ID: 961009192

View in Genome Browser
Species Human (GRCh38)
Location 3:123424638-123424660
Sequence TTCTGGGTAAGGCTGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 445
Summary {0: 1, 1: 0, 2: 3, 3: 38, 4: 403}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961009192_961009198 -5 Left 961009192 3:123424638-123424660 CCTTCCTCCAGCCTTACCCAGAA 0: 1
1: 0
2: 3
3: 38
4: 403
Right 961009198 3:123424656-123424678 CAGAATGACCGTCCTCCTGATGG 0: 1
1: 0
2: 0
3: 8
4: 88
961009192_961009203 26 Left 961009192 3:123424638-123424660 CCTTCCTCCAGCCTTACCCAGAA 0: 1
1: 0
2: 3
3: 38
4: 403
Right 961009203 3:123424687-123424709 TCTCCACCCCATGTTCAGCCTGG 0: 1
1: 0
2: 1
3: 18
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961009192 Original CRISPR TTCTGGGTAAGGCTGGAGGA AGG (reversed) Intronic
901133655 1:6979078-6979100 TTGTTGGTGTGGCTGGAGGAGGG + Intronic
902513409 1:16978020-16978042 TGCTGTGGAAGGCTGGGGGAAGG + Intronic
903008190 1:20312134-20312156 TTCTGAGTAATGCTGGCGGCTGG - Intronic
903515686 1:23909327-23909349 TTCTGGGTTCTGCTGGAAGAAGG + Intronic
903591593 1:24460183-24460205 GACTGGGGAAAGCTGGAGGAAGG + Intronic
903828072 1:26159346-26159368 TTCTGGGCTAGCCTGGAGGCCGG - Intronic
903834484 1:26194089-26194111 AGCTGGGGAAGGCTGGAGCAGGG - Intronic
903997805 1:27318738-27318760 TTATGGGTTTGGCTGGGGGAGGG - Intergenic
904600773 1:31671504-31671526 GGCTGGGCAAGGCAGGAGGAGGG - Intronic
904627270 1:31814198-31814220 TCCAGGGGAAGGCTGGAGCAAGG - Exonic
905637607 1:39565362-39565384 TTGTAGGTAATGCTGGAGGATGG - Exonic
905882960 1:41476447-41476469 TTATGGAAAAGGCAGGAGGAGGG + Intergenic
906499126 1:46328150-46328172 TTCCGGGTATGACTGGAGCAGGG + Intergenic
906529965 1:46518145-46518167 GTCTGGGTGGGGCTTGAGGATGG + Intergenic
907210722 1:52819239-52819261 TTCTGGGTAATGTAGTAGGAAGG - Intronic
907779507 1:57552968-57552990 TTCTGGGAAAGAGTAGAGGAAGG + Intronic
909955845 1:81777950-81777972 ATCTGTGTCAGTCTGGAGGAAGG - Intronic
910551416 1:88479933-88479955 TCCTGGGTTGGGCTGGAGTAGGG - Intergenic
910609440 1:89125846-89125868 ATCTGGGTAAGACTGGGGCAGGG - Exonic
910852766 1:91665026-91665048 TTCTGGGTGTGACTGGAGCAGGG + Intergenic
911567625 1:99482387-99482409 TGCTGGGATAGGCAGGAGGAGGG + Intergenic
911805710 1:102205482-102205504 TTCTGGTAAAGGCTGGTGGGTGG - Intergenic
912474680 1:109928028-109928050 TACTGGGTAAGGAGGGAAGATGG - Intronic
912816222 1:112830826-112830848 TTCTGGGTGTGACTGGAGCAGGG - Intergenic
912988663 1:114460700-114460722 TTCCTAGTAAGGCTGGAGAAGGG - Intronic
913465839 1:119141547-119141569 GTCTAGGGAAGGCTGCAGGAAGG + Intergenic
913964329 1:143362761-143362783 CTCTGTGGAAGGCTAGAGGAGGG - Intergenic
914058698 1:144188367-144188389 CTCTGTGGAAGGCTAGAGGAGGG - Intergenic
914120451 1:144778004-144778026 CTCTGTGGAAGGCTAGAGGAGGG + Intergenic
914997619 1:152558698-152558720 TGCAGGGAAAGGCTGGAGGTGGG + Intronic
916481894 1:165221590-165221612 TTCTGGGCCAGGCAGGGGGAGGG + Intronic
916569617 1:166013830-166013852 TTTTCGGTGAGGCTGGAGCAAGG - Intergenic
917192201 1:172429964-172429986 TTACAGGTAAGGCTGGAGGGTGG - Intronic
917243853 1:172978669-172978691 TTCTGGGTAAGTCAGCAGGCTGG - Intergenic
918523357 1:185439140-185439162 TTCTGGGGAAGTCAGAAGGAGGG + Intergenic
918646993 1:186916953-186916975 TTCTGGGTGTGACTGGAGCAGGG + Intronic
919728038 1:200896327-200896349 TTCTGGGGAGGGTGGGAGGATGG + Intronic
919807295 1:201387719-201387741 TGCCGGGCAAGGCTGGGGGAGGG + Intronic
919807552 1:201389292-201389314 TGCCGGGCAAGGCTGGGGGAGGG + Exonic
920652854 1:207851604-207851626 CTCAGGGTAGGACTGGAGGAAGG + Intergenic
922192230 1:223329464-223329486 TGCTGGGAAAAGCTAGAGGAGGG - Intronic
922244630 1:223783599-223783621 TTCAGGGGAAGGCTGGCGTATGG - Intronic
922700721 1:227758527-227758549 GTCTGGCTGAGGCTGGGGGAAGG + Intronic
922854333 1:228761152-228761174 TTGTGGGTAGGGCAGGGGGAGGG + Intergenic
1063759844 10:9061200-9061222 TTCTGGGTGTGGCTAGAAGATGG - Intergenic
1064553834 10:16528689-16528711 AGATGGGAAAGGCTGGAGGAAGG - Intergenic
1065198932 10:23295307-23295329 TTCTGGGGAAAGCGTGAGGATGG - Intronic
1065493730 10:26308239-26308261 TTCTAGGTGGGGCTGCAGGATGG - Intergenic
1066227127 10:33394187-33394209 TTGTAGGTAGGGTTGGAGGAGGG + Intergenic
1066351501 10:34641343-34641365 TGCCGGGGAAGCCTGGAGGAGGG + Intronic
1066390605 10:34974875-34974897 TTCTGGGTGTGACTGGAGCAGGG - Intergenic
1066481788 10:35803163-35803185 TTCTGGGTGGAGGTGGAGGACGG + Intergenic
1067060560 10:43076128-43076150 TTCTGGGTGAGGTTGGATGTGGG - Intergenic
1067498671 10:46782178-46782200 ATCTCAGTAAAGCTGGAGGAAGG + Intergenic
1067595981 10:47558215-47558237 ATCTCAGTAAAGCTGGAGGAAGG - Intergenic
1069488009 10:68837361-68837383 TTCTGGGTGCAGCTGGAGTATGG + Intronic
1069598420 10:69687560-69687582 GTCTGGGACAGGATGGAGGAGGG - Intronic
1069605671 10:69737340-69737362 TACTGGGTCAGGCTGGGGGTTGG - Intergenic
1069633652 10:69912595-69912617 TTCTCTGTAAGGGAGGAGGAAGG - Intronic
1070118621 10:73553517-73553539 CTCTGGGAAAGGTGGGAGGAGGG - Intronic
1070780311 10:79133740-79133762 GTCTGGGCACTGCTGGAGGAGGG - Intronic
1071617017 10:87084143-87084165 ATCTCAGTAAAGCTGGAGGAAGG + Intronic
1072335006 10:94390023-94390045 TTCTGGGTGTGACTGGAGCAGGG - Intergenic
1072688994 10:97558054-97558076 TTCTGGGTGTGACTGGAGCAGGG + Intronic
1073412072 10:103350735-103350757 TTCTCGTTGAGGCTGGAGGGAGG - Exonic
1074729007 10:116348732-116348754 TGCTGGGTGAGGCTGGAAGGTGG - Intronic
1075604174 10:123792493-123792515 TTCTGGGTTAGGGTGGTGGGCGG - Intronic
1075614635 10:123882600-123882622 TTCTGGGGAAGGCTGGAATGGGG - Intronic
1075975404 10:126689799-126689821 TTCTGAGTGGGGCTGTAGGAAGG - Intergenic
1076657745 10:132036141-132036163 TTCAGGGTAAAGCGGGAGGAAGG - Intergenic
1077279673 11:1736994-1737016 TTCAGGGTAAGGAAGGAGGCAGG + Intronic
1077481913 11:2818940-2818962 GGCTGGGTAATGCTGGAGGGTGG - Intronic
1078838691 11:15057199-15057221 TGCTTGCTAAGGCTGGATGAAGG - Intronic
1079178567 11:18167937-18167959 TTCAGGGGAAGGATGGAAGAGGG + Intronic
1079276696 11:19044962-19044984 TTTTGTGTAAGGTGGGAGGAAGG - Intergenic
1082820025 11:57538427-57538449 TCCTGGGGAAGGAAGGAGGAAGG + Intergenic
1084315098 11:68341343-68341365 TTCTGGGTGTGGGTGGGGGATGG - Intronic
1084911482 11:72393060-72393082 TTAGGGGCAAGGCTCGAGGAAGG + Intronic
1085348453 11:75782973-75782995 TGCTGGGCAAGTCTGGAGGTGGG + Intronic
1088267762 11:108003865-108003887 TTCTTGATAAGGCAAGAGGATGG - Intergenic
1088740409 11:112762415-112762437 TGCTGGGAGAGGATGGAGGAAGG + Intergenic
1089197795 11:116705015-116705037 TTCTGGGTACTGCTCTAGGAAGG + Intergenic
1091458234 12:624095-624117 TTCAGGGTGAGGGTAGAGGAAGG - Intronic
1091964012 12:4722788-4722810 TTCAGGGTGAGGCTGGGAGATGG + Intronic
1092223228 12:6729593-6729615 TTCTGGGGAATGCAGGAGTAGGG + Intronic
1094124623 12:27010801-27010823 TTCTGGGTAAGAATGGAAGATGG - Intronic
1095154950 12:38841540-38841562 TTTGGGGTAAGGCTGGACAATGG + Intronic
1096491120 12:52013613-52013635 TTCTGGCTAAGGTAGGAGGCTGG + Intronic
1096776146 12:53965522-53965544 TTCAGGGTAGGGATGCAGGAAGG + Intergenic
1097426178 12:59447159-59447181 TTCTAGGTAAGGCTATATGAAGG - Intergenic
1097504315 12:60445626-60445648 TCCTGGGTAGGGCTACAGGATGG - Intergenic
1097598531 12:61664213-61664235 TCCTGGGGAGGGTTGGAGGAGGG - Intergenic
1098781299 12:74690174-74690196 TTGTGGGCAAGGATGAAGGAGGG - Intergenic
1100715846 12:97304314-97304336 TTCTGGGAAGGGCTGGGAGATGG + Intergenic
1101028328 12:100635627-100635649 TTCTGGGTGTGACTGGAGCAGGG + Intergenic
1101600530 12:106205700-106205722 ATCAGGGGAAGGCTGGAGGCAGG - Intergenic
1102583640 12:113908164-113908186 TTCAGGGAAAGCCTGGAGAATGG + Intronic
1103057415 12:117832795-117832817 GCCTAGGTAAGGCTGGTGGATGG - Intronic
1103742317 12:123099198-123099220 TTCTGGGTGAGCGTGAAGGAGGG - Intronic
1108486877 13:50935726-50935748 TTCTGGGGAAGGATGTAGGTTGG + Intronic
1108665707 13:52628336-52628358 TGGGGGCTAAGGCTGGAGGATGG + Intergenic
1109804419 13:67419339-67419361 TTCTGTATAAGGCTTAAGGAAGG + Intergenic
1110825263 13:79964452-79964474 TTGGGTGGAAGGCTGGAGGAAGG + Intergenic
1112494316 13:99893592-99893614 CTTTGGATTAGGCTGGAGGATGG - Exonic
1113247992 13:108420156-108420178 TTCTTGGCGAGGCTGCAGGAAGG - Intergenic
1114448293 14:22806813-22806835 CTATGGGCAAGGCTGGAGGCAGG + Intronic
1114539543 14:23444528-23444550 TTCAGGGAGAGGGTGGAGGAGGG + Intergenic
1114771663 14:25433996-25434018 TTTTGTGTAAGGCGGAAGGAAGG - Intergenic
1116012667 14:39369158-39369180 TTGTGGGTAGGGCTTGGGGAGGG + Intronic
1116409567 14:44606003-44606025 TTGCTGGTAAGGATGGAGGAAGG - Intergenic
1117533666 14:56684176-56684198 ATCTGGGTAAGATTGGAGGTAGG + Intronic
1117642016 14:57810143-57810165 TGCTGGCTCAGGATGGAGGAGGG - Intronic
1118235916 14:64004901-64004923 TTCTATGTAAGGAAGGAGGAGGG + Intronic
1118360690 14:65054078-65054100 TGCTGGGCAGGGCTGGAGGATGG + Intronic
1118803150 14:69209511-69209533 TTCTGGGTGTGGCTGTAGGGGGG + Exonic
1119657930 14:76430839-76430861 ATCTGGGTCAGGCTGAAGGACGG - Intronic
1119775008 14:77242882-77242904 TCCTGGGGAAGGATGGAAGAAGG - Exonic
1121534281 14:94680615-94680637 TTCTGGCTGAGGCTGGATAAAGG + Intergenic
1121598896 14:95187855-95187877 AGCTGGGTATGTCTGGAGGAAGG + Exonic
1122666510 14:103334001-103334023 CTCTGGGAAAGGCGGGGGGAGGG + Exonic
1122972559 14:105158343-105158365 TTCTGTGTGAGGGTGGAGGTAGG - Intronic
1123006347 14:105325634-105325656 TCCTGGGGAAGGCTGAAGGGAGG - Intronic
1124140292 15:27071353-27071375 TTCGAGGTGAGGCTAGAGGAAGG + Intronic
1124336544 15:28861527-28861549 TTCTGCGTAAGTCTGGAGTGAGG + Intergenic
1124546724 15:30635428-30635450 TTTTGGGGAAGAGTGGAGGAAGG + Intronic
1124628491 15:31324414-31324436 TTCTGGGTAAAGTTGGTGGATGG - Intergenic
1124780329 15:32625428-32625450 TTTTGGGGAAGAGTGGAGGAAGG + Intronic
1124883307 15:33661541-33661563 TGGTGGGTGAGGCTGGGGGAGGG + Intronic
1126359713 15:47833896-47833918 TTATGGGAAAGGCTGGCAGATGG + Intergenic
1126877119 15:53055609-53055631 TGTTGGGGGAGGCTGGAGGAGGG + Intergenic
1127337228 15:58000050-58000072 TTCTGGGGAGGGGTGGGGGAAGG + Intronic
1127395566 15:58541692-58541714 TCCTGGATAATGCTGGAGGAAGG - Intronic
1127396049 15:58544718-58544740 CTGTGGGTAGGGCTGGAGAACGG + Intronic
1127541654 15:59945019-59945041 TTCTGGGAAAGCCTGGAGACTGG + Intergenic
1127963927 15:63909943-63909965 AGCTGGCTCAGGCTGGAGGAAGG - Intronic
1128832607 15:70783277-70783299 TCCTGGTAAAGGCTGGAGGCAGG + Intergenic
1129232448 15:74204278-74204300 ATCAGGGGAAGGCAGGAGGAGGG - Intronic
1129411862 15:75354744-75354766 TTCTGGGTCCTGCTGGAGGCTGG - Exonic
1133230163 16:4362595-4362617 TGCTGGGTAAGGAGGCAGGACGG - Exonic
1133720403 16:8489332-8489354 ATTTTTGTAAGGCTGGAGGAAGG + Intergenic
1135569297 16:23535992-23536014 TTCTGCACAAGGCTGGAGGTGGG - Intronic
1137753015 16:50880515-50880537 ACCTGGGTAAGGCTGGAGGAGGG + Intergenic
1138148079 16:54630053-54630075 TTCGGGGGCAGGCTGGAGGCAGG + Intergenic
1139587987 16:67916613-67916635 TTCTGGGTAATGGAGGAGGAAGG + Intronic
1139946789 16:70647314-70647336 TCCTGGGTATGGCCGGTGGAGGG + Intronic
1140922988 16:79556350-79556372 TTCAGGGTATGCCTTGAGGAGGG - Intergenic
1140972111 16:80023418-80023440 TTCTGGGGAAGGCTTGTGGGGGG + Intergenic
1141319046 16:82989472-82989494 TTCTGGGTAAGGCAGTGGCAAGG + Intronic
1141489540 16:84362884-84362906 CTGTGGGTACGGCGGGAGGACGG - Intergenic
1141769019 16:86077661-86077683 TTCTGGGGCTGCCTGGAGGAAGG + Intergenic
1143858301 17:9869212-9869234 GTGAGGGTAAGGCTGGAGGAGGG - Intronic
1143862221 17:9899250-9899272 TTCTGGGTTAGGATCCAGGATGG + Intronic
1144622273 17:16825073-16825095 TTTTGGGGCAGGCTGGAGGGAGG - Intergenic
1144815134 17:18028821-18028843 TTCTGATTAAAGCTGGGGGAAGG + Intronic
1144884150 17:18447640-18447662 TTTTGGGGCAGGCTGGAGGGAGG + Intergenic
1144938997 17:18923947-18923969 TTGTGGGTGATGTTGGAGGAAGG + Exonic
1145148078 17:20496737-20496759 TTTTGGGGCAGGCTGGAGGGAGG - Intergenic
1145231162 17:21174376-21174398 CTGTGGCTAAAGCTGGAGGAAGG - Intronic
1145864644 17:28233104-28233126 TTCTGGGTGTGACTGGAGCAGGG + Intergenic
1146764356 17:35505772-35505794 TTCTGGGTGTGACTGGAGCAGGG - Intronic
1146790410 17:35747703-35747725 GTGTGGGGGAGGCTGGAGGAAGG - Intronic
1147316265 17:39621891-39621913 GTGTGTGTAAGGCTGGTGGAGGG + Intergenic
1147419096 17:40313220-40313242 TCCTGGGCAGGGCAGGAGGAGGG - Intronic
1147574244 17:41589404-41589426 TTTTGGGGCAGGCTGGAGGGAGG - Intergenic
1147574854 17:41593275-41593297 TTCTGGGGCAGTCTGGAGGGAGG - Intergenic
1148812113 17:50300021-50300043 TACTGGGTGAGGGTGGAGGGAGG - Intergenic
1149010648 17:51853322-51853344 TTCTGCATAAGGCTGGACAAGGG + Intronic
1149029778 17:52069433-52069455 TTGTGGGTAAGGTCAGAGGAAGG + Intronic
1150219608 17:63488732-63488754 TTTCGGGTAAAACTGGAGGATGG - Exonic
1150435660 17:65152262-65152284 TCCTTGGTATGGCTGGGGGAAGG + Intronic
1151463858 17:74272136-74272158 TTCTGGGTGAGGGTGGGGGTGGG + Intergenic
1151733759 17:75926228-75926250 TTCAGGGAAAAGCTGGTGGACGG - Intronic
1152458741 17:80430575-80430597 TCCTGGGACAGGCTGGAGGATGG - Intronic
1153028701 18:693418-693440 TACTTTGGAAGGCTGGAGGATGG - Intronic
1153848635 18:9072404-9072426 TACTGGGGAAGGCTGGGGAAGGG - Intergenic
1155201215 18:23519411-23519433 GTGGGGCTAAGGCTGGAGGATGG + Intronic
1157304792 18:46509091-46509113 TGCTGGGAAAAGCGGGAGGATGG + Intronic
1157563952 18:48667377-48667399 ATCTGGGAAAGGCTTCAGGAGGG + Intronic
1158239513 18:55361138-55361160 TTCTAGGTGAGGTTGGATGATGG - Intronic
1158547300 18:58407034-58407056 GTGTGGGAAAGGCTGGAGGGAGG - Intergenic
1159001306 18:62977935-62977957 TGCTGTGTAAGGCTAGATGATGG + Intronic
1159845000 18:73448416-73448438 TTCTGGTGAAGGCTTGCGGATGG - Intergenic
1159916041 18:74188778-74188800 AGGTGGGGAAGGCTGGAGGAGGG - Intergenic
1160431345 18:78814916-78814938 TGCTGGCTAGGGCGGGAGGAGGG - Intergenic
1160681183 19:412336-412358 TTCGGGCTCAAGCTGGAGGAGGG + Intergenic
1161943390 19:7419507-7419529 TTCTGAGACAGGCTGGAGGCCGG - Intronic
1162792185 19:13068933-13068955 TTCTGGGCCAGGCTAGGGGAGGG - Intronic
1162880464 19:13655059-13655081 TTCTGGGTAAGGTAGAAGGCAGG - Intergenic
1163172778 19:15544045-15544067 TGTGGGGTGAGGCTGGAGGAGGG + Intronic
1163934352 19:20428683-20428705 TTCTGGGTGTGACTGGAGCAGGG + Intergenic
1163943018 19:20512445-20512467 TTCTGGGTGTGACTGGAGCAGGG + Intergenic
1164109166 19:22138243-22138265 TTCTCGTTGAGGCTGGAGGGAGG + Intergenic
1164123851 19:22292194-22292216 TTCTAGTTAAGGGTGGAGGATGG - Intronic
1164130471 19:22357060-22357082 TTCTGGGTATGACTGGATCAGGG + Intergenic
1164405240 19:27938369-27938391 TTCTGGGAGAGGCAGGGGGATGG + Intergenic
1165058907 19:33195284-33195306 TGCGGGGCAGGGCTGGAGGAGGG + Intronic
1165797401 19:38526932-38526954 TTGTGGGTCAGGAAGGAGGATGG + Intronic
1166126444 19:40717740-40717762 TTCTGGGTGAGTCTGGAGGCTGG - Exonic
1166348821 19:42184341-42184363 TTCTGGGAAGGGCGGCAGGAAGG - Intronic
1167100072 19:47399233-47399255 TTCTGGGAAAAGGGGGAGGAGGG + Intergenic
1168438277 19:56340027-56340049 TTTTGGGTTTGGATGGAGGAGGG - Intronic
1202698102 1_KI270712v1_random:140252-140274 CTCTGTGGAAGGCTAGAGGAGGG - Intergenic
927629069 2:24755323-24755345 TTCTGTGTAAGGCTGGTTGATGG + Intronic
928106014 2:28471190-28471212 TTCAGGTTAAGGCTAGAGGGAGG + Intronic
929122834 2:38497487-38497509 TTCGTGGTAAGGCTGGAGGATGG - Intergenic
929453141 2:42049379-42049401 TTCTGGGTGGCGCTGGAGGTGGG - Intronic
929607703 2:43246136-43246158 TTCTGGATAAGGCTGGGAGGTGG - Intronic
929961739 2:46502381-46502403 TAGTGGGTAAGCCTGGAGGCAGG + Intronic
930864482 2:56108996-56109018 TTCTGGGCAAAGCTGCAGGTAGG + Intergenic
931227866 2:60349618-60349640 ATCTAGGATAGGCTGGAGGAAGG - Intergenic
933187705 2:79297068-79297090 TTCTCAGTAAGGGTGGAGGAGGG - Intronic
933862343 2:86482709-86482731 TTCTGAATAGGGCAGGAGGATGG - Intronic
934279355 2:91598035-91598057 CTCTGTGGAAGGCTAGAGGAGGG - Intergenic
935379121 2:102432729-102432751 GCCTGGGGAAGGCTGCAGGAAGG + Intronic
937226617 2:120374078-120374100 TCCTAGGTGGGGCTGGAGGAGGG + Intergenic
937969678 2:127539826-127539848 TTCGGGGGAAGGCTGGAGCTGGG - Intronic
938190508 2:129275496-129275518 TTCTGGGTAATGCTGCTGGTGGG - Intergenic
939080477 2:137654755-137654777 TTCTGTGGGGGGCTGGAGGAAGG + Intronic
943344057 2:186716367-186716389 TTCTGGGTAAGGAAGGAAAAGGG - Intronic
944055916 2:195521641-195521663 GTCTGGATAAGGCTCAAGGACGG - Intergenic
946440055 2:219687436-219687458 TTCTGGGAAAGGCGGGGGGTGGG + Intergenic
947488753 2:230575905-230575927 TAATCGGTAAGGCTGGTGGAGGG - Intergenic
947587052 2:231362858-231362880 TTTGGGGTCAGGCAGGAGGAAGG - Intronic
948489624 2:238304130-238304152 TGCTGGGTTAGGTAGGAGGAAGG + Intergenic
948768091 2:240233634-240233656 TTATGGGCAGGGCTGGAGGCGGG - Intergenic
1169277877 20:4245750-4245772 AGCTGGGCAAGGCTGGAGCAGGG + Intronic
1170837251 20:19895022-19895044 TGGTGGGCAAGGCTGGAGGCAGG - Intronic
1170884246 20:20325389-20325411 TTGTGGGGGAGGCAGGAGGAAGG - Intronic
1171408718 20:24931564-24931586 TTCTGGGTGTGACTGGAGCAGGG - Intergenic
1171944658 20:31365872-31365894 TTCTGGGGGAGGCAGGAGGGAGG + Intergenic
1172359359 20:34301603-34301625 AGCTGGGTGGGGCTGGAGGAAGG - Intronic
1172834550 20:37864587-37864609 TTCTGGGGAAGGCTGGACGTCGG - Intronic
1173143175 20:40502616-40502638 TGCTGGGTGAGGAAGGAGGAGGG - Intergenic
1173200528 20:40951500-40951522 TTCTGGGTAAGGGTGGGGGTAGG + Intergenic
1173522680 20:43711373-43711395 TCCTGGGTAAGGCAGGAAGGAGG - Intronic
1174280453 20:49435178-49435200 TTCTGGGGGAAGGTGGAGGAGGG - Intronic
1174775515 20:53339787-53339809 TCCTGGGCACTGCTGGAGGAAGG + Intronic
1175080674 20:56417927-56417949 TGCTGGGAAATGCTGGAGGGAGG - Intronic
1175513700 20:59554146-59554168 TTCTGGGTGTGACTGGAGCAGGG + Intergenic
1175921965 20:62454377-62454399 CTCTGGGGCAGGCTGAAGGAGGG + Intergenic
1175935419 20:62511703-62511725 ATCTGAGCCAGGCTGGAGGAGGG - Intergenic
1176260627 20:64177712-64177734 TGCTGGGAAAGGCTGGGGGCAGG + Intronic
1176745265 21:10646429-10646451 TTCTAGGTTAGTCTGGTGGAAGG + Intergenic
1177087660 21:16727507-16727529 TCCTGCGAAAGGCTGGAGGAGGG - Intergenic
1178741016 21:35201322-35201344 TTCTAGGGAATGCTGGAGGAGGG + Intronic
1179719411 21:43306784-43306806 TTCTGGGTGGGGCTGGTGGAGGG - Intergenic
1180167991 21:46040040-46040062 TCCTGGGAAGGGCTGGAGGGAGG - Intergenic
1180168014 21:46040117-46040139 TCCTGGGAGAGGCTGGAGGGAGG - Intergenic
1180730281 22:17976406-17976428 TTCTGGGAATAGCTGGAGGTTGG - Intronic
1181265151 22:21626767-21626789 TGCTGGCTAAGGCTGGGAGAGGG - Intergenic
1181728570 22:24828183-24828205 TACTGGGTGGGGCTGGAGGCAGG + Intronic
1182765507 22:32755093-32755115 GTCTGGGGAAGGTTGGAGGAAGG + Intronic
1183001032 22:34859247-34859269 TTCTGGGTAAGGCTGGGGCTGGG + Intergenic
1183078404 22:35441181-35441203 CTCTGGGAGAGGCTGGAGAAGGG + Intergenic
1183361198 22:37384363-37384385 TTCTGGGAAAGCCAGGAGGTGGG - Intronic
1185149048 22:49153921-49153943 GTGTGGGTAAGGTGGGAGGAGGG + Intergenic
950099249 3:10347051-10347073 TTCCGGGGATGGCTGGGGGACGG - Intronic
950509865 3:13419784-13419806 TTCTGGGTTGTGCGGGAGGAGGG - Intronic
950553098 3:13679438-13679460 GACTGAGGAAGGCTGGAGGAAGG - Intergenic
951754769 3:26077744-26077766 TTCAGGGAAAGACTGGAGGCAGG + Intergenic
952742529 3:36748434-36748456 TTCTGGGGAAGGCAGGTGGCTGG - Intergenic
952920158 3:38278456-38278478 TGCTGGGTGGGGCTGGAGAAGGG - Intergenic
954603500 3:51891227-51891249 TTCTGAGAAAGGATGGAGAATGG - Intergenic
955419709 3:58724164-58724186 TGCTGGGGCTGGCTGGAGGATGG + Intronic
955873124 3:63460841-63460863 TTGGGGGCAAGGCTGGAGGCAGG + Intronic
957285747 3:78215331-78215353 TGATGGATAAGGCTGAAGGATGG + Intergenic
959081332 3:101804370-101804392 TCCTGGGTGAGGCTGGTTGATGG + Intronic
960172787 3:114482127-114482149 TTCTGGGTCATGCTGGGGCATGG - Intronic
961009192 3:123424638-123424660 TTCTGGGTAAGGCTGGAGGAAGG - Intronic
961623558 3:128243675-128243697 TTCTGGGCAAAGCAGGAGCAGGG + Intronic
961636189 3:128334727-128334749 TTCTGGGGAAGGAGGGAGGGAGG - Intronic
961788394 3:129360924-129360946 TAATGGGGAAGGTTGGAGGAGGG + Intergenic
962449872 3:135504076-135504098 TTATGGGGAAGGCAGGAGGCTGG + Intergenic
966302032 3:178489901-178489923 TTTTGGGTATGGGTGGAGGTGGG - Intronic
966420774 3:179732238-179732260 TTGAGGGTAGGGCTGGAGTATGG + Intronic
968612464 4:1563497-1563519 TTCTGGGCAGGACAGGAGGAAGG - Intergenic
969407436 4:7003172-7003194 ATCTGGGGAACGCTGGAGGCTGG - Intronic
969461776 4:7332824-7332846 GTGTGGGTGAGGCAGGAGGAGGG + Intronic
970816079 4:20157355-20157377 TGCTGGCTGAGGCTGGGGGAAGG - Intergenic
971011319 4:22438894-22438916 GGCTGAGTGAGGCTGGAGGATGG + Intronic
971975156 4:33674990-33675012 CACTTGGAAAGGCTGGAGGAAGG - Intergenic
972275110 4:37549851-37549873 TTCTGGGTGTGACTGGAGCAGGG - Intronic
972347207 4:38202482-38202504 CTCTGGGTAAGTGTGGAGCAAGG + Intergenic
974988140 4:69054726-69054748 TTCTGGGTGTGACTGGAGCAGGG - Intronic
976059393 4:81108543-81108565 TTCTGGGTAGGGCATGAGAAAGG - Intronic
976083870 4:81387420-81387442 TTTTGTGTAAGGCGTGAGGAAGG - Intergenic
977151370 4:93516696-93516718 TTTTGGGGAAGGGAGGAGGAGGG + Intronic
981210444 4:142097681-142097703 TTCTGAGAAAGTCTGTAGGATGG - Intronic
981289682 4:143059841-143059863 TTTTGTGTAAGGCGTGAGGAAGG - Intergenic
982217656 4:153095991-153096013 TTATGAGGAAGGCTGGAGGCTGG + Intergenic
982662580 4:158224763-158224785 TTCTGGGTGTGACTGGAGCAGGG + Intronic
983016860 4:162623960-162623982 TTCTGGAGAAGGCTGGAGAAGGG - Intergenic
983558178 4:169076892-169076914 TTCTTGGTAAGAGTGGAAGAGGG + Intergenic
983898165 4:173103664-173103686 TTCTGGGTGTGACTGGAGCAGGG - Intergenic
984622107 4:181965571-181965593 TTGGGGGTAAGGTTGGAGAATGG - Intergenic
985090424 4:186357451-186357473 TTCTGGTAGAGGTTGGAGGAGGG - Intergenic
985701358 5:1375087-1375109 TCCTGTGTAAGGTTAGAGGAGGG - Intergenic
986301493 5:6481673-6481695 ATGTGGGCAAGGCTGGGGGAAGG - Intronic
986376393 5:7136403-7136425 TTCTGGGTGACCCTGGTGGATGG - Intergenic
986740665 5:10702487-10702509 GTCTGGCAAAAGCTGGAGGAAGG - Intronic
989095846 5:37780632-37780654 TTCTGGGTGTGACTGGAGCAGGG + Intergenic
990029221 5:51236399-51236421 TTCTGGGCAAGGATGTGGGATGG - Intergenic
991492192 5:67194434-67194456 CTCTGGGTGAGGCCGCAGGATGG - Intronic
992150697 5:73899563-73899585 TTCTGGGTCAGACTGGAACATGG + Intronic
992481555 5:77156886-77156908 TGCTGGGACAGGCTGGAGGATGG + Intergenic
993507765 5:88732360-88732382 TTCTAGGACAGGCAGGAGGAGGG + Intronic
995212814 5:109559999-109560021 CTTTGGGAAATGCTGGAGGAAGG - Intergenic
996911243 5:128659614-128659636 TTCTTCGTAAGGCAGCAGGAAGG - Intronic
997374073 5:133384476-133384498 GACTGGCTAAGGATGGAGGAAGG + Intronic
997584788 5:135037870-135037892 TACTGGGTAAGTGGGGAGGAGGG + Intronic
998374374 5:141681453-141681475 GTCGGGGTCAGGCTGGTGGAAGG - Intronic
998853125 5:146369680-146369702 TTCTGAGTATGACTGGAAGACGG + Intergenic
1000285771 5:159825201-159825223 TCCTGGGTATGGCTGGAGTTTGG + Intergenic
1002052428 5:176578628-176578650 TGGTGGGTAAGGCTGGGGGAGGG + Intronic
1002136186 5:177109157-177109179 GTGTGGGGAAGGCAGGAGGAGGG + Intergenic
1002666967 5:180831979-180832001 TTCTGGGGAGGGGAGGAGGAGGG - Intergenic
1002669368 5:180853711-180853733 GTCTGGGGAAAGCTGGAGGCGGG + Intronic
1002670383 5:180861487-180861509 TTCTGGGGTAGGCTGGGGGAGGG + Intergenic
1002998917 6:2312972-2312994 TTCTGGGTATGACTGGAGCAGGG + Intergenic
1003105019 6:3208762-3208784 TACTGGGTAGGGCTAGAGGTAGG + Intergenic
1003187396 6:3844217-3844239 TTGTGACTAAGCCTGGAGGAGGG + Intergenic
1003489755 6:6611095-6611117 TTCTTTGAAAGGCTGGAGGTCGG - Intronic
1003495826 6:6662354-6662376 TCCTGATTAAGGCTGGGGGATGG - Intergenic
1004938833 6:20534569-20534591 TTCTGGGTAAGGGTGGCCGATGG + Exonic
1005146013 6:22690906-22690928 TTTTGGGAAATGCTGGAGAAGGG + Intergenic
1005530364 6:26698369-26698391 TTTTGGGTCAAGCTGCAGGAAGG - Intergenic
1005540432 6:26803277-26803299 TTTTGGGTCAAGCTGCAGGAAGG + Intergenic
1005994473 6:30922971-30922993 TTCAGGGTAAGCCTGGGCGAGGG + Exonic
1006031981 6:31183027-31183049 TTCTGGGTGTGACTGGAGCAGGG + Intergenic
1006334875 6:33415250-33415272 CTCTGGTTAGGGCTGGGGGATGG - Exonic
1007614094 6:43170573-43170595 ATCTGGAAAAGGCTGGTGGAGGG - Intergenic
1007960346 6:45953344-45953366 TGCTGGGTGAGTCTGGAGGGAGG + Intronic
1008224504 6:48897563-48897585 AGATGGGGAAGGCTGGAGGATGG - Intergenic
1009011248 6:57845375-57845397 TTTTGGGTCAAGCTGCAGGAAGG + Intergenic
1010317951 6:74472026-74472048 TTCTGGGTGTGACTGGAGCAGGG - Intergenic
1011054951 6:83194056-83194078 TTCTGGGAAAGGCTGGGGCCCGG - Intronic
1011657887 6:89567891-89567913 TTCTGGGGAGGACTGGAGGTTGG - Intronic
1012910079 6:105108294-105108316 TCCAGGATGAGGCTGGAGGACGG + Intronic
1013148535 6:107420268-107420290 TTCTGGCTGAGGCTAGAAGAAGG - Intronic
1013616700 6:111850002-111850024 CTCTGGTGATGGCTGGAGGAAGG + Intronic
1014197423 6:118576173-118576195 TTCTTGGTAAGGCAATAGGAAGG - Intronic
1014823795 6:126024510-126024532 AGTCGGGTAAGGCTGGAGGATGG - Intronic
1015795292 6:137005293-137005315 TTCTGGGTAGGGCTGGAGCCTGG + Intronic
1015966727 6:138701735-138701757 TTCTGCTTTAGGATGGAGGAAGG - Intergenic
1017074738 6:150607179-150607201 TCCTGGCTAAGGCTGGACCATGG - Intronic
1017168616 6:151434359-151434381 TTCTGGTAAAGGCTGGGTGATGG + Intronic
1018698429 6:166408313-166408335 TTCTGGGTACAGCAGGAGGCAGG + Intergenic
1018989465 6:168662555-168662577 TTCTGGGCTATGCTGGAGGCGGG - Intronic
1019042957 6:169121304-169121326 TTCTGGTTATGATTGGAGGAGGG - Intergenic
1019056389 6:169226541-169226563 TTCTGGGTAATGTTGCAGGAGGG + Intronic
1020160962 7:5771234-5771256 TTTTGTGTAAGGCATGAGGAAGG - Intronic
1020174303 7:5869970-5869992 CTCTTGTCAAGGCTGGAGGATGG - Intergenic
1020278859 7:6639931-6639953 TTCTGGGAGAGGCTGGAGGTTGG + Intronic
1020322867 7:6953010-6953032 TTCTGGGTGTGACTGGAGCAGGG + Intergenic
1020871690 7:13638499-13638521 TTTTTGGTAAGGGTGGAGAAAGG - Intergenic
1022170196 7:27820016-27820038 TTCTCAGTAAGGCTGGAGTGGGG - Intronic
1022723854 7:32963617-32963639 TTCTGCTTAAGTCTGCAGGACGG - Exonic
1023209064 7:37783513-37783535 TTCTGGTTAAGAAAGGAGGATGG + Intronic
1023812769 7:43925132-43925154 TTCTGGGTAAGGATGCAGTGTGG + Intronic
1024701329 7:51907155-51907177 TTGTGGCTGAGGCTGGAGGCTGG - Intergenic
1025049773 7:55724298-55724320 TTCTGCTTAAGTCTGCAGGACGG + Intergenic
1026106129 7:67422238-67422260 GCCTGTGGAAGGCTGGAGGATGG - Intergenic
1026556799 7:71415560-71415582 TTCTGGCCAAGTTTGGAGGAAGG + Intronic
1026894565 7:74002811-74002833 CTCTGGGTGAGGCAGGAGGCTGG - Intergenic
1028983426 7:96992245-96992267 TCCTGGTTAAGGCTGGATGAGGG + Intergenic
1029084455 7:98000403-98000425 CTCTTGTCAAGGCTGGAGGATGG + Intergenic
1029456724 7:100675512-100675534 TTCTGGGGAGGGCGGGAGGCTGG + Intronic
1029536641 7:101161178-101161200 TTCTGGGTGAGGCAGGAGCTGGG + Exonic
1030360363 7:108589199-108589221 TCCAGGCTGAGGCTGGAGGATGG - Intergenic
1031170418 7:118286126-118286148 GTCTGGGTAAGGCTCAAGGAGGG - Intergenic
1031550526 7:123106280-123106302 ATCTGGGGCAGGCTGAAGGAAGG + Intergenic
1031647859 7:124248894-124248916 TTCTGGCTAAGACTGGAAGGAGG + Intergenic
1032224365 7:130019156-130019178 TACTGGGTGAGGCAGGAGAATGG - Intronic
1032792268 7:135251340-135251362 CTCTGGGTTAGGCTGCAGGCAGG - Intronic
1032810291 7:135407157-135407179 TTCTGGGCAAAGCGGGAGGCAGG - Intronic
1033262009 7:139852087-139852109 TTCAGGGTCAAGCTGGAGAATGG - Intronic
1033345295 7:140521647-140521669 TTCTGGGAGAGGCTGGCAGAGGG + Intronic
1035413814 7:158667454-158667476 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413824 7:158667483-158667505 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413892 7:158667683-158667705 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1036767650 8:11558895-11558917 TACTGGGTAAGGCTGGGCGAGGG - Intronic
1037856417 8:22374411-22374433 TACTGGGTGAGGCCAGAGGAGGG + Intronic
1038089853 8:24240735-24240757 TTCTGGGTGTGACTGGAGAAGGG - Intergenic
1038517083 8:28196507-28196529 TTCTGGGTTAAAATGGAGGATGG + Intergenic
1039026556 8:33264665-33264687 TTTGGGGCAAGGCAGGAGGATGG + Intergenic
1040102338 8:43516717-43516739 TGGTGGGTGAGGGTGGAGGATGG + Intergenic
1041515659 8:58696271-58696293 TTCTGGGTGTGACTGGAGCAGGG - Intergenic
1041669004 8:60474615-60474637 TTCTAGGCAAGGCAGGAGCATGG - Intergenic
1043683444 8:83060292-83060314 TGCTGGGAAAGACTGGAGGTAGG - Intergenic
1044362982 8:91310163-91310185 TTCTAGGTTGGGGTGGAGGAGGG + Intronic
1044837349 8:96309351-96309373 GTTTGGGTTAGGCTGGAGGCAGG - Intronic
1044915546 8:97109494-97109516 TTCTGGGTCAGGAAGGAAGATGG - Intronic
1045198859 8:99958067-99958089 TGGTGGGTAGGGCGGGAGGAGGG - Intergenic
1045388307 8:101691482-101691504 TTCAGGATAGGGCTGAAGGATGG - Intronic
1046455625 8:114456256-114456278 TTCTGGGTAATGCTGTTGGATGG - Intergenic
1047078851 8:121436819-121436841 TTCTGGGAAAGCCTGGAGGAAGG + Intergenic
1047667729 8:127110255-127110277 GTCTGGGTAAAGCTCGAGGGAGG - Intergenic
1048026586 8:130592739-130592761 GCTTAGGTAAGGCTGGAGGAGGG - Intergenic
1048038299 8:130699265-130699287 TTCTGGGAAAGGCTGTAGAAAGG + Intergenic
1048957166 8:139546752-139546774 TTCTGGGTGTGACTGGAGCAGGG + Intergenic
1048987226 8:139741100-139741122 TGCTGGGGCAGGCTGGAGGAGGG - Intronic
1049419006 8:142508648-142508670 GGCTGGGTAAGTGTGGAGGATGG + Intronic
1051554106 9:18363702-18363724 TTCTGATTAATGCTTGAGGAAGG + Intergenic
1052989413 9:34510377-34510399 TTCTGGGGAAGGAGGCAGGAAGG + Intronic
1053780997 9:41606947-41606969 TTCTTGATATGGCTGCAGGAGGG - Intergenic
1054168940 9:61817104-61817126 TTCTTGATATGGCTGCAGGAGGG - Intergenic
1054697067 9:68371186-68371208 GTCTGGGTTTGGCTGGAAGAAGG - Intronic
1055723675 9:79204052-79204074 TTTTGGACAAGGCTGAAGGAAGG - Intergenic
1056196358 9:84232617-84232639 TTGTTGGAAAGGCTGGAGAAAGG - Intergenic
1057209389 9:93191488-93191510 TTCTGAGCGAGGCTGGAGGAGGG + Intronic
1057592452 9:96383880-96383902 TTCCAGGAAAGCCTGGAGGAAGG - Intergenic
1057865061 9:98674037-98674059 AACTGTGCAAGGCTGGAGGAGGG - Intronic
1058053536 9:100428398-100428420 TTCTGAGTTAGGATTGAGGATGG + Intronic
1058679055 9:107425554-107425576 TTCAGGGTGAGGCTGGTGGAAGG - Intergenic
1059438687 9:114290706-114290728 CCCTGGGTGAAGCTGGAGGAAGG - Intronic
1060058686 9:120439264-120439286 TTCTGGGGAAGGCTTGATGGTGG - Intronic
1061826442 9:133261091-133261113 CTCTGGGTAAGCCTGGAGTTGGG + Intronic
1062166623 9:135110995-135111017 TTCAGGGTAGAGCTGGACGATGG - Intronic
1062219478 9:135406927-135406949 TGGTGGGGAAGGCAGGAGGATGG - Intergenic
1186884583 X:13900400-13900422 TACTGGGAAGGGCTGGAGGGAGG + Intronic
1186929827 X:14376553-14376575 TTTTAAGTAAGACTGGAGGATGG - Intergenic
1186959639 X:14721937-14721959 TGCTGTGGAAAGCTGGAGGATGG - Intronic
1186977126 X:14919540-14919562 TACTCTGTAAGGCTGGTGGAAGG - Intronic
1188535732 X:31194734-31194756 TTGTGGGCAAGGCAGGAGGGTGG + Intronic
1188757045 X:33975056-33975078 GGTTGGGTAAGGCTGGAGTAGGG + Intergenic
1189228153 X:39430803-39430825 ATCTGGCTGAAGCTGGAGGATGG - Intergenic
1190157939 X:48008680-48008702 GTCTGGGTAGGGGTAGAGGATGG - Intronic
1190173710 X:48131564-48131586 GTCTGGGTAGGGGTAGAGGATGG - Intronic
1192529218 X:71871488-71871510 TTCTGAGTCAGGCTGGTGGTGGG + Intergenic
1192634310 X:72803543-72803565 TGCTGTGTTAGGCTGGAGGTGGG - Intronic
1192647400 X:72917258-72917280 TGCTGTGTTAGGCTGGAGGTGGG + Intronic
1193221851 X:78935357-78935379 TTCCGGGGAAGGCTGCAGTAAGG + Intergenic
1193717524 X:84949882-84949904 TTCTGGGTGTGACTGGAGCAGGG - Intergenic
1195176045 X:102316446-102316468 TTGAGGGCAAGGCTGGAGGCAGG + Intronic
1195182819 X:102370647-102370669 TTGAGGGCAAGGCTGGAGGCAGG - Intronic
1197487423 X:127071085-127071107 TTGGGGGTAAGGCTGGGAGAGGG - Intergenic
1199592839 X:149483807-149483829 TGCTGGGTGAGGATGGAGAAAGG - Intronic
1199620906 X:149699935-149699957 TTCTTCATAAGGCTGCAGGATGG + Intronic
1200006681 X:153089851-153089873 TTCTGAGAAAGGGTGGAAGAAGG - Intergenic
1200390476 X:155940307-155940329 TTCTGGACATGACTGGAGGATGG - Intronic
1200699361 Y:6389024-6389046 TCCTGGGTATGACTGGAGTAGGG - Intergenic
1201034750 Y:9775674-9775696 TCCTGGGTATGACTGGAGTAGGG + Intergenic
1201680339 Y:16638664-16638686 TTCTGGGTGTGACTGGAGCAGGG + Intergenic
1201774206 Y:17646157-17646179 TTCTGTGTCAGGGTGGAGGTTGG - Intergenic
1201827351 Y:18259832-18259854 TTCTGTGTCAGGGTGGAGGTTGG + Intergenic