ID: 961008592

View in Genome Browser
Species Human (GRCh38)
Location 3:123421564-123421586
Sequence GGCAATTGCTCCCTGTACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 131}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961008584_961008592 18 Left 961008584 3:123421523-123421545 CCACTATGACCATCAGATTGAGC 0: 1
1: 0
2: 0
3: 10
4: 83
Right 961008592 3:123421564-123421586 GGCAATTGCTCCCTGTACCCTGG 0: 1
1: 0
2: 1
3: 7
4: 131
961008588_961008592 9 Left 961008588 3:123421532-123421554 CCATCAGATTGAGCCATGGGGAG 0: 1
1: 0
2: 1
3: 8
4: 129
Right 961008592 3:123421564-123421586 GGCAATTGCTCCCTGTACCCTGG 0: 1
1: 0
2: 1
3: 7
4: 131
961008591_961008592 -4 Left 961008591 3:123421545-123421567 CCATGGGGAGTTCTCACAGGGCA 0: 1
1: 0
2: 1
3: 32
4: 240
Right 961008592 3:123421564-123421586 GGCAATTGCTCCCTGTACCCTGG 0: 1
1: 0
2: 1
3: 7
4: 131
961008583_961008592 30 Left 961008583 3:123421511-123421533 CCTGGGTGTGGTCCACTATGACC 0: 1
1: 0
2: 0
3: 12
4: 68
Right 961008592 3:123421564-123421586 GGCAATTGCTCCCTGTACCCTGG 0: 1
1: 0
2: 1
3: 7
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961008592 Original CRISPR GGCAATTGCTCCCTGTACCC TGG Intronic
901138798 1:7014555-7014577 GGCCATTGCTCCCTATACTTGGG - Intronic
901532206 1:9860685-9860707 GGCAGAAGCTCCCTGTCCCCAGG - Intronic
904258408 1:29272259-29272281 TGCCACTGCTCCCTGTATCCTGG - Intronic
905543799 1:38781635-38781657 GTCTTTTGCTCCCTGAACCCAGG + Intergenic
906991756 1:50746878-50746900 GGAAACTGCTCCCTGCATCCTGG + Intronic
907271506 1:53294126-53294148 GGCCATGGCTCCCTGTTTCCAGG + Intronic
910840806 1:91559610-91559632 GGCAAATGCTCTCTGTCTCCTGG - Intergenic
911060267 1:93741400-93741422 GGAAATTACTCTCTGTGCCCGGG + Intronic
913990702 1:143609222-143609244 GGCAATTCCTGCCTTTCCCCTGG + Intergenic
916197231 1:162235770-162235792 GGCAAGTGCTCCTTGAACACTGG - Intronic
917477061 1:175377999-175378021 GGGAAGTGTTCCCTGTCCCCTGG - Intronic
921504036 1:215944380-215944402 GGAAATTGCTCCCTTTATTCAGG - Intronic
924127350 1:240868820-240868842 GGCAAATGCTCTCTGCAGCCTGG + Exonic
1063197390 10:3756330-3756352 TACAATTGCTGCCTGTGCCCGGG + Intergenic
1063907000 10:10791359-10791381 GGAAATTGGTAGCTGTACCCCGG - Intergenic
1069757004 10:70779559-70779581 GGCCATGCCTCCCTCTACCCTGG - Intronic
1069852930 10:71422251-71422273 GGCAAAGGCTCCCTGGAGCCAGG - Intronic
1072740460 10:97906079-97906101 GGCAAGAGCTCCCTGTGTCCTGG - Intronic
1072741800 10:97914293-97914315 GCACAGTGCTCCCTGTACCCAGG + Intronic
1075808923 10:125210243-125210265 GGCACTTCCTCCCTGGGCCCTGG + Intergenic
1077004819 11:349381-349403 GGGAATTGAACCCTGAACCCGGG + Intergenic
1079024286 11:16933793-16933815 GCCACTTTCTCCCTATACCCAGG - Intronic
1080810700 11:35701544-35701566 GGGAATTGAACCCTGAACCCAGG + Intronic
1083977425 11:66134670-66134692 GGGTAGGGCTCCCTGTACCCTGG + Intronic
1084261881 11:67984252-67984274 GGCTCTTACTCCCCGTACCCCGG + Intergenic
1084419686 11:69054104-69054126 GGCACCTGCTCCCTGTGGCCGGG + Intronic
1090496848 11:127221512-127221534 GGCCATTGCTCCATTTACACTGG + Intergenic
1093795900 12:23310137-23310159 GGCAAGTGCTCTCTGTCCCTGGG - Intergenic
1095084890 12:38050344-38050366 ACCAATGGCTCCCTCTACCCTGG - Intergenic
1101873621 12:108584189-108584211 GGCAGCTGCTCCCTCTCCCCAGG - Intergenic
1104974087 12:132544296-132544318 GGCAGCAGCTCCCTGTACCATGG - Intronic
1106184730 13:27399364-27399386 GTCCATTGCTCCCTGCACCCTGG + Intergenic
1107374383 13:39786219-39786241 GGAAATTTCTCCCTTTAGCCTGG - Intronic
1108457809 13:50634172-50634194 GGCAATTTTTCCATGGACCCGGG + Intronic
1114206755 14:20579200-20579222 GGCATCTGTTTCCTGTACCCAGG + Intergenic
1114266964 14:21078351-21078373 GGCAACTCCTCCCTATCCCCAGG + Exonic
1116288443 14:43003066-43003088 GGCATTTGCTGACTCTACCCTGG - Intergenic
1120038687 14:79728033-79728055 GGCAACTTCTCCCTGAAGCCAGG + Intronic
1121312664 14:92943580-92943602 GAGAATGGCTCCCTGTTCCCTGG - Intronic
1127641362 15:60918850-60918872 GGTAATTCCTGGCTGTACCCTGG - Intronic
1129828536 15:78651740-78651762 GGCAAGTGCTCTCTGAGCCCTGG + Intronic
1131553729 15:93379092-93379114 GCAAATTGCTCCCGTTACCCAGG - Intergenic
1132193899 15:99895444-99895466 GGCAATTTCTCCAAGTGCCCTGG - Intergenic
1135650413 16:24201565-24201587 GGGAATTGCTCACTGCACCAGGG + Intronic
1136273848 16:29166342-29166364 GGGAATTACTCCCTGGGCCCTGG + Intergenic
1142077390 16:88128085-88128107 GGGAATTACTCCCTGGGCCCTGG + Intergenic
1142427684 16:90009359-90009381 GGCCATTGTCCCCTGTCCCCTGG + Exonic
1143610511 17:8015261-8015283 GGCAATCGCTTCGTGTACTCGGG + Intronic
1148052052 17:44774341-44774363 GGCATATGCTCCCTGTCCCACGG + Exonic
1150649256 17:66999319-66999341 GGGAATAGCTCCCTGACCCCAGG + Intronic
1150923962 17:69513259-69513281 GGAACTTGCTCCCAATACCCAGG - Intronic
1152171804 17:78755624-78755646 GTCCATTCCTCCCTCTACCCCGG - Intronic
1155263902 18:24073112-24073134 CTCAGGTGCTCCCTGTACCCTGG + Intronic
1157468563 18:47969525-47969547 GACAATTTTTCCCTGGACCCAGG - Intergenic
1158837449 18:61345968-61345990 GGCAAGTGCTGCCAGTACCTGGG + Intronic
1160216187 18:76933741-76933763 AACAATTGCTTCCTATACCCAGG - Intronic
1161209236 19:3057585-3057607 GGCAGCTGCTCCCTCAACCCCGG - Intronic
1163377964 19:16945280-16945302 AGCAAGTGCTCCCTGACCCCTGG - Intronic
1163660823 19:18576204-18576226 GGTCATGGCTCCCTGTACCCTGG + Exonic
1164704760 19:30312149-30312171 GGCAAGTGCAAACTGTACCCAGG - Intronic
1165462790 19:35953908-35953930 GGCAGTTGGTAACTGTACCCAGG + Intergenic
1167966934 19:53155667-53155689 GGGAATTCATCCCTGTACCTAGG - Intronic
928089720 2:28366693-28366715 GGGAATTGCTCACAGCACCCTGG - Intergenic
929043811 2:37771903-37771925 GGCAAGTGCTGCCTGTTGCCTGG - Intergenic
929538611 2:42801623-42801645 GGCCACTGCTCACAGTACCCGGG - Intergenic
931005777 2:57849392-57849414 GGCAGCTCCTCTCTGTACCCAGG + Intergenic
931470619 2:62535065-62535087 GGCAAGTTCTCCCTGAAGCCTGG - Intergenic
936697329 2:114966106-114966128 GTGCATTGCTCCCTGTCCCCGGG - Intronic
938134010 2:128738988-128739010 ATCACTTGCTCCCTGTAGCCTGG + Intergenic
940399643 2:153233262-153233284 GGCAATTGCTTCCTTTACACAGG + Intergenic
943483591 2:188453639-188453661 GGCCATTGCTCTCTGTATCTTGG - Intronic
944981001 2:205119848-205119870 GGGAATAGCTTCCTGTACCCAGG + Intronic
947765374 2:232634106-232634128 GCCAAATGCTACCTGCACCCCGG - Intronic
947795156 2:232889973-232889995 GCCAATGGCTCCCTCTGCCCAGG + Intronic
1171537006 20:25902069-25902091 GCCATTTGCTCTCTGTATCCGGG - Intergenic
1182016240 22:27042244-27042266 GGAAATCGCTCCATGTACCCTGG + Intergenic
1183785091 22:40024575-40024597 ACACATTGCTCCCTGTACCCAGG + Intronic
950436543 3:12983682-12983704 GGCAATTCCTCCCAGCACCTGGG + Intronic
952416786 3:33096974-33096996 AGCAATGCCTCCCCGTACCCGGG + Intronic
954842611 3:53525194-53525216 GGCTCTTGCTCCCTCTACCTAGG + Intronic
956317462 3:67954240-67954262 GGCAATTGGTCACTGTGCACCGG + Intergenic
960514785 3:118591239-118591261 GGGAATTGAACCCTGAACCCAGG - Intergenic
961008592 3:123421564-123421586 GGCAATTGCTCCCTGTACCCTGG + Intronic
961330880 3:126137228-126137250 GGCAATTCCTCCCTGAACCCAGG + Intronic
962259362 3:133893350-133893372 GGCAAGGCCTCCCTGTTCCCTGG + Intronic
965074913 3:163963920-163963942 GGAAACTGCTTCCTGCACCCTGG + Intergenic
965990389 3:174810924-174810946 GGCCACTGCTCCCTGCATCCTGG + Intronic
969793072 4:9505429-9505451 GGCTCTTACTCCCCGTACCCGGG - Intergenic
974733308 4:65897588-65897610 GGACATTGCTCCCTGTATCCTGG - Intergenic
976175714 4:82349650-82349672 GGCAATTGACTCCTGAACCCTGG + Intergenic
977270939 4:94916932-94916954 GGACATTGCTCCCTATATCCTGG + Intronic
983644020 4:169971676-169971698 GGCATTTGTTCACTGTTCCCAGG + Intergenic
985946715 5:3190954-3190976 GGAAATTGCCCTCTGTGCCCAGG - Intergenic
991972824 5:72157517-72157539 GCCCATGGCTCCCTGTCCCCGGG - Intronic
993134304 5:83938045-83938067 GGCATTTTCTGCCTGGACCCAGG - Intergenic
993501643 5:88673293-88673315 GGCACTTGCTCCCTGAGCCTCGG + Intergenic
996239042 5:121171566-121171588 GGAAACTGCTCCCTGAATCCTGG - Intergenic
998389147 5:141775864-141775886 GGCAATTTTTCCATGGACCCCGG - Intergenic
998983219 5:147727014-147727036 GGGAATTGAACCCTGAACCCAGG - Intronic
1000061132 5:157656094-157656116 GGGAATTGAACCCTGAACCCGGG - Intronic
1001296138 5:170500393-170500415 GGCTGTTGCTCCCTTTACTCTGG - Intronic
1007448762 6:41927217-41927239 TGCATTAGCTCCCTGTCCCCAGG - Intronic
1007975296 6:46095104-46095126 GGATACTGCTCCCTGTATCCTGG - Intergenic
1008409092 6:51152408-51152430 GGCTGTTGCTCCCTGAGCCCAGG - Intergenic
1013620223 6:111880548-111880570 GGGAATAGCTCCCAGTGCCCAGG + Intergenic
1016061509 6:139636009-139636031 GGCAAGTTCTCCCTGAGCCCAGG + Intergenic
1017999457 6:159566062-159566084 GGCATGTGGTCACTGTACCCTGG - Intergenic
1019051082 6:169184576-169184598 GGCAAATGCTCCCTGGAAACAGG + Intergenic
1023304393 7:38808908-38808930 GCCAATAGCTCCCAGTCCCCTGG - Intronic
1023391372 7:39714683-39714705 GGACATTGCTCCCTGCATCCTGG + Intergenic
1023899205 7:44462008-44462030 GGCAGGTGGTCCCTGAACCCAGG + Intronic
1027524150 7:79245688-79245710 GGCAAGTTCTCCCTGATCCCAGG - Intronic
1029078912 7:97957023-97957045 GGCTCTTACTCCCCGTACCCCGG + Intergenic
1033570099 7:142619112-142619134 GGAATTTTCTCCCTGAACCCAGG - Intergenic
1034558250 7:151863258-151863280 TACCAGTGCTCCCTGTACCCGGG - Intronic
1035069325 7:156129770-156129792 GGCAAATGCTCCCAGCAGCCAGG + Intergenic
1035266356 7:157692164-157692186 GGCCATTGTTCCCTGCGCCCGGG + Intronic
1037819092 8:22127170-22127192 GCCCATTGCTCCCTGGACCTCGG + Exonic
1038231931 8:25708709-25708731 GGGAATTGCTCACTGAAACCAGG - Intergenic
1041133061 8:54723070-54723092 GGCAAAAGCTCCCCGCACCCAGG - Intergenic
1041135732 8:54756756-54756778 GGCAGAGGCTCCATGTACCCTGG + Intergenic
1043210223 8:77504783-77504805 GGAAATAGCTGCCTGTTCCCTGG + Intergenic
1046578994 8:116068306-116068328 GGGAATTGAACCCTGAACCCGGG - Intergenic
1050436422 9:5615245-5615267 GGCAGAATCTCCCTGTACCCTGG - Intergenic
1058652567 9:107190514-107190536 TACTATTGCTCCCAGTACCCAGG + Intergenic
1058667901 9:107337254-107337276 AGCAATTGCTCCTTGTTCACGGG - Intergenic
1060820595 9:126659367-126659389 GGCAATTTCACGCTGTCCCCAGG + Intronic
1060967879 9:127721628-127721650 GGCAACTCCTCCCTGTGCCCCGG + Intronic
1061266286 9:129507029-129507051 GGCAATTGCCCGCTGGTCCCTGG - Intergenic
1186203742 X:7180096-7180118 GACAATTTCTCCCTGGACCTGGG + Intergenic
1186736118 X:12465941-12465963 GGAAATTGATGGCTGTACCCAGG - Intronic
1188063129 X:25625380-25625402 GGAAAGTGCTCCCTGGACCTTGG - Intergenic
1188133863 X:26470607-26470629 GGGAATTGAACCCTGAACCCGGG + Intergenic
1189292324 X:39895187-39895209 GGGAATTGCTCCCCTTGCCCAGG - Intergenic
1190947521 X:55110095-55110117 GGGAATTGAACCCTGAACCCAGG - Intronic
1191258941 X:58292197-58292219 GGCATTTGGTCTCTGTCCCCAGG - Intergenic
1192223837 X:69215307-69215329 GACCCTTGCTCCCTGTCCCCAGG + Intergenic
1197874455 X:131088721-131088743 GCCCATTGCTCCGTGTGCCCCGG + Exonic
1201645477 Y:16225047-16225069 GGAACTGGCTCCCTGTAGCCTGG - Intergenic
1201657336 Y:16360265-16360287 GGAACTGGCTCCCTGTAGCCTGG + Intergenic