ID: 961012694

View in Genome Browser
Species Human (GRCh38)
Location 3:123447135-123447157
Sequence CTGTGGGAATGCAGTGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 537
Summary {0: 1, 1: 1, 2: 8, 3: 54, 4: 473}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961012694_961012699 10 Left 961012694 3:123447135-123447157 CCTTCCTCACTGCATTCCCACAG 0: 1
1: 1
2: 8
3: 54
4: 473
Right 961012699 3:123447168-123447190 AGTTCAGTACACGTTATCTAAGG 0: 1
1: 0
2: 0
3: 5
4: 51
961012694_961012702 17 Left 961012694 3:123447135-123447157 CCTTCCTCACTGCATTCCCACAG 0: 1
1: 1
2: 8
3: 54
4: 473
Right 961012702 3:123447175-123447197 TACACGTTATCTAAGGGGCAAGG 0: 1
1: 0
2: 0
3: 1
4: 29
961012694_961012701 12 Left 961012694 3:123447135-123447157 CCTTCCTCACTGCATTCCCACAG 0: 1
1: 1
2: 8
3: 54
4: 473
Right 961012701 3:123447170-123447192 TTCAGTACACGTTATCTAAGGGG 0: 1
1: 0
2: 0
3: 4
4: 46
961012694_961012700 11 Left 961012694 3:123447135-123447157 CCTTCCTCACTGCATTCCCACAG 0: 1
1: 1
2: 8
3: 54
4: 473
Right 961012700 3:123447169-123447191 GTTCAGTACACGTTATCTAAGGG 0: 1
1: 0
2: 0
3: 2
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961012694 Original CRISPR CTGTGGGAATGCAGTGAGGA AGG (reversed) Intronic
900037533 1:429901-429923 CTGTGGGAGTTCAGTCAGGCTGG + Intergenic
900059161 1:665642-665664 CTGTGGGAGTTCAGTCAGGCTGG + Intergenic
900457426 1:2783989-2784011 CTGGGGGGCTGCCGTGAGGAGGG + Intronic
901718631 1:11177017-11177039 CTGCCGGAATGCAGACAGGAGGG + Intronic
901821750 1:11834790-11834812 CTGTGGGACTGCAGTGGGCAGGG + Intronic
902568445 1:17331163-17331185 CTGTGGGGTGGCAGTGTGGATGG + Intronic
902632838 1:17715858-17715880 CTGGGAGAATTCAGTGAGGCAGG - Intergenic
903176706 1:21585851-21585873 CTGTGGAAATGGAGAGGGGAGGG + Intergenic
904391333 1:30188254-30188276 CTGTGGGAATGGTGTGACGCTGG - Intergenic
904896460 1:33821774-33821796 CTGTGGGACCACAGTGGGGAGGG + Intronic
904977922 1:34472703-34472725 CTGTGTGAATCAAGGGAGGATGG + Intergenic
905011245 1:34748302-34748324 CTGTGGGAGGAGAGTGAGGAGGG - Intronic
905467597 1:38167048-38167070 AGGTGGGAATGGAGTGAGGAGGG + Intergenic
906711752 1:47935389-47935411 CTGTTGCAATACAGTGACGACGG - Intronic
906732945 1:48098869-48098891 CTTTGGAAATCCAGTGAGGAGGG - Intergenic
907186318 1:52612136-52612158 CAGTGGGTATGGAGGGAGGAAGG - Intergenic
907244357 1:53098465-53098487 ATGTGTGAATGCATTGAGGCAGG - Intronic
907271715 1:53295232-53295254 CTGTGGGAGTGAAGAGAGCAGGG + Intronic
907379603 1:54075283-54075305 CTGTGGGAATACAGGGGAGACGG + Intronic
907446164 1:54509183-54509205 CTTTGGGATTACAGTGAGGGTGG - Intergenic
908389090 1:63669349-63669371 CTGTGGGAATAGAGGGATGAAGG + Intergenic
909736419 1:78968232-78968254 CTGTGGGAGTTCAGTCAGGCTGG + Intronic
910831679 1:91467732-91467754 CTGTGGGAGTTCAGTCAGGGTGG + Intergenic
911141125 1:94503677-94503699 CTGTTTGCATGAAGTGAGGAAGG - Intronic
911175427 1:94812826-94812848 CTGTGGGAGTACAGTCAGGGTGG + Intergenic
912022007 1:105117309-105117331 CTGTGGTACTGCAGAGAGAATGG - Intergenic
912949461 1:114110782-114110804 CTGAGGTAGTGCAGCGAGGATGG - Intronic
912952928 1:114133038-114133060 CTGAGGGTATGCAGGGAGGAAGG - Intronic
913509678 1:119550316-119550338 CTGTTAGAATGGAGAGAGGAAGG + Intergenic
914227125 1:145729789-145729811 GTGTGGAAATGGAGTGAGAATGG - Intronic
914832573 1:151181179-151181201 CTGTGGCCATGCAGTGTTGAAGG - Intronic
914901284 1:151712474-151712496 CTGTCGGTCTGCAGTCAGGAAGG - Intronic
915013871 1:152714995-152715017 GTCTGGGTATGCACTGAGGAGGG + Intergenic
915048755 1:153044181-153044203 GTGTGTGAATGCTATGAGGATGG - Intergenic
915300966 1:154951435-154951457 CTGTGGGAAGGAAGGGAGGCGGG - Intronic
915719729 1:157975914-157975936 CTGTGGGTATACATTCAGGAAGG - Intergenic
915815320 1:158959623-158959645 CTGTGGTAATTCAGTCAGGCTGG - Intronic
919493467 1:198234846-198234868 CAGTGTGAATGCAGAGAGGAGGG - Intronic
919897115 1:202015857-202015879 CTGTGGGAGAGGAGTGGGGAGGG - Exonic
919947416 1:202329807-202329829 TTGAGGGTATGCAATGAGGATGG + Intergenic
921026930 1:211293169-211293191 CTGTAGGAATGAAGGAAGGATGG - Intronic
922767500 1:228163489-228163511 AGGTGGGGATGCTGTGAGGAGGG + Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923388722 1:233492221-233492243 TTGTGGGAAAGGAGTGAGGCAGG + Intergenic
924284667 1:242474247-242474269 CTGTGGGAATCCCGGTAGGATGG - Intronic
1062826349 10:571554-571576 ATGGGGAAGTGCAGTGAGGAAGG - Intronic
1062956420 10:1543138-1543160 CCGTGGGAACGCAGAGAGCAGGG - Intronic
1063116994 10:3078786-3078808 CTGTGGGTCTGCAGTCAGCAAGG + Intronic
1063775697 10:9261227-9261249 ATGTGGGCATGAAGTGAGGAGGG - Intergenic
1063780757 10:9320614-9320636 CTGTTGGAATGCAGTGAACAAGG - Intergenic
1063971499 10:11384350-11384372 CTGTGGCAAGGCAGTGGAGAAGG + Intergenic
1064714745 10:18165257-18165279 CTGTGGAAGGGCAGAGAGGAGGG + Intronic
1065203719 10:23338556-23338578 CTGTGAGAATACCGTGATGATGG - Intronic
1066338381 10:34504075-34504097 ATGTGGAAGTGCAGTGAGCATGG - Intronic
1067102032 10:43340792-43340814 CAGTGGGAATGCAGGAAGCACGG + Intergenic
1067745476 10:48932574-48932596 CAGTGGATATGCAGTGAGCAAGG + Intronic
1070655427 10:78267838-78267860 CTGTGTGAGTGGAGTGGGGAAGG + Intergenic
1070740761 10:78901585-78901607 TGGTGGGATGGCAGTGAGGATGG - Intergenic
1070748759 10:78951401-78951423 GCGTGGGAGTGCTGTGAGGAGGG - Intergenic
1070763839 10:79045071-79045093 CTGTGGGAAGGTGGTGAGGAGGG + Intergenic
1071014974 10:80986416-80986438 TGGTGGGAATGGGGTGAGGAGGG - Intergenic
1071743487 10:88388819-88388841 CTCTGGGGATACAGTGATGAGGG - Intronic
1072128659 10:92470817-92470839 CTGATAGAATGCAGTGAGAAAGG - Intronic
1072474819 10:95750209-95750231 CTGTGGGAAAGGAGCGGGGATGG + Intronic
1073894490 10:108139130-108139152 TTGTGGGCATGGAGTTAGGAAGG - Intergenic
1074349177 10:112717966-112717988 CTGTGGGAAGGGAGCAAGGAAGG - Intronic
1074406894 10:113187604-113187626 CTGTGGGGCTGCTGTCAGGAAGG - Intergenic
1075087944 10:119426090-119426112 CTGGGGGCATCCAGTGAGAAAGG + Intronic
1075688195 10:124378358-124378380 GAGGGAGAATGCAGTGAGGAGGG + Intergenic
1076413080 10:130265583-130265605 CTGTGGGAGGGTAGTGAGAAGGG + Intergenic
1076420218 10:130326138-130326160 CTGTGGGGTTGGAGGGAGGAAGG + Intergenic
1076964259 11:67824-67846 CTGTGGGAGTTCAGTCAGGCTGG + Intergenic
1077343229 11:2035285-2035307 CTGAGGGAATGCAGGCGGGATGG - Intergenic
1077490832 11:2860258-2860280 CTGAGGGACTGCAGTGCGGCTGG - Intergenic
1077835813 11:5927121-5927143 CTTTGGGAATGCAGTGATTATGG - Intronic
1077892245 11:6427650-6427672 ATGTGGGAGTGAAGTGAGGGAGG + Intergenic
1078197309 11:9146696-9146718 TTGTGGGTATGCAGGGAGGGAGG + Intronic
1078650123 11:13183157-13183179 CTGTGGAGATTCAGTGAGGCTGG + Intergenic
1078675594 11:13409984-13410006 CTCTGGGAAGTCGGTGAGGAAGG + Intronic
1079546844 11:21643288-21643310 CTGTGCTAGGGCAGTGAGGAAGG + Intergenic
1081738891 11:45424453-45424475 CGGTGGCAGTGCAGTGAGAAAGG - Intergenic
1082659415 11:55892277-55892299 ATGTGGGAATGCACTGTGTATGG - Intergenic
1082869788 11:57933611-57933633 AGGTTGGAATGCAGTGAGGAAGG - Intergenic
1083319214 11:61834996-61835018 CTGGGGGCAGGCAGGGAGGAGGG - Intronic
1083891486 11:65597982-65598004 CTGGGGTGATGCAGGGAGGAGGG - Exonic
1084653651 11:70502932-70502954 CTGTGGGAAGGCGGAGAGGATGG + Intronic
1084779626 11:71399775-71399797 CTGGGGGAGGGCAGTGTGGAGGG + Intergenic
1085205498 11:74729809-74729831 CTCTTAGAATGCTGTGAGGATGG - Intronic
1085532614 11:77200966-77200988 CTGTGACAGTGCAGTGAGCAGGG + Intronic
1085804566 11:79623245-79623267 CTGTGGGAATTGATAGAGGAAGG - Intergenic
1086261201 11:84943381-84943403 ATGTGGGAATGCAGGAAGGCAGG - Intronic
1087078721 11:94150040-94150062 CTGTGGGAAGTCAGTGGGGGAGG + Intronic
1087215391 11:95487895-95487917 CTGTGGGAGTTCAGTCAGGCTGG + Intergenic
1089493069 11:118895604-118895626 TTATGGGAAGGGAGTGAGGAGGG - Exonic
1090383963 11:126345813-126345835 CTGTGGGAAGGCCTTGAGAATGG + Intergenic
1090418946 11:126560559-126560581 TTTTTGGAATGTAGTGAGGAGGG + Intronic
1090458047 11:126866638-126866660 GTGTGGGGGGGCAGTGAGGAGGG - Intronic
1090633294 11:128669513-128669535 ATGCTGGAATGCAGGGAGGATGG - Intergenic
1091204253 11:133808722-133808744 CTGTGGAGATGCAGTGATGATGG - Intergenic
1091303593 11:134523426-134523448 CTCTGGGAATGCGGGGAGGCTGG + Intergenic
1202826215 11_KI270721v1_random:90474-90496 CTGAGGGAATGCAGGCGGGATGG - Intergenic
1091813936 12:3421967-3421989 CCCTGGGAGTGCACTGAGGAGGG - Intronic
1093381050 12:18493683-18493705 CCCTGTGAATGCAGTGAGCATGG + Intronic
1093547856 12:20369251-20369273 CACTGGGAATTCAGTGAAGAGGG + Exonic
1093649931 12:21631484-21631506 GTGTTGGAAGGCAATGAGGAAGG + Intergenic
1094161421 12:27394859-27394881 CTGCATGAATGCAGTGAGCAAGG + Intronic
1096199671 12:49672710-49672732 CAGTGGGAAGGAAATGAGGAGGG - Intronic
1096602548 12:52740309-52740331 CTATGGGAGAGCACTGAGGATGG + Intergenic
1096681085 12:53255674-53255696 CTGGTGGAATGCAGGGTGGAAGG + Intergenic
1096715301 12:53487429-53487451 CTGTGGGAATGAAGGAAGGAGGG + Intronic
1098231797 12:68378681-68378703 CTGTGGGAATGGTGGGAGTAGGG - Intergenic
1099054329 12:77819605-77819627 CAGTGGGAAAGCATTGAGGAGGG + Intergenic
1099492971 12:83308504-83308526 CTGAGGGAATGCAGTGAAAAGGG - Intergenic
1099711437 12:86230949-86230971 CTGAGAAAATGCAGTGAGGGAGG - Intronic
1099717152 12:86310559-86310581 CTGTAGGAATGGAGTCAGTAAGG - Intronic
1101301709 12:103489672-103489694 CTGTGAGGCTGCAGTGTGGATGG - Intronic
1101733574 12:107446126-107446148 CAGTGGGAAGGCACTGAGGCAGG + Intronic
1103510355 12:121469283-121469305 CTTTGGGAATGGAGTGATGTGGG - Intronic
1103557583 12:121775586-121775608 CTGGGGGAGTCCAGAGAGGAGGG - Intronic
1104274965 12:127318308-127318330 CTGTGGGGATGCAGTGAGGATGG - Intergenic
1104328828 12:127825498-127825520 CTGGGGCAGAGCAGTGAGGACGG - Intergenic
1105322074 13:19335598-19335620 TTTTGGGAATGCATTAAGGATGG - Intergenic
1105876390 13:24558696-24558718 TTTTGGGAATGCATTAAGGATGG + Intergenic
1106204952 13:27584282-27584304 CTGCTGTAATGCAGTGAGGGAGG + Intronic
1106605285 13:31223292-31223314 CTGGGGGAATGCAGAGGGGAAGG + Intronic
1107103034 13:36614475-36614497 CTGAAGGTGTGCAGTGAGGATGG - Intergenic
1107139710 13:36984741-36984763 CGGTGGGAAGGCAGGGAGGAGGG + Intronic
1107511600 13:41091202-41091224 CTTTGGGGATTCAGTGGGGAAGG + Intergenic
1107804980 13:44145267-44145289 TAGTGGGAAAGGAGTGAGGATGG + Intronic
1108440917 13:50451781-50451803 ATGTGGGAAGGCAGGGAGCAGGG + Intronic
1109567553 13:64137193-64137215 TTGTGTGAATGCAGTGAAAAGGG + Intergenic
1109655427 13:65384524-65384546 CAGTGGGAAGGCACTGAGAATGG - Intergenic
1110277970 13:73660996-73661018 CTGTGGGAGAGCACTGAGGATGG + Intergenic
1111501437 13:89126063-89126085 CTGTGGGGAAGCAGAGAGGAAGG + Intergenic
1111931601 13:94518305-94518327 CTGAGGGTAAGCAGTGTGGAGGG - Intergenic
1112094433 13:96116531-96116553 GTTTGGGAATGGAGTGGGGATGG - Intronic
1112817869 13:103294336-103294358 ATTTGGGAATGCACTAAGGATGG + Intergenic
1113042366 13:106119014-106119036 CTGTGGGAATGCTGTCAGATAGG - Intergenic
1115424304 14:33238387-33238409 CTGTGGGACTACAGAGAGAATGG - Intronic
1116951623 14:50883409-50883431 CTCTGAGAAGGCAGTGATGAGGG - Intronic
1116958150 14:50944554-50944576 CGGTGGGAGTGCAGCGGGGACGG - Exonic
1117971476 14:61255016-61255038 GTGTGGGACTGCAGTGAGGATGG - Intronic
1118188559 14:63559625-63559647 CTTTGGGCATGCACTGAGGTAGG - Intergenic
1118976671 14:70683850-70683872 CTGTTAGGATGCAGTGAAGAGGG + Intergenic
1119170278 14:72529651-72529673 CTGTGGGATTGCAGGGAGGGGGG - Intronic
1120724060 14:87917672-87917694 TTGTGGTAATGCAGTGAGCATGG - Intronic
1120948908 14:90022984-90023006 GTGTGGGACTGAAGTGAGTATGG - Intronic
1120949497 14:90028025-90028047 CTGGGGGAATGCAGTTCAGAAGG - Intronic
1121010041 14:90514423-90514445 CTGGGGAAATGGGGTGAGGATGG + Intergenic
1121605459 14:95236875-95236897 TTGTGGGAATGGTGTGGGGAGGG + Intronic
1121687204 14:95845333-95845355 CTGTGGCAATACAGTAAGCAGGG + Intergenic
1122143057 14:99673888-99673910 CTGGGGGAGTGCACTGAGGGGGG + Intronic
1122774669 14:104111897-104111919 CTATGGGGAAGCAGTGGGGAGGG - Intronic
1124011749 15:25844702-25844724 CGGTGGGCGAGCAGTGAGGAGGG + Intronic
1124969581 15:34473190-34473212 CTGTGGCAAGGCAGAGTGGAAGG + Intergenic
1125386319 15:39140813-39140835 TTGTAGGAATGTAGTGGGGAAGG - Intergenic
1126369742 15:47933241-47933263 CTGTGGGAAGAGAGTGAGTAAGG - Intergenic
1126634358 15:50766581-50766603 GTGTGGGAAAGTAGTGAAGATGG - Intergenic
1127198689 15:56619440-56619462 CTTTGGGAAGCCAGTGAGGGAGG - Intergenic
1127395316 15:58539912-58539934 CTGTGGGAGTGCTGGGATGAAGG - Intronic
1129337889 15:74864706-74864728 CTGTGGGATTGATGTGAGGAAGG - Intronic
1129384015 15:75185776-75185798 CTGAGGGAAGGGAGTGGGGATGG + Intergenic
1130840872 15:87700331-87700353 CTGTGAGACAGCAGTTAGGAGGG + Intergenic
1130919933 15:88335445-88335467 CTGTGGGAACTCAGGGAGCAGGG + Intergenic
1132227938 15:100157549-100157571 CTGTGGGCCTCCAGTCAGGAGGG - Intronic
1132444291 15:101897359-101897381 CTGTGGGAGTTCAGTCAGGCTGG - Intergenic
1132857592 16:2053798-2053820 CAGATGGAATGCAGTGAGCAGGG - Intronic
1132889032 16:2195359-2195381 CTGTGGGGGTGGAGGGAGGAGGG + Intronic
1132949834 16:2555071-2555093 CAGTGGGAAAGCAGTGGGGTGGG + Intronic
1132964514 16:2645096-2645118 CAGTGGGAAAGCAGTGGGGTGGG - Intergenic
1133085167 16:3356551-3356573 TAGTGGGACTGCAGTGAAGAAGG - Exonic
1133522686 16:6574360-6574382 GCGTGGGAATGCTGTGAGGAGGG + Intronic
1134271479 16:12736853-12736875 AAGTGGGAAGGCAGTGGGGAGGG + Intronic
1135960403 16:26990142-26990164 CTGAAGGAAGGCAGTGAGGTGGG - Intergenic
1136234120 16:28904004-28904026 CTGTGGGGCTGCAGTGGGGGGGG + Intronic
1136716697 16:32288012-32288034 CTTGGGGAATGCAGTGGGTATGG + Intergenic
1136835074 16:33494257-33494279 CTTGGGGAATGCAGTGGGTATGG + Intergenic
1137225244 16:46498769-46498791 TAGTGGGAATGGAGTGAGTAGGG - Intergenic
1138267906 16:55673254-55673276 CTGATGGAATGCACTGAGGAGGG - Intronic
1138351572 16:56348786-56348808 CTCGGGGAGGGCAGTGAGGAGGG - Intronic
1139516280 16:67454169-67454191 CTGTGGGAGTGGAGTGGAGAGGG + Intronic
1139561232 16:67743705-67743727 CTGAGGTAAGGCAGTGGGGATGG - Intronic
1140975529 16:80056527-80056549 ATGTGAGAATGCAGTGAGAAGGG + Intergenic
1141376603 16:83536489-83536511 CAGTGGGAATGCAGTGAGTGTGG + Intronic
1141456974 16:84149258-84149280 GTCTGAGAATGGAGTGAGGATGG + Intronic
1141508605 16:84497511-84497533 CTCTGGGAGGGCAGTCAGGAGGG + Intronic
1142074244 16:88108223-88108245 CTGTGGGGATGCGGGGAGGGGGG + Intronic
1203009729 16_KI270728v1_random:229775-229797 CTTGGGGAATGCAGTGGGTATGG - Intergenic
1203145246 16_KI270728v1_random:1794578-1794600 CTTGGGGAATGCAGTGGGTATGG + Intergenic
1144098462 17:11922994-11923016 CTTTGGGAATTAAGTGAAGAGGG + Intronic
1145957386 17:28863974-28863996 CTGAGGGAATGGGGTGAGGTGGG - Intergenic
1146426122 17:32740952-32740974 CTGTGTAAATGAAGGGAGGAAGG - Intronic
1146798374 17:35798937-35798959 CTGTGTGGATGCTGGGAGGATGG + Intronic
1147484628 17:40800777-40800799 CAGTGGGGATGCAGAGAAGATGG + Intergenic
1148506620 17:48132466-48132488 CTGAGGAAATGCTCTGAGGAGGG - Intergenic
1148664864 17:49366879-49366901 GTGAGGAAATGCAGTGAGCAGGG - Intergenic
1149637953 17:58185404-58185426 CTGAGGGTGTGCAGGGAGGAGGG - Intergenic
1149932439 17:60769549-60769571 CTGTGGGCCTGCCGTGGGGAAGG + Intronic
1150003530 17:61456188-61456210 CTGTGGCAATGCCGAGAGGGCGG + Intronic
1150347903 17:64418722-64418744 CTTTGGGAGGCCAGTGAGGAAGG - Intergenic
1152039065 17:77891627-77891649 CTGTGGGATTGCAGGCAGAAGGG - Intergenic
1152595372 17:81235331-81235353 TGGTGGGTGTGCAGTGAGGATGG - Intronic
1153892084 18:9526656-9526678 CTTTGGAAATGTAGTGATGAGGG + Intronic
1153914337 18:9732509-9732531 GTGTGGGCATGCAGTGAGGTGGG + Intronic
1154285861 18:13056029-13056051 CTGTTGGAAACCAGTGAGGTAGG + Exonic
1155697589 18:28701180-28701202 CTTTGGGAATGTTGTGAGTAAGG + Intergenic
1156707219 18:39897958-39897980 CTGTGTGAGTCCAGTGAGCATGG - Intergenic
1157046587 18:44107515-44107537 CTGTGGCCATCCAGTGAGGAGGG - Intergenic
1157513184 18:48293257-48293279 TTGTGTGCATGCAGTGAGGAAGG - Intronic
1157670721 18:49526260-49526282 CAGTGAGAAAGCAGTGAGCACGG - Intergenic
1157751978 18:50187384-50187406 CTGAGGTGATGCAGTGAGAAAGG + Intronic
1157889083 18:51397311-51397333 AGGTGTGAATGCAGAGAGGAGGG - Intergenic
1157987147 18:52451082-52451104 CTGTGGGCATGTTGTGAGGCAGG + Intronic
1158202979 18:54960362-54960384 CTGAGAGGATGCAGTGGGGAAGG - Intergenic
1158257750 18:55572407-55572429 CTGAGAAAATGGAGTGAGGAGGG + Intronic
1159147428 18:64471949-64471971 CTGAGGGAAAGCAATGTGGATGG - Intergenic
1159225171 18:65523835-65523857 CTGTGGAAATGGAGTGATGGTGG + Intergenic
1159554704 18:69933077-69933099 CTGTGGCCCTGCAGTGAGGGAGG - Intronic
1159914032 18:74173152-74173174 TTGTAGGGAAGCAGTGAGGATGG + Intergenic
1160641062 19:137456-137478 CTGTGGGAGTTCAGTCAGGCTGG + Intergenic
1160812615 19:1019490-1019512 CTGGGGGGCTGCAGGGAGGAAGG + Intronic
1161512202 19:4678041-4678063 CTGTGGGGAGGCAGTGAGACAGG + Intronic
1162084193 19:8238575-8238597 CTGTGGGAAGGAAGTAAAGAGGG - Intronic
1162740594 19:12771470-12771492 CTGCGGGACTGCAGAGATGAGGG + Exonic
1163045072 19:14635346-14635368 CTTTGGGAAGGCAAGGAGGAAGG - Intronic
1164607297 19:29609370-29609392 CTGTGGGAGAGCAATGGGGATGG - Intronic
1165221018 19:34316956-34316978 CTGTGGGGTGGCAGTAAGGAGGG - Intronic
1166847114 19:45735323-45735345 CTCTGGGATTGCAGGAAGGATGG - Intronic
1167650895 19:50728046-50728068 CTGTGGGCATGCAGAGAGAGAGG + Intergenic
1167784753 19:51627736-51627758 CTGTGGGAGGGCTGTGGGGAGGG + Exonic
1168031445 19:53683033-53683055 CTTTGGGAATGGAGTGGGGCGGG + Intergenic
1168186862 19:54705622-54705644 CTGTGGGAATTCCATCAGGAGGG + Intergenic
1168581354 19:57558301-57558323 CTGGATGAATGCAGTGAGAAAGG + Intronic
924978522 2:199031-199053 CTGTGGGAATGCAGGGGGCCAGG - Intergenic
925276465 2:2651668-2651690 CTGTGGGAAAGCAGGGAGGCAGG + Intergenic
925428289 2:3769439-3769461 CTGATGGAATGGAGTGAAGACGG - Intronic
925472774 2:4180718-4180740 CTGAGGGCATCCAGTGAAGAAGG - Intergenic
925594366 2:5540407-5540429 CTGTGGGGACTCAGTGAGAAAGG - Intergenic
926152629 2:10433266-10433288 GTGTGGGAATGGTGTGGGGATGG + Intergenic
926420070 2:12687323-12687345 CTGTGGCCATGCAGAGAGGCAGG + Intergenic
926811756 2:16761014-16761036 TGGTGGGAATGCAGTGAGGAAGG - Intergenic
926853278 2:17224559-17224581 CTGTGGCATGGCAGTGAGGCTGG + Intergenic
926868972 2:17391579-17391601 CTCTGCTAAGGCAGTGAGGAAGG + Intergenic
926929793 2:18025157-18025179 CTGAGAGAATGCAATGAGAATGG - Intronic
927637569 2:24827367-24827389 CTGCAGCAGTGCAGTGAGGAGGG - Intronic
927722531 2:25394739-25394761 CGGTGTGAATGCAGTGAAAAAGG + Intronic
928549105 2:32354595-32354617 CTGTGGGGCTGGAGTGAGAAGGG - Intergenic
928824658 2:35405527-35405549 CTGTGTGCAAGCACTGAGGAAGG - Intergenic
929260773 2:39864281-39864303 CTGTGTGAAAGCAGCCAGGAGGG + Intergenic
930055200 2:47246525-47246547 CTGGGGATATGCAGTGAGGAAGG - Intergenic
930060252 2:47282594-47282616 CTGTAGGAGTTCAGTCAGGATGG + Intergenic
930443690 2:51443215-51443237 TTGTTGGAATGCAATGTGGAGGG - Intergenic
931067831 2:58606790-58606812 CTGTGGAAAAGCAGAGGGGAAGG + Intergenic
931591584 2:63889331-63889353 TAATGGGAATGCAGTCAGGAGGG + Intronic
931757916 2:65390391-65390413 CTGTGGGACTGGAGTGAGCCTGG + Intronic
932097012 2:68859814-68859836 CTGTGTGAATGGTCTGAGGAAGG + Intergenic
932484542 2:72075696-72075718 CTGAGGGAATGCGGAGAGGTGGG - Intergenic
932760320 2:74435334-74435356 CTGTGAGAATTCTGTGAGGCAGG + Intronic
933008653 2:77028401-77028423 GTGTGTTAATGAAGTGAGGAAGG - Intronic
933751475 2:85604708-85604730 CAGTGGGAATGCAGTTGGGCAGG - Intronic
933843426 2:86305811-86305833 CTCCGGGCATGCAATGAGGAGGG - Intronic
934523256 2:95033059-95033081 CTGTGAGAATGCAGTGGGCTGGG + Intronic
934571721 2:95376806-95376828 CTGAGGGCTGGCAGTGAGGATGG - Intronic
934573224 2:95384865-95384887 CAGTGGGAATGCAGTGGGTGGGG + Exonic
934764854 2:96874956-96874978 TTCTGGGGATGCAGTGAGGGAGG + Intergenic
937334946 2:121056486-121056508 CAGTGGGGATGGAGAGAGGATGG + Intergenic
937379085 2:121360071-121360093 CTATGTGACTGCAGCGAGGAAGG - Intronic
938589344 2:132721748-132721770 CTGTGGCAATGCTGCCAGGAAGG - Intronic
938727779 2:134122002-134122024 TTATAGGAAAGCAGTGAGGACGG - Intronic
941424048 2:165320491-165320513 CTCTGCCAAGGCAGTGAGGAAGG - Intronic
942093098 2:172513060-172513082 CTCTGGGGATTCAGTCAGGATGG + Intergenic
943666670 2:190616172-190616194 ATGTGTGGATGGAGTGAGGAGGG + Intergenic
944260532 2:197671051-197671073 ATGTGGAATTGCAGTGAGAAGGG - Intronic
944335296 2:198526597-198526619 AGGTGGGAAGGCAGGGAGGATGG + Intronic
945208999 2:207363127-207363149 CTGTGGGGGTGAAGTGGGGAGGG - Intergenic
946152733 2:217787344-217787366 CGGTGGGAGCGCAGGGAGGACGG + Intergenic
946441979 2:219704387-219704409 CTGGGGGAGGGCAGTGTGGAGGG - Intergenic
947365907 2:229394668-229394690 CTGTCGCACTGCAGTAAGGAAGG + Intronic
947876898 2:233473678-233473700 GTGTGGGAAAGCAGTGAGGAGGG + Intergenic
947949613 2:234135957-234135979 CTGTGGGAGACCAGTGAGGCTGG + Intergenic
948362168 2:237429943-237429965 CTGAGGGACTCCAGTGAGCATGG - Intergenic
1168868416 20:1108537-1108559 CTGGTGGAATGAAGTCAGGATGG + Intergenic
1169112213 20:3041593-3041615 GTGTGGGAATGAAGTGAGGAAGG - Intergenic
1170241904 20:14175368-14175390 CTGTGCTAATGAAGTGTGGAGGG + Intronic
1170761285 20:19253648-19253670 CTATGGGAAACCTGTGAGGATGG - Intronic
1171072364 20:22085554-22085576 CTGTGGGAGTGCAATAGGGAAGG - Intergenic
1171486656 20:25490725-25490747 GTGGGGGACTGCAGTGAGAAGGG + Intronic
1172132880 20:32667431-32667453 CTGTGGGCAGGCAGTGAGACAGG + Intergenic
1172488188 20:35312543-35312565 CTGTGAGAGTGCAGGGAGGATGG + Intronic
1172714462 20:36952291-36952313 CTCTGGGAATGCAGTTGGGATGG - Intergenic
1172986168 20:38992104-38992126 CTGTTGGAATTCAGTGTGGATGG + Intronic
1173197540 20:40928255-40928277 CTGTGGGAGTGCAGAGGAGAGGG - Intergenic
1174238738 20:49115763-49115785 CTGTGTGAGTGCACTGATGAAGG - Exonic
1174708816 20:52684224-52684246 CTCTGGGAACGCAGAGGGGATGG - Intergenic
1174738927 20:52993256-52993278 CCGGGGGAATGCAGTGAGCAGGG - Intronic
1175753208 20:61513434-61513456 CTGTGGGGTTGCTGTGAGGTTGG - Intronic
1175791860 20:61744945-61744967 CTGTGGGAGAGCACTAAGGAAGG + Intronic
1175826927 20:61941610-61941632 CTGGGGAAATGAAGTGGGGAGGG - Intergenic
1175943526 20:62548592-62548614 GTGTGGGGCTGCCGTGAGGAGGG + Intergenic
1176103818 20:63376465-63376487 GTGTGGGAAAGCAGTGAGGAGGG - Intronic
1176290825 21:5043725-5043747 CTGGGAGAATGCAGTGAGGAAGG + Intergenic
1179623284 21:42632732-42632754 CTGTGGGACTGGTGGGAGGAAGG + Intergenic
1179828416 21:43981412-43981434 CAGTGGGGCTGCAGTGGGGATGG - Intronic
1179866430 21:44219916-44219938 CTGGGAGAATGCAGTGAGGAAGG - Intergenic
1180195930 21:46194391-46194413 CTGAGTGAATGTAGAGAGGAGGG - Intronic
1181008466 22:20026062-20026084 CTGTGCGACTGCTGTGAGGTGGG - Intronic
1181043229 22:20202769-20202791 CTGTGGGACTGCAGGGGAGACGG + Intergenic
1182060276 22:27392444-27392466 CCGTGGGGATGCAGACAGGAAGG - Intergenic
1183433841 22:37782071-37782093 CAGGGGGACGGCAGTGAGGATGG - Intergenic
1183489141 22:38107525-38107547 CTGGGAGGCTGCAGTGAGGAGGG + Intronic
1184291183 22:43498892-43498914 CTGTGGGAATGAGGAAAGGAAGG - Intronic
1184722999 22:46326346-46326368 CTGTGCTAATGCAGTGCTGAGGG - Intronic
1184904835 22:47474679-47474701 CTGTGGGAATGCAAACAGCATGG + Intronic
949798226 3:7874602-7874624 CTGTGCGAAGGAAGTGAGAAAGG + Intergenic
950117367 3:10460109-10460131 CTCTGGGAATGAAGTGCTGATGG + Intronic
950139890 3:10608196-10608218 CAGTGTGGATGGAGTGAGGAGGG - Intronic
950237876 3:11339507-11339529 CAGTGGGAATTCAATGAGAAAGG + Intronic
950314796 3:11991803-11991825 CTCTGGGAATGCAGAGAAGGGGG + Intergenic
951039934 3:17978849-17978871 CTTTGGGACTGCAGTGGGAATGG - Intronic
951083735 3:18485246-18485268 CTGTCAGAATGCATTGAGAAGGG - Intergenic
951362832 3:21744983-21745005 GTGTGGGAGAGCAGAGAGGAAGG - Intronic
952827592 3:37537187-37537209 CTGAGGGAGTGCAATGAGGCTGG + Intronic
953821267 3:46209309-46209331 TTGTAGCAATGCCGTGAGGAAGG - Intronic
954710002 3:52500955-52500977 CAGTGGGAATGCAGTGCAGATGG - Intronic
954715017 3:52522648-52522670 CTGAGGGAATGAAGCAAGGACGG - Exonic
956327507 3:68070124-68070146 CTCTGCTAATGCAGTGTGGAAGG - Intronic
958132314 3:89443721-89443743 CTGGGGGAATACAGTGGTGAAGG + Intronic
959886915 3:111513500-111513522 TTGTGTGAATGAAGTGTGGATGG - Intronic
959914217 3:111797886-111797908 CTGTGGGAAGCCACTGTGGAAGG + Intronic
960619748 3:119626513-119626535 TTGTGGGGATGCTGTGAGGCTGG + Intronic
961012694 3:123447135-123447157 CTGTGGGAATGCAGTGAGGAAGG - Intronic
962290697 3:134134229-134134251 GTGTGGGACTGCAGTTTGGAGGG - Intronic
962304852 3:134277004-134277026 CTGAAGGAATACAGTGAGAATGG + Intergenic
963052254 3:141152233-141152255 CTGTGGGAATGCAGGGAGCCTGG - Intergenic
963433028 3:145233906-145233928 CTGTGGGAGTTCAGTCAGGATGG + Intergenic
963525629 3:146411042-146411064 CTGTGTGAATGGTGTGTGGATGG - Intronic
963624355 3:147652177-147652199 ATGTGATAATGTAGTGAGGAGGG - Intergenic
964019892 3:151997025-151997047 CTGAGTGAATGCAGTGTGCAGGG - Intergenic
964663837 3:159151014-159151036 GTGTGGGAATGCAGGTGGGAAGG + Intronic
965083427 3:164064780-164064802 CTGTGCTAAGGCAGTGAAGAAGG + Intergenic
965367045 3:167813883-167813905 CTGTGTGGCTGCAGTGGGGAGGG - Intronic
965448798 3:168810633-168810655 AAGTGGGAGTGCAGTGTGGAGGG + Intergenic
966130586 3:176633687-176633709 CTGTGGGAATGCAGGAAGGTGGG + Intergenic
967957298 3:194887050-194887072 CTCTGGTAGGGCAGTGAGGAAGG - Intergenic
968278672 3:197459437-197459459 TAGTAGGGATGCAGTGAGGACGG + Intergenic
968278849 3:197460154-197460176 TAGTAGGGATGCAGTGAGGACGG + Intergenic
968351471 3:198057297-198057319 GAGTGGGAATGAAGTGAGTATGG - Intergenic
968893672 4:3385912-3385934 CTGTGGGAGGGCAGTGATGCTGG + Intronic
968900673 4:3430248-3430270 CTGTGGGAAGATAGTGTGGACGG + Intronic
969333412 4:6492976-6492998 GTGTTGGAATGGAGTGAGGAGGG - Intronic
969352887 4:6608328-6608350 CTGTGGGATTGTGGTGAGGGTGG - Intronic
969489670 4:7491883-7491905 CTGTGGGAAGGCAGACAGCAGGG + Intronic
969624943 4:8297625-8297647 CTGTGGGAAGGGAGTGGGGCAGG + Intronic
970243396 4:14032802-14032824 CTGGGGAAAGGCAGTGAGCATGG - Intergenic
970437793 4:16052265-16052287 CTGTGGGAGTGCAGTGAGTAAGG - Intronic
971132525 4:23828478-23828500 CTGTGGGTTTGGTGTGAGGAGGG + Exonic
971385103 4:26135053-26135075 AAGGAGGAATGCAGTGAGGAAGG - Intergenic
971666976 4:29499955-29499977 CTGTGGGAATTCTGTGAACATGG - Intergenic
972143458 4:35990803-35990825 CTGCTTGAATGCAGTGAGGGTGG - Intronic
972451217 4:39200566-39200588 ATGTGGCAAGGAAGTGAGGAAGG - Intronic
973663827 4:53137291-53137313 CTTTGGGAAAGAAGTGAGGAAGG - Intronic
974860259 4:67511808-67511830 CTGTGGGAATCCACTGGGAAAGG + Intronic
975399208 4:73915043-73915065 CTCTTGGAATGCAATCAGGAGGG - Intergenic
975542711 4:75531339-75531361 CTGTGTGATTACACTGAGGAAGG + Intronic
975727268 4:77304088-77304110 TTCTGGTAAAGCAGTGAGGAAGG + Intronic
975741768 4:77436113-77436135 CTGCAGGAATGCACTGAGCATGG - Intergenic
979529805 4:121757795-121757817 CTGTGGGAATGACATAAGGATGG + Intergenic
979841241 4:125443393-125443415 CTGAGGGAATGTAGTGAAGACGG - Intronic
979913836 4:126405174-126405196 CTCTGGGCATGGAGTGGGGATGG - Intergenic
980088333 4:128415813-128415835 CTGTGACAGTGCAATGAGGAAGG + Intergenic
980509870 4:133771687-133771709 CTCTGCTAAGGCAGTGAGGAAGG - Intergenic
981781197 4:148431639-148431661 CTGTGGGCATTCAGTGAGAGTGG - Intronic
982695730 4:158597810-158597832 CTGTGTGTATGCTGTGGGGATGG - Intronic
984402507 4:179285593-179285615 CTGTTGGGATGCACTCAGGATGG + Intergenic
984770175 4:183430579-183430601 CTGTGGGACAGCAGAGAGAAGGG + Intergenic
984874733 4:184357020-184357042 CTGTGGGGATGCAGCAAAGATGG + Intergenic
985230095 4:187806321-187806343 CGGTGGGGAGGAAGTGAGGATGG + Intergenic
985805384 5:2039265-2039287 CTGTGGGAAGGGACTGGGGAAGG - Intergenic
985835394 5:2268189-2268211 CGGTGGAAATGCACTGAGGACGG - Intergenic
987192139 5:15489381-15489403 CTGTTGGTATCCAGTGAGGGAGG + Intergenic
987362894 5:17122589-17122611 ATGTGAGGATGCAGTGAGAAGGG + Intronic
988018864 5:25597437-25597459 TTGTGAGAAAACAGTGAGGATGG - Intergenic
990442304 5:55859095-55859117 CTGTGGGCATGCATAGAGCATGG + Intronic
991979395 5:72215715-72215737 CATTGGGAATGCACTGGGGAAGG + Intergenic
992411524 5:76510392-76510414 CTTGGGGGATGCAGTGATGACGG + Intronic
994496395 5:100518211-100518233 CTGTGAGAATGCAGTCTGAAAGG - Intergenic
994728356 5:103462844-103462866 CAGTGTGAATGCTGTGAGGTGGG - Intergenic
994776188 5:104037462-104037484 CTGTGGAAATGTGGTAAGGATGG - Intergenic
994930455 5:106176433-106176455 CTTTGGGAAGGCAATGAGGGTGG - Intergenic
995603417 5:113823984-113824006 CTGAGGGGATGCAATGAGGCTGG - Intergenic
997949972 5:138234648-138234670 CTGTGGGAGGTCAGTGAGGATGG + Intergenic
998778865 5:145633903-145633925 CTATGGGAATGCAGGGAACATGG - Intronic
999274303 5:150318822-150318844 CAGTGGGACTGCAGGGAGAAGGG + Intronic
999299443 5:150482074-150482096 CTGTGGGAATGTGGAGGGGAAGG - Intergenic
999396783 5:151234602-151234624 CTGGGGGAATGCAGAGAGCGAGG + Intronic
999661004 5:153862807-153862829 CTGTGGGAGTTCAGTCAGGCTGG + Intergenic
1001001449 5:168011221-168011243 CTGTGGGAATGATGTGCAGATGG + Intronic
1001011555 5:168103627-168103649 CTGATGTAATGCACTGAGGAGGG - Intronic
1001240002 5:170061411-170061433 CTGGGGGAATGAAATGAGCATGG + Intronic
1001445523 5:171779776-171779798 GAGTGGGAATGAAGCGAGGAAGG + Intergenic
1002306634 5:178287407-178287429 CTCTGTGAATGCAGAGATGAAGG - Intronic
1002384083 5:178852706-178852728 CTGCTGGAATGCAGTGAGTCAGG - Intergenic
1002458211 5:179358051-179358073 CAGTGGGAGTGGGGTGAGGAGGG + Intergenic
1002736288 5:181388965-181388987 CTGTGGGAGTTCAGTCAGGCTGG - Intergenic
1002748409 6:85859-85881 CTGTGGGAGTTCAGTCAGGCTGG + Intergenic
1002820873 6:723532-723554 CTCTGGGCATGGAGAGAGGATGG + Intergenic
1003563624 6:7204029-7204051 CTGTGGGAATGCCGTCAGCCAGG - Intronic
1003579284 6:7325080-7325102 CTGTGGGAGTGGAGAGAGAAGGG - Intronic
1003980742 6:11387673-11387695 TGGAAGGAATGCAGTGAGGAAGG - Intergenic
1004065715 6:12241941-12241963 TTATGGGAATGCAGTAAAGATGG - Intergenic
1005024222 6:21447472-21447494 CCGTGTGTTTGCAGTGAGGATGG - Intergenic
1005483866 6:26280725-26280747 TAGTGGGAAGGCCGTGAGGAAGG + Intergenic
1005488531 6:26324161-26324183 CTGGGGGAAGGAAGGGAGGAAGG + Intergenic
1006893906 6:37453742-37453764 TTGTTGGAATGTGGTGAGGAGGG + Intronic
1007240427 6:40420860-40420882 CTGTGGTAAGGAAGTGTGGAAGG + Intronic
1007461250 6:42020670-42020692 CTGTGGGAATTCTGAGAGAAGGG - Intronic
1007474022 6:42107260-42107282 CAGGGGGAATGAAGTCAGGAGGG + Exonic
1007567120 6:42860078-42860100 GTGAGGGAATGCAGTGTAGAAGG + Intronic
1007950695 6:45869629-45869651 CCTTGGGAAAGCAGAGAGGAGGG - Intergenic
1008036752 6:46753444-46753466 CTGTGGCAATGCACAGGGGAGGG + Intronic
1008774262 6:55017068-55017090 GTGTGGGAAGGCAGTTACGACGG - Intergenic
1010021395 6:71163858-71163880 CTGGAGGAATGGAGTGAGTATGG - Intergenic
1011157731 6:84352026-84352048 CTGTGGAAAGGAAGGGAGGAAGG + Intergenic
1014133964 6:117866459-117866481 CTCTGCTAAGGCAGTGAGGAAGG - Intergenic
1015966454 6:138699060-138699082 CTTTGGGCAAGCAGTGAGTAGGG + Intergenic
1016428063 6:143955472-143955494 ATGTGGAGATGCAGTGAGGAGGG + Intronic
1016886948 6:148967692-148967714 CTGTGGGCATGCGGTGTGCAGGG - Intronic
1017703300 6:157096563-157096585 CTGTGGCAATGTGGAGAGGAAGG - Intronic
1018346600 6:162905292-162905314 CTGTGTGAATGGAGTGGGAAGGG + Intronic
1018662927 6:166105129-166105151 CCATGGGAAGGCAGTGTGGATGG - Intergenic
1019042446 6:169118413-169118435 CTGTGGGGGTGGAGTGGGGATGG - Intergenic
1019162325 6:170076858-170076880 CTGTGGGGAAGAAGAGAGGAGGG - Intergenic
1019241386 6:170664493-170664515 CTGTGGGAGTTCAGTCAGGCTGG - Intergenic
1019501094 7:1365094-1365116 CAGAGGGGATGCAGTGGGGAGGG - Intergenic
1019672332 7:2287839-2287861 CTTTGGGACTGCAGTGAGCCAGG + Intronic
1019712040 7:2522193-2522215 CTGGGGGAAGGGAGGGAGGAGGG + Intronic
1020250407 7:6463669-6463691 GTTTGGGACTGCAGTGAGGAAGG + Intronic
1022280928 7:28908417-28908439 CTGAGGGAAGGGGGTGAGGAGGG + Intergenic
1022547238 7:31200756-31200778 CTGTGGGAAGACAATGAAGATGG + Intergenic
1023073308 7:36458990-36459012 CATTGGGAAGGCAGAGAGGAGGG + Intergenic
1023769445 7:43541846-43541868 CTGGGTGAATTCAGTGAGAAAGG - Intronic
1024023837 7:45394612-45394634 CTGTGGGAGTTCAGTCAGGCTGG - Intergenic
1024838594 7:53556099-53556121 CTCGGGGAATCCAGTGAGTAAGG - Intergenic
1025043874 7:55673991-55674013 CAGTGAGAAAGCAGTGAGTAGGG - Intergenic
1025299349 7:57805739-57805761 AGGAGGGAATGCAGGGAGGAAGG - Intergenic
1026144501 7:67734808-67734830 CTGGGGGAAGGCAGTGTAGAAGG - Intergenic
1026329132 7:69336893-69336915 CCCAGGGAATGCAGTGGGGATGG - Intergenic
1026590104 7:71686971-71686993 CTGTGGGAAGGAATTGAGGGTGG + Intronic
1026896026 7:74010531-74010553 CGGTGGGAAGCCAGCGAGGAGGG - Intergenic
1027261507 7:76468057-76468079 CGGGGGGAATGGAGAGAGGAGGG + Intronic
1028596824 7:92554748-92554770 CTGTGGGAAGGGTGGGAGGAGGG - Intergenic
1028874310 7:95803267-95803289 TTGTGGACATGCAGTGTGGATGG - Intronic
1029788406 7:102816758-102816780 ATGTGGGGAGGCAGGGAGGATGG - Intronic
1031484449 7:122310754-122310776 CTGCGGGAATGCAGAGGAGAAGG - Intergenic
1031894656 7:127335312-127335334 GTGGGGGAATGAAGTGAGGTTGG + Intergenic
1032026565 7:128447247-128447269 CTGTGGAAGTAAAGTGAGGATGG - Intergenic
1032385702 7:131521842-131521864 CTGTGGGAATGTGGTGGGTATGG - Intronic
1032527463 7:132590224-132590246 CTGAGGAAATGAACTGAGGAAGG + Intronic
1032534141 7:132646556-132646578 CTGTGAGGACACAGTGAGGATGG + Intronic
1033180774 7:139175754-139175776 GAGTGGGAGGGCAGTGAGGATGG + Intronic
1034642106 7:152612428-152612450 GTGTGGGGGTGGAGTGAGGATGG - Intergenic
1034954116 7:155322826-155322848 CTCCGGGCATGCAGTCAGGAAGG + Intergenic
1035506731 8:143602-143624 CTGTGGGAGTTCAGTCAGGCTGG + Intergenic
1036705800 8:11045738-11045760 CTGTGGAAATTCAATAAGGAAGG - Intronic
1037753886 8:21699314-21699336 CTGCAGGCATGCAGTGAGGGGGG + Intronic
1038095074 8:24299888-24299910 CATTGGGAATGCAGTAAGGATGG + Intronic
1038177486 8:25194452-25194474 CGGAGGGAAGGCAGGGAGGATGG - Intronic
1038196554 8:25373399-25373421 CTTTGGGAACTCAGTGGGGAAGG - Intronic
1039322241 8:36445207-36445229 CTGTGGTATTGCAGTAAAGAAGG + Intergenic
1039418681 8:37417831-37417853 TTGTGTGTATGCAGTGGGGAGGG - Intergenic
1040008553 8:42641678-42641700 CTGTTAGAATGGAGTGAGCATGG - Intergenic
1040015495 8:42696028-42696050 TTGTGGGAATGCAAGGAGGAAGG - Intergenic
1043107890 8:76137837-76137859 CTGTGAGAATGCAGAAAGGACGG - Intergenic
1045506903 8:102785191-102785213 CTGTTGGCAGGCAGTGAGGGGGG - Intergenic
1046133827 8:110000813-110000835 GAGTGGGAATGAAGTGAGGTTGG - Intergenic
1046378281 8:113416926-113416948 CTGTATGAATACTGTGAGGAAGG + Intronic
1046742072 8:117840244-117840266 CTGGGGCAGTGCAGTCAGGAAGG + Intronic
1047417744 8:124679265-124679287 GTGTGCGACTGCAGTGAGGATGG - Intronic
1047555335 8:125923297-125923319 CTGATAAAATGCAGTGAGGATGG + Intergenic
1047661503 8:127042018-127042040 CTCTGGGAAGCCAGTGATGATGG + Intergenic
1047883357 8:129220515-129220537 CTGTGGGGGTGCAGTGATTATGG + Intergenic
1048117332 8:131539402-131539424 ATATGGGAATGTAGAGAGGATGG - Intergenic
1048148303 8:131867491-131867513 CTGTGGGCTTGGAGGGAGGAAGG - Intergenic
1048678008 8:136806445-136806467 CCGGGTCAATGCAGTGAGGAAGG + Intergenic
1048709476 8:137192785-137192807 GTGTGGGAATGCAAGGAGCAAGG - Intergenic
1049161593 8:141101684-141101706 CAGTGGGAGGGCAGTGGGGAAGG - Intergenic
1049347759 8:142147847-142147869 GTGTGGGAGTGCAGAGAGGAAGG - Intergenic
1049392215 8:142377736-142377758 CTCTGGGGGTGCAGTGAAGAGGG - Intronic
1049600563 8:143505555-143505577 GTGTGGGAGTGGAGTGGGGAGGG - Intronic
1049773598 8:144394816-144394838 CTGTGGGATGGCTGTGGGGATGG + Intronic
1050655661 9:7825929-7825951 CTGTAAGACTGCTGTGAGGAGGG + Intronic
1050774798 9:9246486-9246508 CTGTGGGAGTGGAGGCAGGAAGG - Intronic
1050876424 9:10643141-10643163 ATGTGGAAATGCAGTCATGAAGG + Intergenic
1052777496 9:32747263-32747285 CTGTGGGAATTAAGTAAGAATGG + Intergenic
1054754409 9:68942913-68942935 CTGTGGAAAGGCAGTGGGCATGG + Intronic
1056132492 9:83600138-83600160 CTGTGGGTCTGCCGTGGGGAAGG - Intergenic
1056691031 9:88808912-88808934 GTGTGAGAATCCAGTAAGGAAGG - Intergenic
1057133925 9:92673245-92673267 CAGTGGGAATGCAGAGGAGAGGG + Intergenic
1057141092 9:92727255-92727277 CTGAGGGTATGCAGTGATTAGGG - Intronic
1057171974 9:92968472-92968494 CTGTGGGAGTGGATGGAGGAGGG - Intronic
1057397527 9:94693028-94693050 CTGCTGGAATGCAGAGGGGAGGG + Intergenic
1058351204 9:104026539-104026561 GTGTGGTAATGCAGTTAGGAGGG + Intergenic
1058379297 9:104361248-104361270 CAATAGGAATGCAGTGATGAGGG - Intergenic
1058782979 9:108357296-108357318 TTTTGGGAAGGCAGTGAGGATGG - Intergenic
1058837245 9:108869096-108869118 CTGAGTGACTGCAGTTAGGAGGG - Exonic
1060018418 9:120107377-120107399 GTTTGGGAATGCAGGGAGAAAGG + Intergenic
1061332525 9:129904716-129904738 CTGTGGGAAAGAAGGCAGGAAGG - Intronic
1061924925 9:133801299-133801321 CTGTGAGGATGCAGTGAGCCCGG - Intronic
1062618921 9:137410898-137410920 CTGTGGGAAAGCACTGAGGCCGG - Intronic
1062699734 9:137892627-137892649 CTGTGAGACTGCAGGCAGGAGGG + Intronic
1203601578 Un_KI270748v1:13727-13749 CTGTGGGAGTTCAGTCAGGCTGG - Intergenic
1185568864 X:1117237-1117259 CTGTGGGTAAACAGTCAGGAAGG + Intergenic
1185656587 X:1690446-1690468 CTGTGGGAGGGGAATGAGGAGGG - Intergenic
1186817446 X:13251912-13251934 CTGTGAAAATGAAGAGAGGAGGG - Intergenic
1188028763 X:25240219-25240241 CTGTGTAAATTCAGTGAGGGAGG - Intergenic
1188068052 X:25685881-25685903 CTGCGGGAAGGCAGTGAAGGTGG + Intergenic
1189280061 X:39814896-39814918 CTGTAGCAAAGCAGTCAGGAAGG - Intergenic
1189384087 X:40522339-40522361 CTGTGGTACAGCAGAGAGGAGGG + Intergenic
1190605184 X:52134182-52134204 CTCAGGGAATTGAGTGAGGATGG + Intergenic
1192109550 X:68350535-68350557 CTGTCGGAAAGAAGGGAGGAAGG - Intronic
1192216069 X:69159145-69159167 TTGGGGGAAAGCAGTCAGGAAGG - Intergenic
1192340571 X:70260095-70260117 CTGTAGGCAGGCAGTGGGGAAGG - Intergenic
1194335888 X:92645247-92645269 CTCTTAGAATCCAGTGAGGATGG - Intergenic
1194497482 X:94635480-94635502 CTCTGGTAAGGCAGTGTGGAAGG + Intergenic
1196093923 X:111777868-111777890 CTGTGGAAACACAGAGAGGAGGG - Intronic
1196181625 X:112698305-112698327 CTGTGGTAATCCAGTGTAGATGG + Intergenic
1197762238 X:130036119-130036141 CTGGGTGAATGAGGTGAGGAGGG - Intronic
1198220950 X:134601482-134601504 CTGTGTTAATGCAGTGAGTCAGG - Intronic
1198525860 X:137500026-137500048 CTAGGGCAATGCAGAGAGGATGG + Intergenic
1199113259 X:143959354-143959376 CTCTGCTAAGGCAGTGAGGAAGG - Intergenic
1199779006 X:151041160-151041182 CTGTGAGACAGCAGTGAGGCTGG - Intergenic
1199785797 X:151103766-151103788 CTCTGAGGATGCAGTGTGGATGG + Intergenic
1199969580 X:152849638-152849660 TGGTGGGGCTGCAGTGAGGATGG - Intronic
1200644325 Y:5761998-5762020 CTCTTAGAATCCAGTGAGGATGG - Intergenic
1201229757 Y:11852773-11852795 CTGTGGGAATGGACTGTTGAAGG - Intergenic
1201853955 Y:18520327-18520349 CTGTGGGGGTTCAGTCAGGATGG - Intergenic
1201879366 Y:18800057-18800079 CTGTGGGGGTTCAGTCAGGATGG + Intronic