ID: 961012924

View in Genome Browser
Species Human (GRCh38)
Location 3:123448156-123448178
Sequence CGCCCGGGTGCTGCCCCCGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 271}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961012904_961012924 30 Left 961012904 3:123448103-123448125 CCGCCCGCCGAGGCAGCCGCCGC 0: 1
1: 0
2: 5
3: 274
4: 4594
Right 961012924 3:123448156-123448178 CGCCCGGGTGCTGCCCCCGCTGG 0: 1
1: 0
2: 1
3: 14
4: 271
961012905_961012924 27 Left 961012905 3:123448106-123448128 CCCGCCGAGGCAGCCGCCGCCGC 0: 1
1: 0
2: 12
3: 292
4: 803
Right 961012924 3:123448156-123448178 CGCCCGGGTGCTGCCCCCGCTGG 0: 1
1: 0
2: 1
3: 14
4: 271
961012907_961012924 23 Left 961012907 3:123448110-123448132 CCGAGGCAGCCGCCGCCGCCGAG 0: 1
1: 0
2: 5
3: 108
4: 662
Right 961012924 3:123448156-123448178 CGCCCGGGTGCTGCCCCCGCTGG 0: 1
1: 0
2: 1
3: 14
4: 271
961012921_961012924 -9 Left 961012921 3:123448142-123448164 CCGCCCGCAGGGGGCGCCCGGGT 0: 1
1: 0
2: 1
3: 28
4: 150
Right 961012924 3:123448156-123448178 CGCCCGGGTGCTGCCCCCGCTGG 0: 1
1: 0
2: 1
3: 14
4: 271
961012915_961012924 0 Left 961012915 3:123448133-123448155 CCGCCGCCGCCGCCCGCAGGGGG 0: 1
1: 1
2: 11
3: 104
4: 654
Right 961012924 3:123448156-123448178 CGCCCGGGTGCTGCCCCCGCTGG 0: 1
1: 0
2: 1
3: 14
4: 271
961012918_961012924 -6 Left 961012918 3:123448139-123448161 CCGCCGCCCGCAGGGGGCGCCCG 0: 1
1: 0
2: 5
3: 31
4: 263
Right 961012924 3:123448156-123448178 CGCCCGGGTGCTGCCCCCGCTGG 0: 1
1: 0
2: 1
3: 14
4: 271
961012910_961012924 8 Left 961012910 3:123448125-123448147 CCGCCGAGCCGCCGCCGCCGCCC 0: 2
1: 6
2: 61
3: 319
4: 1453
Right 961012924 3:123448156-123448178 CGCCCGGGTGCTGCCCCCGCTGG 0: 1
1: 0
2: 1
3: 14
4: 271
961012906_961012924 26 Left 961012906 3:123448107-123448129 CCGCCGAGGCAGCCGCCGCCGCC 0: 1
1: 2
2: 50
3: 1358
4: 2410
Right 961012924 3:123448156-123448178 CGCCCGGGTGCTGCCCCCGCTGG 0: 1
1: 0
2: 1
3: 14
4: 271
961012909_961012924 11 Left 961012909 3:123448122-123448144 CCGCCGCCGAGCCGCCGCCGCCG 0: 1
1: 6
2: 39
3: 204
4: 871
Right 961012924 3:123448156-123448178 CGCCCGGGTGCTGCCCCCGCTGG 0: 1
1: 0
2: 1
3: 14
4: 271
961012908_961012924 14 Left 961012908 3:123448119-123448141 CCGCCGCCGCCGAGCCGCCGCCG 0: 1
1: 4
2: 20
3: 150
4: 800
Right 961012924 3:123448156-123448178 CGCCCGGGTGCTGCCCCCGCTGG 0: 1
1: 0
2: 1
3: 14
4: 271
961012917_961012924 -3 Left 961012917 3:123448136-123448158 CCGCCGCCGCCCGCAGGGGGCGC 0: 1
1: 1
2: 28
3: 55
4: 426
Right 961012924 3:123448156-123448178 CGCCCGGGTGCTGCCCCCGCTGG 0: 1
1: 0
2: 1
3: 14
4: 271
961012911_961012924 5 Left 961012911 3:123448128-123448150 CCGAGCCGCCGCCGCCGCCCGCA 0: 1
1: 7
2: 35
3: 172
4: 966
Right 961012924 3:123448156-123448178 CGCCCGGGTGCTGCCCCCGCTGG 0: 1
1: 0
2: 1
3: 14
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961012924 Original CRISPR CGCCCGGGTGCTGCCCCCGC TGG Exonic
900391075 1:2434206-2434228 TGCCCAGGCGCGGCCCCCGCCGG - Intronic
901686084 1:10944352-10944374 CGCACGGGTGTTGCCTCTGCTGG - Intergenic
902263935 1:15247589-15247611 CTCCCGGGGGCTTCCTCCGCGGG - Intronic
903458400 1:23504274-23504296 CGCCCGGGAGCCGCCCCGTCCGG + Intergenic
903467151 1:23559571-23559593 CGCCTCGGCCCTGCCCCCGCCGG + Exonic
905033900 1:34904929-34904951 GGCCCGGGCCCTGCCCCTGCTGG + Exonic
905173973 1:36125056-36125078 CGCCCGGCGGCCGCGCCCGCAGG - Exonic
910891641 1:92026084-92026106 CGCCCGGCAGCTGCTCCCTCTGG - Intergenic
910981172 1:92961330-92961352 CGGCCGGGTGCTCCCGCAGCTGG + Intronic
911092561 1:94029502-94029524 CTCCCTGGTGCTGCACCTGCAGG + Exonic
912775147 1:112502153-112502175 CGCGCAGGTGCTGCGCCCGCGGG + Intronic
912844022 1:113063576-113063598 CGCCCGGCAGCTGCCCCGTCCGG - Intergenic
913186534 1:116374060-116374082 AACCCGGAGGCTGCCCCCGCCGG - Exonic
913191748 1:116418762-116418784 CGCCCGGCTGCGGCCCCAGGCGG + Intergenic
914908984 1:151769347-151769369 CGCCCGGCAGCTGCCCCGTCCGG - Intronic
916496760 1:165354468-165354490 CGCCCGGGTACTGCCTGCTCTGG + Intronic
917304624 1:173613428-173613450 CGCCCGGCAGCCGCCCCCTCTGG + Intronic
917553311 1:176058052-176058074 CGCCCGGCAGCCGCCCCGGCCGG + Intronic
918215823 1:182391495-182391517 CTCCCGCGTGCTTCCGCCGCTGG - Intronic
918812485 1:189139813-189139835 CGCCCGGCAGCTGCCCCATCCGG - Intergenic
923174891 1:231454310-231454332 CGCCCGGCAGCTGCCCCGTCTGG + Intergenic
1062909787 10:1205169-1205191 TGCCCGGGGGCTGCCTCGGCTGG + Intronic
1065738059 10:28771933-28771955 CGCCCGGCAGCTGCCCCGTCTGG + Intergenic
1066180571 10:32957897-32957919 CGCCCGGGGGCTGCCAGCGCCGG + Intronic
1067391158 10:45865388-45865410 CGCCCGGCTGCCGCCCCGTCTGG - Intergenic
1067478069 10:46579152-46579174 CGCCATGGGGCTGCTCCCGCAGG - Exonic
1067613742 10:47744142-47744164 CTCCCCGGTGCTGCACCGGCAGG + Intergenic
1067616671 10:47762635-47762657 CGCCATGGGGCTGCTCCCGCAGG + Intergenic
1068673246 10:59744419-59744441 CGCCCGGCAGCTGCCCCTTCCGG + Intergenic
1069942415 10:71964623-71964645 CGAGCGGATGCTGCCCGCGCCGG + Exonic
1070162585 10:73874717-73874739 CGCCCCGGAGCCGCCCTCGCTGG + Intergenic
1070742897 10:78914065-78914087 GGCCCGGCTGCTGCCGCTGCTGG + Intergenic
1071997732 10:91163548-91163570 CGCTCGGGCCCTTCCCCCGCCGG + Intronic
1073432279 10:103494255-103494277 CCCCCGGCTGCAGCCCCAGCAGG + Exonic
1074772274 10:116742074-116742096 CGCGCGGGGGCTGCACACGCGGG + Intronic
1074772581 10:116743059-116743081 GGCCTGGGTCCTGCCCGCGCCGG - Intergenic
1075013851 10:118895818-118895840 CGCCCGGCCGCTGCCCCGTCCGG + Intergenic
1077298973 11:1838538-1838560 AGCCGGGGAGCTGGCCCCGCAGG + Intergenic
1078561705 11:12378011-12378033 CGCCCGGGCGCTGCCCTCCTGGG + Intronic
1080097936 11:28430154-28430176 CGCCCGGCAGCTGCCCCGTCTGG + Intergenic
1082166421 11:48955645-48955667 CGCCCGGCAGCTGCCCCTTCTGG - Intergenic
1082935672 11:58654255-58654277 CGCCCAGGGGCTGCCCACGTGGG + Intronic
1084013293 11:66364391-66364413 CAGCCGGCTGCTGCCCCTGCTGG - Exonic
1084315713 11:68344081-68344103 CGCCTGGGTGCATCGCCCGCAGG + Intronic
1084338316 11:68475514-68475536 CGCCCGGCCGCTGCCCCGTCCGG - Intronic
1084588716 11:70078349-70078371 CACCCGGCTGCTGGTCCCGCGGG - Exonic
1085159666 11:74328525-74328547 CGCCCGGCTGCCGCCCCGTCCGG + Intergenic
1088604250 11:111512909-111512931 CGTCCGGGAGCTGCAGCCGCGGG + Intergenic
1090229036 11:125088696-125088718 CGCCCGAGTGCTGGCCCTGGAGG - Exonic
1090686685 11:129129304-129129326 CGCCCGGCAGCTGCCCCGTCTGG + Intronic
1094319667 12:29171401-29171423 TGCCCGGCTGCTGCCCCATCTGG + Intronic
1094456399 12:30639026-30639048 AGCCCAGGTGCTGCCCCAGTAGG - Intronic
1095703758 12:45216558-45216580 GGCCCCGGTGCGGCCCCTGCGGG + Intronic
1096121175 12:49090335-49090357 AGGCCGGGTGGTGCCCACGCCGG - Exonic
1096121658 12:49092684-49092706 CACTGGGCTGCTGCCCCCGCAGG - Intronic
1096502119 12:52070396-52070418 CGCCCTGGTGCGACCTCCGCAGG - Exonic
1096777936 12:53975019-53975041 TGCCCGGGTGCTGCGGCTGCAGG + Intronic
1097110075 12:56651820-56651842 CGCCCGGCAGCTGCCCCGTCTGG - Intergenic
1097198549 12:57258919-57258941 CTCCAGGCTTCTGCCCCCGCTGG + Exonic
1098255465 12:68611168-68611190 CGCCGAGGGGCTGCCGCCGCCGG - Intronic
1098333103 12:69375061-69375083 CGCCCGGCAGCCGCCCCCTCCGG - Intronic
1102501859 12:113358669-113358691 GGCCCTGGTGCTGGCCCTGCTGG + Exonic
1104376263 12:128267333-128267355 CGCCCGCCCGCGGCCCCCGCCGG - Intergenic
1104887440 12:132118949-132118971 CGCCGGGAGGCTGCCCCAGCCGG + Intronic
1105009341 12:132745031-132745053 TGCCCGGGAGCTGCCTCTGCTGG - Intronic
1105044042 12:132986794-132986816 CCCGCGGGTCCTGCCCCCGCAGG + Exonic
1106735698 13:32586396-32586418 CCCCCGGGTGCTGTCCGCGGCGG + Intergenic
1106809952 13:33349996-33350018 CGCCCGGGGGCAGCCCCTCCAGG + Intronic
1107165832 13:37280410-37280432 CGCCCGGCAGCTGCCCCGTCTGG + Intergenic
1107251102 13:38363957-38363979 CGCCCGGCCGCTGCCCCGTCTGG + Intergenic
1111672637 13:91348609-91348631 CGCCCCGAGGCTGCCCACGCGGG - Intergenic
1112752593 13:102597317-102597339 CACCCCGGTGCTGCCCACCCCGG - Intronic
1113493625 13:110712410-110712432 CGCCCCGCTGCGGCCGCCGCGGG - Intronic
1113714861 13:112496350-112496372 CGCCCGCCTGCTGCACCCCCTGG - Intronic
1113774146 13:112933161-112933183 GGTCCGGGCGCTGGCCCCGCAGG + Intronic
1113885389 13:113656180-113656202 CTCCCTGGTGCTGGCCCTGCAGG + Intronic
1114182863 14:20380356-20380378 CCCCCGGCTCCTGCCCCAGCAGG - Exonic
1114594313 14:23898477-23898499 CGCCCGGCAGCTGCCCCATCTGG - Intergenic
1114637485 14:24195939-24195961 GGCCCGAGAGCTGTCCCCGCGGG + Intronic
1115324872 14:32127844-32127866 CGCCCGGCAGCTGCCCCGTCTGG - Intronic
1116005372 14:39285720-39285742 CGCCCGGCAGCTGCCCCGTCTGG - Intronic
1118312638 14:64704818-64704840 CGCCCCGGTCCTCACCCCGCAGG - Intronic
1118955603 14:70477731-70477753 CGCCCGGCAGCTGCCCCGTCCGG + Intergenic
1120953493 14:90062176-90062198 GGCCTGGGGGCTGCCCCCGGGGG + Exonic
1122580836 14:102770709-102770731 TGCCTGGGTGCTCTCCCCGCTGG + Intergenic
1122624238 14:103075900-103075922 CGCCCCGGGGCTGCCCCTGTGGG + Intergenic
1122886510 14:104712770-104712792 ACCCCGGGTGGTGCCCGCGCGGG + Intronic
1122942193 14:104986354-104986376 CGCCGGGGTGCTGGCCGCCCAGG - Exonic
1202851597 14_GL000225v1_random:23582-23604 CCCGCGGGTGCTGCCTCAGCTGG - Intergenic
1125721234 15:41846088-41846110 CCCCCTGGTGCAGCCCCAGCTGG - Intronic
1126780952 15:52138462-52138484 CGCCCTGGTGTTGCACCCACTGG + Intronic
1132251945 15:100341230-100341252 CGCCCTGCTGCTGCACCTGCCGG - Exonic
1132464858 16:72650-72672 CGCCCGGGGGCGGGCCCGGCCGG + Intronic
1132879492 16:2155738-2155760 CGCCAGGCCGCTGCGCCCGCCGG - Intronic
1134074469 16:11281019-11281041 CACCAGGGTGCTGCCGCCCCAGG - Exonic
1136129610 16:28211664-28211686 CGCCCGGGCCCGACCCCCGCGGG + Exonic
1137620914 16:49876367-49876389 CGCTCGGGTGCAGCCCGGGCTGG + Intergenic
1142011781 16:87718982-87719004 CGCCCGGCAGCCGCCCCCTCCGG + Intronic
1142120232 16:88383371-88383393 CGCCGGGGAGCGGCCCCCGAGGG - Intergenic
1142232007 16:88904444-88904466 CGACCTGGTGTTGCCCCCACAGG + Intronic
1142474564 17:181338-181360 CGTCCGGGGGCAGGCCCCGCGGG + Exonic
1142705266 17:1689894-1689916 CGCCCGGCAGCCGCCCCCTCTGG - Intergenic
1142860056 17:2755824-2755846 CGCCCCGCTGCTTCCCGCGCCGG - Intergenic
1143485389 17:7251352-7251374 CGGCGGGGGGCTGCCCCCGGGGG - Exonic
1144021344 17:11241638-11241660 CCGCCGCGGGCTGCCCCCGCCGG - Exonic
1146731229 17:35195077-35195099 CGCCCGGCCGCTGCCCCGTCCGG - Intergenic
1147393345 17:40122862-40122884 TGCCCGGGGGCCGCCCCGGCCGG - Intronic
1147662155 17:42122506-42122528 CGCCAGGGTGCGGCTCCCTCGGG + Exonic
1150085775 17:62272678-62272700 CGCCCAGGTCCTGCCCCTCCTGG - Intronic
1150413379 17:64965975-64965997 CGCCCGGGGACTTCCCCGGCGGG - Intergenic
1150798440 17:68259242-68259264 CGCCCGGGGACTTCCCCGGCGGG + Exonic
1152231771 17:79117488-79117510 AGGCTGGGGGCTGCCCCCGCAGG + Intronic
1153935236 18:9914626-9914648 CGCCCAGGAGGCGCCCCCGCGGG - Intronic
1154089613 18:11344754-11344776 CGCCCGGCTGCTGCCCCATCTGG + Intergenic
1154218797 18:12434322-12434344 AGCCCGGGTGCAGCCCCCGGAGG + Intergenic
1154990250 18:21592669-21592691 CGCCCGGCAGCTGCCCCGTCCGG - Intronic
1160778827 19:868897-868919 CGCCAAGGTGCAGCCTCCGCAGG + Exonic
1160832245 19:1109448-1109470 CGCCCCGGTCCGCCCCCCGCGGG + Intronic
1160878198 19:1307580-1307602 GGCCCGGGTTCAGCCGCCGCCGG + Intergenic
1160941205 19:1621226-1621248 GGCCTGGGTGCTGCCGCCGACGG + Intronic
1161199505 19:3006557-3006579 CGCCCGGCAGCTGCACACGCTGG - Exonic
1161752835 19:6110259-6110281 CGTCCGGGTGGTGCGCCCGCGGG - Intronic
1162345018 19:10113847-10113869 CGCCCTGACGCTGCCCCCGCTGG + Exonic
1162426862 19:10602400-10602422 CGCGCGGGGGCTGGCCCGGCGGG + Intergenic
1162565051 19:11441366-11441388 CACCCTGGGGCAGCCCCCGCGGG - Intronic
1162602082 19:11676919-11676941 CGCCCGGCAGCTGCCCCGTCCGG - Intergenic
1162683801 19:12365449-12365471 CGCCCGGGTCCCGCCACAGCCGG + Intronic
1164016576 19:21260179-21260201 TGCCCGGTTGCTGCCCCGTCTGG - Intronic
1164017328 19:21264672-21264694 TGCCCGGCTGCTGCCCCATCTGG + Intronic
1164239268 19:23369400-23369422 CGCCCGGCCGCTGCCCCGTCCGG + Intronic
1164659287 19:29949107-29949129 CGCCCGGCAGCTGCCCCGTCTGG - Intronic
1164713419 19:30375224-30375246 AGGCCGAGCGCTGCCCCCGCCGG + Intronic
1165481900 19:36069229-36069251 CGCCCGGCAGCTGCCCCGTCTGG - Intronic
1166069784 19:40380419-40380441 CTCCCAGCTGCTGCCCCGGCAGG + Exonic
1166086257 19:40477431-40477453 AGCCTGGGTCCTGCCCCCACAGG + Intronic
1166191622 19:41180349-41180371 CGCCCGGCAGCCGCCCCGGCCGG + Intergenic
1166199316 19:41226273-41226295 CGCGCGGGAGCTGGCGCCGCCGG - Intronic
1166792335 19:45405566-45405588 CACCGGGGTGCAGCCCCTGCGGG - Intronic
1167433039 19:49464200-49464222 CACACTGGCGCTGCCCCCGCGGG - Exonic
1167792228 19:51689634-51689656 CCCCCGGGTGCTCCTCCCTCAGG - Intergenic
925778653 2:7359047-7359069 TCCCCTGGTGCTGCCCCCACTGG + Intergenic
928722164 2:34133158-34133180 CGCCCGGCAGCTGCCCCGTCCGG - Intergenic
930590780 2:53323598-53323620 CGCCCGGCCGCTGCCCCGTCCGG - Intergenic
932036765 2:68253110-68253132 CACCCCGGTGCAGCACCCGCAGG + Exonic
932484414 2:72074430-72074452 AGCCTGGGTGCTGCCCACACTGG - Intergenic
932495782 2:72145089-72145111 GCGCCGGGTGCTGCCCCGGCAGG - Intronic
935783843 2:106531519-106531541 AGCCAGGATGCTGCCCCTGCAGG + Intergenic
941025107 2:160449051-160449073 CGCCCGGCAGCTGCCCCGTCTGG + Intronic
941025134 2:160449131-160449153 CGCCCGGCAGCCGCCCCCACTGG + Intronic
943005799 2:182386682-182386704 CGCCCGGCAGCTGCCCCGTCTGG + Intronic
943669798 2:190648865-190648887 CGCCCGGCGGCGGCCCACGCCGG + Intronic
943704445 2:191020465-191020487 CGCCTGCGTACTGCTCCCGCAGG - Intronic
945530805 2:210950858-210950880 CGCCCGGCAGCTGCCCCGTCTGG + Intergenic
948399593 2:237674051-237674073 GGCACTGCTGCTGCCCCCGCGGG + Intronic
948479339 2:238240238-238240260 CGCCCCGGTGCCGCCCCCGCGGG - Intronic
948874038 2:240818060-240818082 CAGCCGGGTGCTGCCCCCCTGGG - Intronic
1169832466 20:9839191-9839213 CGTGCAGGAGCTGCCCCCGCCGG - Intergenic
1170617751 20:17968244-17968266 CTCACGGGTGCTTCCCGCGCTGG + Intronic
1171187981 20:23137046-23137068 CGCCCTGGTGCAGCCCCTCCAGG - Intergenic
1171484305 20:25476458-25476480 AGCCCGGGAGCTGCCTCTGCTGG - Exonic
1172237729 20:33389421-33389443 CGCCCGGCAGCTGCCCCGACTGG + Intronic
1172337912 20:34132642-34132664 CGCCCGGCAGCTGCCCCGTCCGG + Intergenic
1172465549 20:35153659-35153681 CGCCCGGCAGCTGCCCCTACTGG + Intergenic
1173704645 20:45100920-45100942 CGCCCGGGAGGTGCCACCACAGG - Exonic
1175890795 20:62315055-62315077 GGCCCAGGTCCTGGCCCCGCAGG + Exonic
1176104805 20:63380916-63380938 GGCCTGGGTGCTGCCCCCTGTGG + Intergenic
1176150879 20:63590150-63590172 GGCCCGGGGGCAGCCCCTGCGGG + Exonic
1176234644 20:64048711-64048733 CTTCCGCGAGCTGCCCCCGCTGG - Exonic
1176549793 21:8216197-8216219 GGCCCGGGTGGAGCCGCCGCAGG + Intergenic
1176557684 21:8260426-8260448 GGCCCGGGTGGAGCCGCCGCAGG + Intergenic
1176568718 21:8399231-8399253 GGCCCGGGTGGAGCCGCCGCAGG + Intergenic
1176576632 21:8443466-8443488 GGCCCGGGTGGAGCCGCCGCAGG + Intergenic
1178922413 21:36747550-36747572 CGCCCACGCGCTGCACCCGCGGG - Intronic
1180042657 21:45288132-45288154 CGCCCTGGCGCAGCCCACGCAGG + Intergenic
1180920489 22:19519218-19519240 CTCCCTGGTGCTGCCCTCGAAGG + Intronic
1181026260 22:20129512-20129534 CGTCCGCGTGCTGGCCCCACGGG + Intronic
1181796962 22:25318289-25318311 GCCCCGGGTGCTGGCCCCGGGGG + Intergenic
1182294942 22:29307098-29307120 GGCCCGGCTCCGGCCCCCGCTGG + Exonic
1183650913 22:39152771-39152793 CCCCCGGGGCCCGCCCCCGCGGG + Intergenic
1184192124 22:42901855-42901877 CGCCCTGGTGGTGCCCCTGCAGG - Intronic
1185055185 22:48575633-48575655 CGCCCCTGGGCTGCCCACGCTGG - Intronic
1185111017 22:48900272-48900294 CACCCGGCTGCTGCCCACACCGG + Intergenic
1203254682 22_KI270733v1_random:132523-132545 GGCCCGGGTGGAGCCGCCGCAGG + Intergenic
1203262738 22_KI270733v1_random:177602-177624 GGCCCGGGTGGAGCCGCCGCAGG + Intergenic
950499174 3:13353118-13353140 CTCCCCAGTGCTGCCCCCACGGG + Intronic
953575946 3:44113370-44113392 CGCCAGGGTGCTTCCTCCCCTGG - Intergenic
953966215 3:47309332-47309354 CGCCCGGCAGCTGCCCCTTCTGG - Intronic
954372103 3:50174368-50174390 TGGCCCTGTGCTGCCCCCGCTGG + Intronic
954468944 3:50675223-50675245 CGCCCGGTCGCCGCGCCCGCGGG + Exonic
954529769 3:51308782-51308804 CGCCCGGCAGCTGCCCCTACTGG - Intronic
954584174 3:51719822-51719844 GGCCTGGGTGCTGCCCCCAGTGG + Intergenic
955228464 3:57079370-57079392 CGCCCGGCTCCGGCGCCCGCGGG - Intergenic
956716847 3:72086949-72086971 CTGCCGGCTGCTGCTCCCGCCGG - Intergenic
957206427 3:77204986-77205008 CGCCCGGCTCCTGCACCTGCCGG - Intronic
960101203 3:113745728-113745750 CCCCCGGGTCTTGCCTCCGCTGG + Intronic
960625008 3:119674008-119674030 TGCCCGGCTGCTGCCCCGTCTGG + Intronic
960770765 3:121190738-121190760 CGCCCGGCAGCTGCCCCATCCGG - Intronic
961012924 3:123448156-123448178 CGCCCGGGTGCTGCCCCCGCTGG + Exonic
962301803 3:134250362-134250384 CGGCCGGAAGCTGCCCCAGCCGG + Intronic
968175178 3:196543230-196543252 CGCCCGGCAGCTGCCCCGTCCGG - Intergenic
968353404 3:198080971-198080993 CGCCCCGGTGCAGCCGCCGCCGG + Intergenic
968353578 3:198081611-198081633 CGCCCCTGTGCAGCCGCCGCCGG + Intergenic
968521208 4:1035601-1035623 CGCCTGGTTGCTGCCCCAGCAGG - Intergenic
968883033 4:3310794-3310816 CACCTGGGACCTGCCCCCGCAGG - Intronic
969053320 4:4387290-4387312 CGCCCGGGTGCGGCGGCCCCAGG + Intronic
969384728 4:6837107-6837129 CGCCCGGCCGCTGCCCCGTCTGG - Intronic
973554171 4:52065694-52065716 AGCCAGGGTGCTGCCCACGATGG + Intronic
973664130 4:53139601-53139623 CGCCCGGCTGCTGCCCCGTCTGG + Intronic
976146199 4:82044450-82044472 CGCCAAGGCGCTGCGCCCGCCGG - Intergenic
978376259 4:108077719-108077741 TGCCCGGCTGCTGCCCCATCTGG + Intronic
978519778 4:109603740-109603762 CGCCCGGCAGCTGCCCCGTCTGG + Intronic
979205606 4:118033779-118033801 CGCCCGCTTGTCGCCCCCGCCGG + Intronic
982723507 4:158882302-158882324 CGCCCGGCAGCTGCCCCATCTGG + Intronic
985558676 5:570575-570597 CGCCTGGGTGCGGACCCCACGGG - Intergenic
985558714 5:570734-570756 CGCCTGGGTGCAGACCCCACGGG - Intergenic
985558726 5:570787-570809 CGCCTGGGTGCAGACCCCACGGG - Intergenic
985558741 5:570859-570881 CGCCTGGGTGCAGACCCCACGGG - Intergenic
993934766 5:93986376-93986398 CGCCCGGCAGCTGCCCCCTCTGG + Intronic
994359965 5:98839593-98839615 CGCCCGGTCGCTGCCGCCGGGGG - Intergenic
1001313368 5:170626668-170626690 TGCCCGAGTGCTGCCCCAGAAGG + Intronic
1002195043 5:177496973-177496995 CCCCCGTGTGCTCCCTCCGCTGG - Intronic
1006145784 6:31958891-31958913 CCCCCGGTTGCCGCCCCCTCGGG - Exonic
1013117769 6:107115419-107115441 CGCCCGAGCGCCGCCGCCGCCGG - Intergenic
1013441778 6:110179166-110179188 CGCCCCGGGGCTGCTCTCGCTGG - Intronic
1014463671 6:121729757-121729779 CGCCCGGCAGCTGCCCCGTCTGG - Intergenic
1014798216 6:125749316-125749338 CGCCCGCGCGCTCCCTCCGCAGG + Intronic
1014800358 6:125770995-125771017 CGCCCGGCAGCCGCCCCCTCCGG + Intergenic
1017981912 6:159407457-159407479 CGCCCGGCAGCCGCCCCCTCTGG + Intergenic
1019317033 7:391578-391600 GGCCCGGGTGCTGCCGCAGGAGG + Intergenic
1019703246 7:2484755-2484777 CGCCCGGGTGCTGGGCCCCAGGG - Intergenic
1019715007 7:2534484-2534506 CGCCCGGCAGCTGCCCCGTCTGG - Intergenic
1024065281 7:45727144-45727166 CGCCCGGGCGCGGCCGCCGGAGG + Intergenic
1024305136 7:47922668-47922690 CGCCCGGCAGCTGCCCCGTCTGG + Intronic
1025178029 7:56811699-56811721 CGCCTTGGGGCAGCCCCCGCAGG - Intergenic
1025178877 7:56815132-56815154 CGCCTTGGGGCGGCCCCCGCAGG - Intergenic
1025179313 7:56816922-56816944 CGCCTTGGGGCGGCCCCCGCAGG - Intergenic
1025179771 7:56818808-56818830 CGCCTTGGGGCGGCCCCCGCAGG - Intergenic
1025180220 7:56820646-56820668 CGCCTTGGGGCGGCCCCCGCAGG - Intergenic
1025180691 7:56822628-56822650 CGCCTTGGGGCGGCCCCCGCAGG - Intergenic
1025181134 7:56824475-56824497 CGCCTTGGGGCGGCCCCCGCAGG - Intronic
1025181566 7:56826217-56826239 CGCCTTGGGGCGGCCCCCGCAGG - Intronic
1025690801 7:63752586-63752608 CGCCTTGGGGCGGCCCCCGCAGG + Intergenic
1025691241 7:63754361-63754383 CGCCTTGGGGCGGCCCCCGCAGG + Intergenic
1025692126 7:63758008-63758030 CGCCTTGGGGCGGCCCCCGCAGG + Intergenic
1025692574 7:63759831-63759853 CGCCTTGGGGCGGCCCCCGCAGG + Intergenic
1025693434 7:63763333-63763355 CGCCTTGGGGCGGCCCCCGCAGG + Intergenic
1027826760 7:83125281-83125303 CGCCCGGCCGCCGCCCCCTCTGG + Intronic
1030033328 7:105388501-105388523 CGCTCGGCTCCTGCCCCCGGCGG - Intronic
1031531923 7:122886386-122886408 CCCCCGGCGGCTGCGCCCGCGGG + Intronic
1033282485 7:140015921-140015943 CTCCCGGCTGCTGCCTCCACTGG - Intronic
1034445923 7:151114494-151114516 CTCCCAGGGGCTGCCCCAGCAGG + Intronic
1035265616 7:157689066-157689088 CGCCCGGGGGCTGCGAGCGCCGG - Intronic
1035289557 7:157829072-157829094 CGCCCGGCTGCGCCCCGCGCTGG - Intronic
1040076956 8:43246596-43246618 CGCCCCTGTGCAGCCGCCGCCGG - Intergenic
1040616233 8:49041493-49041515 CGCCCGGCAGCTGCCCCGTCTGG - Intergenic
1042134026 8:65616930-65616952 CGCCCGGCAGCTGCCCCGTCTGG + Intronic
1042290728 8:67167495-67167517 CGCCCGGCAGCTGCCCCGTCTGG - Intronic
1043961593 8:86424003-86424025 CGCCCGGCAGCTGCCCCGTCCGG - Intronic
1044996312 8:97841099-97841121 TGCCCGGCTGCTGCCCCATCTGG - Intronic
1045021906 8:98051792-98051814 CGCCCGGCAGCTGCCCCATCTGG - Intergenic
1045489393 8:102656882-102656904 CGCCCGTGTGCTGCGCCTGGGGG + Intergenic
1048203896 8:132400527-132400549 GGCCCTGGTGATGCCACCGCGGG + Intronic
1049645457 8:143733848-143733870 CCCCCAGGTGCTGCCCGGGCAGG - Intergenic
1049746805 8:144266479-144266501 CGCCCGGCAGCTGCCACCGCGGG + Intronic
1049752518 8:144291872-144291894 CGCCCGCGCGCTGCCCTCACCGG - Exonic
1051079465 9:13278876-13278898 CGTCCGGGAGCGGCCCCTGCAGG + Intronic
1052872732 9:33523965-33523987 TGCCCCGGTGCAGCCGCCGCCGG - Intergenic
1053503574 9:38621524-38621546 CGCCCCTGTGCAGCCGCCGCCGG + Intergenic
1055090980 9:72364785-72364807 CGCCCTGGTGCCGCCGCCGCGGG + Intronic
1057180007 9:93024687-93024709 CGCCCAGGTCCTGCCCACCCAGG - Intronic
1057684722 9:97221861-97221883 TGCCCCGGTGCAGCCGCCGCGGG + Intergenic
1059879811 9:118677941-118677963 CGCCCGGCAGCTGCCCCGTCCGG - Intergenic
1060758207 9:126227808-126227830 CGACCTGGAGCTGCCCGCGCTGG + Intergenic
1062003890 9:134229864-134229886 CCCCCAGGGGCTGCCCCCGACGG + Intergenic
1062044324 9:134418078-134418100 CGCCCCTGTGCTGCCCTCCCTGG - Intronic
1062369322 9:136229346-136229368 CGCCCGTGAGCTGCCCACGGCGG - Intronic
1202800565 9_KI270719v1_random:170878-170900 TGCCCCGGTGCAGCCGCCGCCGG - Intergenic
1203774048 EBV:62997-63019 CGCGGGGCTGCTGCCCCCTCCGG + Intergenic
1203471083 Un_GL000220v1:115668-115690 GGCCCGGGTGGAGCCGCCGCAGG + Intergenic
1203478904 Un_GL000220v1:159640-159662 GGCCCGGGTGGAGCCGCCGCAGG + Intergenic
1188086471 X:25906140-25906162 CGCCCGGCAGCTGCCCCGTCCGG + Intergenic
1189323163 X:40098089-40098111 CGCCCGAGCGCTGCGCCTGCGGG - Intronic
1191894176 X:65975309-65975331 CGCCCGGCCGCTGCCCCGTCCGG - Intergenic
1192610303 X:72559957-72559979 CGCCCGGCCGCTGCCCCGTCTGG + Intronic
1193130074 X:77910595-77910617 CTTCCGGGTGATGCCCCTGCCGG - Intergenic
1198189134 X:134286025-134286047 CGCCCGGCAGCTGCCCCATCTGG - Intergenic
1199744586 X:150763980-150764002 CACCTGGGTCCTGCCCCAGCAGG + Intronic