTCACTGAAGG - Intergenic
1088486948 11:110349871-110349893 AGCCACAGGGAGTTTCCACAAGG + Intergenic
1090253918 11:125269835-125269857 ACTTTTGGGGAGTTCTCACAAGG + Intronic
1091092182 11:132781659-132781681 AACCATGGGGTGTTCACACCTGG + Intronic
1092299155 12:7228701-7228723 AGACAAGGGGATTGCTCACAGGG + Intergenic
1092452351 12:8614649-8614671 AGCCATGGAGGGTTATGACAGGG - Intergenic
1094052804 12:26239246-26239268 AACCTTGGTGAGTTGTCACAAGG - Intronic
1101784585 12:107872123-107872145 GGCCATGGGGTCTTCCCACATGG + Intergenic
1104645634 12:130495364-130495386 ATCCCTGGGGAAATCTCACAGGG - Intronic
1104954394 12:132457382-132457404 AGCCACAGGAAGCTCTCACATGG + Intergenic
1106491075 13:30222544-30222566 ATCCAAGGGTAGCTCTCACATGG + Intronic
1107461413 13:40607119-40607141 AGACATAGGGAGATCTCACTTGG - Intronic
1107818308 13:44264066-44264088 AGCCATGGTGGGTTGTCACAAGG - Intergenic
1109742702 13:66575509-66575531 AGGCATGGGGTGATCTTACAGGG - Intronic
1112462525 13:99615135-99615157 ATCCATGGGGAGTGCTCTCAGGG + Intronic
1113602969 13:111584208-111584230 AGCCATGGGGTGTTGTCACGGGG - Intergenic
1113695751 13:112343973-112343995 AAGCAGGGGGAGTTCGCACATGG + Intergenic
1116722007 14:48509073-48509095 TGCCATGGGGAGTTCCCACAGGG + Intergenic
1118803117 14:69209181-69209203 AGCCATGGGGAACTGTCAGAGGG + Intronic
1122126622 14:99581922-99581944 AGCCAAGGGGGGTTCACACCGGG - Intronic
1122489931 14:102107811-102107833 ACCCAAGGGAAGTTCTGACAAGG + Intronic
1122830558 14:104393618-104393640 AGCCCTGGGGTTTTCACACAGGG - Intergenic
1124223583 15:27870290-27870312 TGCCATGGGGAGTGCTCACCAGG + Intronic
1124515194 15:30361983-30362005 AGCCATGGGGAGCTCTCCGAAGG + Exonic
1124727728 15:32168746-32168768 AGCCATGGGGAGCTCTCCGAAGG - Exonic
1125523626 15:40361940-40361962 GGCCATGGGGGGTTCCCAGAGGG - Intronic
1126096866 15:45096151-45096173 AGGCCTGGGGAGTAGTCACATGG + Intronic
1126546440 15:49879375-49879397 AGCCATGGGGATTTTTGACCAGG - Exonic
1126579580 15:50230673-50230695 AGGCCTGGGGAGTTCTCCAATGG - Intronic
1128239514 15:66092347-66092369 ACCCATGGGAAGTTCTAAAAGGG - Intronic
1129233480 15:74209492-74209514 AGCTAAGGGGAGTCATCACAGGG + Intronic
1133505176 16:6404750-6404772 AGCAATGTGAAGTTCTCATAAGG - Intronic
1135074732 16:19383405-19383427 GGCCATGGGGAGTGCTCATAGGG - Intergenic
1135225997 16:20658572-20658594 AGCCATGGGCAGTCCTGCCAAGG + Intronic
1136994454 16:35179828-35179850 GGCCATTGGGAGGTCTTACAGGG + Intergenic
1139266324 16:65642506-65642528 AGCCAGGGAGAGTACCCACATGG + Intergenic
1147448453 17:40489144-40489166 ACCCAAGGGAAGTTGTCACAGGG - Intronic
1147982407 17:44282611-44282633 AGCTCTGGGGAGACCTCACAGGG + Intergenic
1150211720 17:63445706-63445728 AGCCATGGGGCTTTCCCACTCGG + Intronic
1150590262 17:66556069-66556091 AGCCATGGGGACTCCTCCCTGGG + Intronic
1151519646 17:74618915-74618937 AGAAATGGGGAGTGCTCAGAAGG - Intronic
1153136331 18:1921511-1921533 AGCCATAGGGAGTCCTGCCAAGG - Intergenic
1154018645 18:10643453-10643475 GGCCATGGGCAGTTCTGTCAGGG - Intergenic
1154185583 18:12179969-12179991 GGCCATGGGCAGTTCTGTCAGGG + Intergenic
1156655859 18:39285176-39285198 GGCAATGGGGAGTTCTGTCAGGG + Intergenic
1163778725 19:19233800-19233822 AGACAAGGGTTGTTCTCACAGGG - Exonic
1163884834 19:19956444-19956466 ACCCATGGGTATTTCTCGCAAGG - Intergenic
1166844429 19:45718054-45718076 AGCCATGGCAGGTTCTCACCAGG - Intronic
1167939731 19:52936990-52937012 ACCCATGGATATTTCTCACAAGG - Intronic
1168691237 19:58378800-58378822 AGGCAAAGGGAGTTCTGACACGG + Intronic
926420741 2:12694560-12694582 AGCCATGGTGAGTTGACCCAAGG + Intergenic
927422025 2:22943728-22943750 AGGGATTGGGAGTTTTCACAGGG - Intergenic
928541128 2:32284463-32284485 TGTCATAGTGAGTTCTCACAAGG + Intronic
931328071 2:61248822-61248844 AGACACGGGGTGTTCTCAGAAGG - Intronic
931942704 2:67270447-67270469 AGCAATGGGAAGCTCTCAGAGGG - Intergenic
936426933 2:112430207-112430229 AGGCATGGGCAGTTCACAGATGG + Intronic
936789055 2:116128525-116128547 AGACATGGCAAGTTCTCAAAAGG - Intergenic
937240625 2:120460055-120460077 AGCCATGGTGGCATCTCACATGG + Intergenic
937668177 2:124510975-124510997 TGCCATGGGGACCTCTCACATGG + Intronic
939119166 2:138095508-138095530 AGCCATGGGAAGATCTGAGAAGG - Intergenic
947280410 2:228446565-228446587 AGCCAGTGAGAGTCCTCACAAGG + Intergenic
948290297 2:236819414-236819436 GGCCATGGTCAGTGCTCACATGG + Intergenic
948550201 2:238765929-238765951 AGCCGTGGGGAGGTCTGAGAAGG - Intergenic
1169919296 20:10717290-10717312 AGTCATGAGGCGTTTTCACAGGG - Intergenic
1173223710 20:41149350-41149372 AGCCAGTGGGACTTCTCAGAGGG + Intronic
1176091342 20:63319872-63319894 AGCAAGGGGGGGTTCTCCCAGGG + Intronic
1176416553 21:6478825-6478847 CGCCAGGGAGAGCTCTCACAGGG - Intergenic
1177068209 21:16466470-16466492 AGCCATGGGAATTTCAAACAGGG - Intergenic
1179692053 21:43087160-43087182 CGCCAGGGAGAGCTCTCACAGGG - Intergenic
949114181 3:299700-299722 AGCCTAGGGGAGCTCACACAGGG - Intronic
950617935 3:14177456-14177478 AGCCATGGGGGGTTCACTCTAGG + Intronic
961008590 3:123421543-123421565 AGCCATGGGGAGTTCTCACAGGG + Intronic
962477260 3:135765955-135765977 AACCATTGGGAGTTTTCAGATGG + Intergenic
962767624 3:138580065-138580087 ACCCATGGGGAGTACTGCCAGGG - Intronic
963258096 3:143166339-143166361 AGACCTGGGGGGGTCTCACAAGG + Intergenic
964776154 3:160280321-160280343 AGCGTTGGGTAGTTGTCACAAGG + Intronic
965710271 3:171550079-171550101 ATACATGGGGACTTCTCCCAAGG - Intergenic
971630942 4:28993089-28993111 ATCCTTGGTGAGTTCTAACAGGG + Intergenic
973173184 4:47170575-47170597 AGTCCTGGGCAGATCTCACAAGG + Intronic
973748092 4:53984350-53984372 ACTCATGGGGAGTTTTCATAGGG - Intronic
979960737 4:127018233-127018255 AGCCATGGTGAGTTCACAGAGGG - Intergenic
985477545 5:86914-86936 AGAAATGGGGAGTTCTCACCCGG - Intergenic
989259101 5:39399260-39399282 ACCCAAGGGGTGTTATCACAAGG + Intronic
997213839 5:132094547-132094569 GGCCATGGGGAATGCTCAGAAGG - Intergenic
997487426 5:134243210-134243232 AGGCAAGAGGAGTCCTCACATGG + Intergenic
999314518 5:150575294-150575316 AGCCCTGCGGCGCTCTCACAAGG + Intergenic
1001965759 5:175908766-175908788 AGCCATGAGGAGTTCCGAGAAGG - Intergenic
1002251186 5:177930430-177930452 AGCCATGAGGAGTTCCAAGAAGG + Intergenic
1002456306 5:179346831-179346853 AGGCATGGTGAGATGTCACATGG + Intergenic
1003025205 6:2548693-2548715 AGACAGGGAGAGTGCTCACAGGG - Intergenic
1003467102 6:6391252-6391274 AGCCAAGGAGAGTTTTCAGATGG - Intergenic
1007237966 6:40404740-40404762 AGCTTTGGGGAGTTCACACAAGG + Intronic
1007616100 6:43180472-43180494 AGAAATGGGCAGTTCTCCCAGGG + Exonic
1008522886 6:52379300-52379322 AGCCATGGGGAGTTGTTTAATGG + Intronic
1012964438 6:105657941-105657963 TTCCATGGAGAGTCCTCACAAGG + Intergenic
1013694128 6:112681304-112681326 GTCCATGGGGAGTCCTAACAAGG - Intergenic
1015374444 6:132493544-132493566 AAGCATGGGGACTTCTTACATGG - Intronic
1018423351 6:163659231-163659253 AGCCAAGGGTAGTTCCCAAAAGG - Intergenic
1021963720 7:25897121-25897143 AGCCCTGAGAAGTTCTCACTGGG - Intergenic
1024378790 7:48670327-48670349 AGCCATGGAGTCTTCACACAGGG - Intergenic
1033448995 7:141446331-141446353 AGTGATGGGGAATTCTGACAAGG - Intronic
1034933260 7:155181238-155181260 AGCAATGTGGAGTTCACAGAGGG + Intergenic
1035395378 7:158531462-158531484 AGCCCTGGGTCGTTCTCTCAGGG - Intronic
1036638443 8:10567068-10567090 AGCCAAGGGGAGGTGCCACATGG - Intergenic
1038843712 8:31209852-31209874 AGCCATGGGCAGTTTCCAGAGGG - Intergenic
1040310780 8:46235763-46235785 TGCCCTGGGGAATTCTGACATGG - Intergenic
1040317764 8:46274019-46274041 AGCCTTGGGGACTTCTGGCATGG - Intergenic
1040324407 8:46334431-46334453 AGCCCTGGGGAGTTCTGGGATGG - Intergenic
1040324991 8:46337163-46337185 AGCCGTGGGGGCTTCTCAGATGG - Intergenic
1040330855 8:46385093-46385115 AGCCATGGGGATTTCTGAGATGG - Intergenic
1040331773 8:46389266-46389288 AGCCCTTGGGGCTTCTCACATGG - Intergenic
1040336778 8:46420124-46420146 AGCCTTGGGGGCTTCTCAGATGG - Intergenic
1040342123 8:46446359-46446381 AGCCTTGGGGGATTCTCAAATGG + Intergenic
1040342212 8:46446770-46446792 AGCCCTGGGGGCTTCTCAAATGG + Intergenic
1040342316 8:46447202-46447224 AGCCCTGGGGGCTTCTCAAATGG + Intergenic
1040342526 8:46448178-46448200 AGCCATGGGGACTTCTCAAATGG + Intergenic
1045657313 8:104400140-104400162 GGCCATGGGGAGCTCACAGATGG - Intronic
1045798519 8:106075065-106075087 AGCGATGGTGATTTCTCCCAGGG - Intergenic
1047543749 8:125796248-125796270 AGCCACAGTGAGTTCTCATAGGG + Intergenic
1048972992 8:139655602-139655624 AGAAATAGGGATTTCTCACAGGG - Intronic
1057738486 9:97690133-97690155 AGCAATGGTGGCTTCTCACACGG + Intronic
1059136327 9:111810164-111810186 AGCTTTAGGTAGTTCTCACAAGG - Intergenic
1059335678 9:113567082-113567104 AGCCCTGGAGACTTCTCACGAGG - Intronic
1186285636 X:8041292-8041314 TCTCATGGGGAGTTCTCACTCGG - Intergenic
1188964755 X:36537310-36537332 CCCCATGGAGAGTTCTCACTGGG + Intergenic
1192634943 X:72807612-72807634 AGCCCTGGGGATTTCTGACTTGG + Intronic
1192756837 X:74055509-74055531 AGCCATGGAGCCTTCTCAAATGG - Intergenic
1194256561 X:91642872-91642894 AGCCATAGGGAGTCCTACCAAGG + Intergenic
1200575282 Y:4882149-4882171 AGCCATAGGGAGTCCTACCAAGG + Intergenic