ID: 961012937

View in Genome Browser
Species Human (GRCh38)
Location 3:123448189-123448211
Sequence GTCGCGGCAGCCGCCGGCAG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 171}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961012937_961012947 21 Left 961012937 3:123448189-123448211 CCGCTGCCGGCGGCTGCCGCGAC 0: 1
1: 0
2: 0
3: 23
4: 171
Right 961012947 3:123448233-123448255 CCTGCCAGGCGGACTTGGAGCGG 0: 1
1: 0
2: 1
3: 15
4: 149
961012937_961012942 10 Left 961012937 3:123448189-123448211 CCGCTGCCGGCGGCTGCCGCGAC 0: 1
1: 0
2: 0
3: 23
4: 171
Right 961012942 3:123448222-123448244 GCCGCCGCGCTCCTGCCAGGCGG 0: 1
1: 0
2: 2
3: 19
4: 379
961012937_961012941 7 Left 961012937 3:123448189-123448211 CCGCTGCCGGCGGCTGCCGCGAC 0: 1
1: 0
2: 0
3: 23
4: 171
Right 961012941 3:123448219-123448241 GTCGCCGCCGCGCTCCTGCCAGG 0: 1
1: 0
2: 2
3: 39
4: 877
961012937_961012945 16 Left 961012937 3:123448189-123448211 CCGCTGCCGGCGGCTGCCGCGAC 0: 1
1: 0
2: 0
3: 23
4: 171
Right 961012945 3:123448228-123448250 GCGCTCCTGCCAGGCGGACTTGG 0: 1
1: 0
2: 1
3: 8
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961012937 Original CRISPR GTCGCGGCAGCCGCCGGCAG CGG (reversed) Exonic
900401405 1:2474360-2474382 GGCAGGGCAGCCCCCGGCAGAGG + Intronic
901000978 1:6148736-6148758 GGCGGGGCAGGAGCCGGCAGGGG + Intronic
901028882 1:6294554-6294576 GTCGTGGCAGCTGCAGGCACAGG + Intronic
902823362 1:18956638-18956660 GCCGCGGCAGCCGCACGCAGAGG + Exonic
903953999 1:27012560-27012582 GTCGGGGCCGCCGCCTGCCGGGG + Exonic
904199785 1:28812268-28812290 GGCGCGGCAGCCGGCGGCGTCGG + Exonic
904782992 1:32964542-32964564 GGCGCGGCGGCCGCGGGCCGAGG + Exonic
905580782 1:39081651-39081673 CTCCCGGCAGCCGGCGGCCGCGG + Intronic
905710334 1:40096993-40097015 GTCGAGGCAGCCGCGTGCTGTGG + Intronic
906514108 1:46428928-46428950 GTCTCAGCAGCCACCTGCAGAGG + Intergenic
907526301 1:55056131-55056153 GTCCCGGAAGTTGCCGGCAGCGG - Exonic
910676395 1:89820953-89820975 GTCGCGGCACTCGCCGGCTGCGG + Intronic
910758876 1:90716891-90716913 GTCGGGGCCGCGGCCGGCGGCGG + Exonic
914730392 1:150364664-150364686 GCCGCCGCCGCCGCCGCCAGAGG + Intronic
916052410 1:161045610-161045632 CGCGCCGCAGCCGCCGGCACCGG - Intronic
918042070 1:180919555-180919577 GTGGGGGCAGCTGCAGGCAGAGG - Intronic
920066535 1:203273487-203273509 CTCCCGGCAGCGGCCGGCAGAGG + Intronic
921472722 1:215567713-215567735 CCCGCGGCGGCGGCCGGCAGCGG + Exonic
924179371 1:241424834-241424856 ATCCAGGCAGGCGCCGGCAGTGG - Intergenic
924527421 1:244864365-244864387 GCCGCAGCAGCCGCCACCAGTGG - Exonic
1068538612 10:58267839-58267861 GCCGCCGCAGCCGCCGGCCCCGG + Exonic
1073297643 10:102450781-102450803 GTCGCTGCAGGCGCCCGCGGCGG - Exonic
1074419897 10:113299550-113299572 GGCGCTGCAGGCGCCGGGAGCGG + Intergenic
1074865725 10:117543430-117543452 GCCGCCGCCGCCGCCGGTAGGGG + Exonic
1074884615 10:117684445-117684467 GGGTCGGCAGCCGCCGGGAGGGG - Intergenic
1076401979 10:130190627-130190649 GGCTCGGCAGCCGCAGGCAGCGG - Intergenic
1077144009 11:1036807-1036829 ACCGCGGCGCCCGCCGGCAGTGG - Intergenic
1078801025 11:14644111-14644133 GTCCCTGCAGCCGCCGGATGGGG + Exonic
1079489028 11:20966833-20966855 GTCGGGGCAGGGGGCGGCAGGGG - Intronic
1080457737 11:32431111-32431133 TTCTCTGCAGCCGCCGGCGGGGG - Intronic
1080551270 11:33375950-33375972 TGCGCGGGAGCCGCCGGGAGGGG + Intergenic
1081831985 11:46121720-46121742 GTCCCGGGAGCCGCGGGCCGAGG - Intergenic
1084419671 11:69054020-69054042 GCCGCGGCACCTGCAGGCAGAGG - Exonic
1085333041 11:75668671-75668693 GCCGCCGCAGCCGCAGGGAGGGG - Exonic
1085622269 11:78046370-78046392 GTCGCGGCTCCGGCCAGCAGAGG - Intronic
1086504985 11:87495403-87495425 GTAGCAGCAGCCCCCAGCAGAGG - Intergenic
1090699040 11:129278819-129278841 GTCGCGGCTGCCGCCCGCCTTGG + Intronic
1091381875 12:67105-67127 GTGGCCGGAGCGGCCGGCAGCGG - Exonic
1091759458 12:3077383-3077405 GCCGCCGCCGCCGCCGCCAGCGG - Exonic
1094041078 12:26122481-26122503 GCCGCGGCGGCCGCGGGCTGCGG + Exonic
1096647756 12:53047673-53047695 GACCCGGCAGCAGCTGGCAGCGG + Intronic
1100632285 12:96400588-96400610 GCCTCCGCCGCCGCCGGCAGGGG - Intergenic
1101321575 12:103677556-103677578 GTCGTGGCAGCCGCCTGCACTGG - Exonic
1102278193 12:111598802-111598824 GTCGCGGCGACCTCCGGCGGCGG - Exonic
1110119761 13:71866536-71866558 GCCGCCGCCGCCGCCGGTAGAGG + Exonic
1110705971 13:78602250-78602272 GGCGCGGCGGCCGGCGGCGGCGG - Exonic
1112652720 13:101416346-101416368 GTCGCCGCCGCCGCCGCCCGCGG - Exonic
1119808482 14:77498164-77498186 GGCTCTCCAGCCGCCGGCAGGGG - Intronic
1121042217 14:90758579-90758601 CCCTCGGCAGCCGCCGCCAGGGG - Intronic
1121465846 14:94115098-94115120 GGTGTGGCAGCAGCCGGCAGAGG + Intronic
1122418305 14:101560738-101560760 CGCGCGGCAGCCTCGGGCAGCGG + Intergenic
1122830432 14:104393133-104393155 GTCGCTGCACCCACTGGCAGTGG + Intergenic
1122952285 14:105051666-105051688 GTCGGGGCCGCCGCCGCCGGAGG - Exonic
1122976945 14:105174623-105174645 GCCGCGGCCGCCGCCGGAAATGG - Intronic
1125534669 15:40436343-40436365 GCTGCGGCAGCCTCCGGCTGAGG - Intergenic
1126348361 15:47718835-47718857 GCGCCGGCAGCCGCTGGCAGGGG + Exonic
1126406877 15:48331391-48331413 GTCGCAGCCGCCGCCGGACGAGG - Intronic
1127515509 15:59689362-59689384 GGCGCGGCAGCCGGCGGTGGAGG + Exonic
1128455038 15:67827398-67827420 GCAGCGGCAGCTGCTGGCAGCGG + Intronic
1130317691 15:82810186-82810208 GGCGCGGCGGCCGACGGCTGCGG + Exonic
1132877960 16:2148665-2148687 GCCGCCGCCGCCGCCGCCAGGGG + Exonic
1133156455 16:3880143-3880165 GCCGCCGCCGCCGCCGGCCGCGG + Exonic
1135325321 16:21521863-21521885 GCCCAGGCAGCCACCGGCAGGGG + Intergenic
1135577326 16:23596023-23596045 GGCGCGCCAGCTGCAGGCAGGGG - Intronic
1136336808 16:29615131-29615153 GCCCAGGCAGCCACCGGCAGGGG + Intergenic
1140753348 16:78046006-78046028 GTCGCGGCACCCGGCTGCTGAGG + Intronic
1141989771 16:87603060-87603082 GTCGCGGCCGCCGGCGGCCCTGG - Exonic
1142752769 17:1998428-1998450 CTCGCGGGAGCCGCCGGCCGGGG + Intronic
1144565054 17:16353144-16353166 GTCGCGGGAGTCGGCGGCGGCGG + Exonic
1145765513 17:27456264-27456286 CTCGCCGCGGCCGCCGGGAGGGG + Intergenic
1145815783 17:27793898-27793920 TCCGCGGCAGACGCCGGCTGCGG - Intronic
1145824559 17:27867033-27867055 GTGGCGGCATCAGCAGGCAGAGG - Intronic
1147150368 17:38510555-38510577 GTCGCTGCGGCCCCCGGCGGCGG + Exonic
1147907632 17:43833186-43833208 GGCGCGGCAGCCGCAGGGAGGGG - Intergenic
1147943503 17:44066601-44066623 GCCGCCGCCGCCGCCGGCCGCGG - Exonic
1149996735 17:61409696-61409718 GCTGCGGGAGCGGCCGGCAGGGG - Intergenic
1152331437 17:79675457-79675479 GTCCCATCAGCAGCCGGCAGTGG - Intergenic
1152817681 17:82418197-82418219 GCCGCGGTAGCCGACGGCAGAGG - Intronic
1153794396 18:8609480-8609502 GCCGCCGCCGCCGCCGGGAGAGG - Exonic
1154325466 18:13387656-13387678 GTCGAGGAAGCCGCCGGGCGAGG - Exonic
1155152792 18:23135871-23135893 GGCGCGGCGGCCGCGGGCTGAGG - Exonic
1156275798 18:35581722-35581744 GCCGGGGGAGCCGCCGGCAGTGG + Intronic
1157464291 18:47930764-47930786 GCCGCGGCGGCCGGCGGCCGAGG - Intronic
1157687028 18:49650942-49650964 GCCGCCGCACCTGCCGGCAGAGG - Intergenic
1160397001 18:78580020-78580042 GGCCAGGCAGGCGCCGGCAGAGG - Intergenic
1160664017 19:314551-314573 ACCGCGTCAGCCCCCGGCAGTGG - Intronic
1162773614 19:12965506-12965528 GTCCCGGGAGCCGCCGCCAGAGG + Intronic
1163607153 19:18281605-18281627 GGCGCAGGAGCCGCCGCCAGTGG - Exonic
1163655695 19:18543597-18543619 GTCGCGGCAGCGGCGGCCAATGG - Exonic
1163687261 19:18718974-18718996 GTCTCGGCAGCCACTTGCAGAGG + Intronic
1163815383 19:19461901-19461923 GTGCAGGCAGCAGCCGGCAGAGG + Intronic
1164992106 19:32692059-32692081 GTCGCGCCCGCCGCCGGCCGAGG + Exonic
1165533239 19:36421562-36421584 GTCTCGGCAGCCGCGGCCCGCGG - Intergenic
1167220379 19:48195288-48195310 GACGCAGCAGTCGCCGGCGGTGG - Exonic
926130965 2:10302910-10302932 GCCGCGGCGGCGGCGGGCAGCGG + Intronic
926283123 2:11466212-11466234 CGGGCGGCAGCCGCCGGGAGAGG - Intergenic
928964836 2:36966366-36966388 GCCGCGGCAGCCTCCGCCAGAGG + Exonic
931517708 2:63059545-63059567 GTCGCGGCTGCGGGCGGGAGGGG + Intergenic
935265161 2:101387424-101387446 GCCGCGCCGGCCGCCGGCCGCGG + Exonic
937221807 2:120346282-120346304 GGCGCGGCAGGCGTCGGCGGGGG - Exonic
942278093 2:174336941-174336963 GCCGCGGCTGCCGCCGCCGGGGG + Exonic
942890547 2:180981199-180981221 GTGGCCGCCGCCGCCGGCCGTGG + Intronic
942946942 2:181682655-181682677 GTCGGGGCAGCTGCCGGGTGAGG - Intergenic
1170150506 20:13221726-13221748 GGCGCGGCGGCCGGCGGCGGCGG - Intergenic
1171123107 20:22582406-22582428 GCCGCAGGCGCCGCCGGCAGCGG - Exonic
1172062614 20:32196777-32196799 GCCGCAGCTGCCGCCGGCTGAGG + Exonic
1173820161 20:46014281-46014303 GCCGCCGCGGCCGCCGGCAGGGG + Intronic
1175509739 20:59515812-59515834 GTCTCTCCAGCCGCCGCCAGAGG + Intergenic
1176068945 20:63216109-63216131 GTCGCCGCCGCCGCCGCCATTGG - Exonic
1176283327 20:64327728-64327750 GTGGCCGGAGCGGCCGGCAGCGG + Intergenic
1179290364 21:40013168-40013190 GTCGTGGCAGCCGGGGGCCGTGG - Exonic
1180110263 21:45644030-45644052 GCCGCCGCAGGCGCCGGCGGCGG - Intronic
1180875068 22:19171374-19171396 GTCCCGGGAGGCGCCGCCAGAGG + Intergenic
1180961937 22:19766184-19766206 GCCGCCGCCGCCGCCCGCAGAGG + Intronic
1182222978 22:28773096-28773118 CTCGCGGCGGGCGCGGGCAGGGG + Intronic
1183535488 22:38398464-38398486 GTCCCGGCAGCCGCCGCGCGAGG - Intronic
1183598825 22:38828345-38828367 GCCACAGCAGCCGCCGGCAGAGG - Exonic
1185055170 22:48575588-48575610 GGCGCGGCAGCCACCGGCACCGG + Intronic
1185101654 22:48843814-48843836 CTCGGGGCAGCTGCTGGCAGGGG + Intronic
951558612 3:23945208-23945230 GTCGCCGCAGCGGCCGGCCGAGG + Intronic
953485005 3:43286702-43286724 GGCGCGGCGGCCGTAGGCAGGGG + Intronic
953899910 3:46834069-46834091 GCCCCGGGAGCCGCCGCCAGAGG + Exonic
961012914 3:123448132-123448154 GCCGCCGCCGCCGCCCGCAGGGG + Exonic
961012937 3:123448189-123448211 GTCGCGGCAGCCGCCGGCAGCGG - Exonic
964786483 3:160400891-160400913 GTCGCTGCTGGCGCCGTCAGGGG - Exonic
968726551 4:2250558-2250580 GGCGGCCCAGCCGCCGGCAGTGG + Exonic
969268236 4:6080132-6080154 GGCGCGGCTGCCCCTGGCAGGGG - Intronic
972765789 4:42151698-42151720 GCGGCGGCGGCCGCCGGCACCGG - Exonic
973532287 4:51844788-51844810 GTCGCGGCCGCGCCCGGCCGCGG + Intronic
976367205 4:84245144-84245166 GCCGCAGCTGCCGCCGGCTGAGG - Intergenic
978361067 4:107931658-107931680 GCCGTCGCAGCCGCCGGCCGAGG + Exonic
981429879 4:144646172-144646194 GAAGCTGCAGCCGCCGGCAGAGG + Exonic
982204665 4:152988793-152988815 GTGGAGGCAGCCGCCTGCAGGGG - Intergenic
983649791 4:170026504-170026526 TTCGCGGCAGCCGCGGGCGGGGG + Intronic
985996778 5:3601233-3601255 GCCACTGGAGCCGCCGGCAGAGG - Exonic
986284529 5:6349528-6349550 GTGGGGGCAGCCGCCGGGAGGGG + Intergenic
991298167 5:65103024-65103046 GCCTCGGCGGCCGCCGGGAGCGG + Intergenic
991977273 5:72195738-72195760 GTCGCTGCAGCTGTCGGCACTGG + Exonic
992269824 5:75053161-75053183 CCCGCGGCAGCCGCCGCCTGCGG - Intergenic
992312164 5:75511700-75511722 GTCGCGTCAGACGCCGGGAGGGG - Intronic
992473159 5:77077435-77077457 TGCGCGGCAGCCGGCGGGAGCGG - Exonic
996597884 5:125226238-125226260 GTCCCAGCAGTCACCGGCAGAGG - Intergenic
998311579 5:141137445-141137467 GCCGGGGCCGCCTCCGGCAGCGG - Exonic
998319552 5:141216137-141216159 GTCGGGGCCGCCTCCGGGAGAGG - Exonic
998424193 5:142013002-142013024 GTCGCTGCAGCCGCCGCGGGAGG - Intronic
1001902752 5:175444837-175444859 GAAGTCGCAGCCGCCGGCAGAGG - Intergenic
1003624094 6:7727055-7727077 GCCGCGGCCGCCGCCGCCGGGGG + Exonic
1004024504 6:11805768-11805790 GCAGCGGCAGCCCCAGGCAGAGG - Intronic
1004262051 6:14117498-14117520 GTCGCTGCTGCGGCTGGCAGCGG - Intronic
1004925455 6:20411596-20411618 GTCGCAGCAGCCGAGTGCAGAGG - Intronic
1006834143 6:36986408-36986430 GTGGCGGCAGCCGCAGGCCGGGG + Intergenic
1006836048 6:36999337-36999359 GTCACGGCAGCCTCTGGCACAGG + Intergenic
1007614349 6:43171588-43171610 GCCGCCGCAGCCGCCGCCATCGG - Exonic
1011416222 6:87122656-87122678 GTGGCCGCAGCCGCCGCCTGGGG - Intergenic
1011643033 6:89433104-89433126 GGCGTAGGAGCCGCCGGCAGGGG + Intergenic
1017282125 6:152636833-152636855 GCCGCGGCCGCCGGCCGCAGCGG - Intronic
1019343664 7:519760-519782 GCCGCAGCCGCCGCCGGGAGAGG + Intronic
1019592157 7:1841024-1841046 ATCCCACCAGCCGCCGGCAGTGG - Intronic
1020099577 7:5387721-5387743 GTGGCGGCAGTGGCCGGCTGGGG - Exonic
1022106271 7:27199881-27199903 GCCGCCGCAGCCGCCGGGTGGGG + Exonic
1022107179 7:27204983-27205005 GCCGCGGCTGCCGCCGGCTTCGG - Intergenic
1023417891 7:39949850-39949872 GCCGCCGCCGCCGCCAGCAGAGG - Intergenic
1028988010 7:97022908-97022930 GTCGGGGCCGCCGCAGACAGAGG + Intronic
1029154280 7:98503951-98503973 TTGCCGGCAGCCGCAGGCAGAGG + Intergenic
1029440892 7:100586101-100586123 GCAGCGGGAGCCGCCGGGAGCGG - Exonic
1037262892 8:17027484-17027506 GTGGCGGCGGCGGCCGGCGGGGG + Exonic
1043428453 8:80171539-80171561 TTCGCGGGAGTCGCCGGCGGAGG - Intronic
1043502948 8:80874269-80874291 GGCGCGGCGGCCGCGGGCGGGGG + Intronic
1044229340 8:89757375-89757397 GTAGCGGCAGCGTCCGGCTGGGG - Intergenic
1044719753 8:95134000-95134022 GTCGCCGCCGCCGCCGCCCGCGG + Exonic
1049230790 8:141480172-141480194 CTCGCTGCAGCCGCAGGCAGAGG - Intergenic
1049788434 8:144462359-144462381 GCGGCGGCGGCGGCCGGCAGCGG - Intronic
1056135122 9:83623354-83623376 GGCGCGGCAGCCGCGGGCCTCGG - Intronic
1056475290 9:86946785-86946807 GCAGCGGCGGCCGCCGGGAGAGG + Exonic
1056550565 9:87650045-87650067 GTCGTGGTAGCCCCTGGCAGAGG - Exonic
1057168588 9:92947413-92947435 GTCCCTGCAGCTGCCGGGAGAGG + Intergenic
1060526524 9:124324104-124324126 CTCGGTGCAGCCGCCAGCAGGGG + Intronic
1060987564 9:127828488-127828510 GTCGCAGTAGCCGCCGGCTCTGG - Intronic
1061665849 9:132160957-132160979 GTAGCAGCAGCCCCGGGCAGAGG - Intergenic
1061968646 9:134031253-134031275 GTCGGGGGAGCGGCCGGCTGTGG - Exonic
1062269984 9:135703946-135703968 GGCAGAGCAGCCGCCGGCAGTGG + Intronic
1062385783 9:136310992-136311014 GACCCGGCAGCGGCCGGCATGGG + Intergenic
1062587267 9:137255012-137255034 CTCGCGGCAGCCACGCGCAGCGG - Intergenic
1062671400 9:137712021-137712043 GTAGCGGCAGAGGCGGGCAGCGG - Intronic
1187873446 X:23783377-23783399 GTCACTGCAGTCGGCGGCAGTGG - Exonic
1189002875 X:36963969-36963991 GCCGCGGGAGCCGCGGGCGGGGG - Intergenic
1189310021 X:40012423-40012445 TCCGCGGCAGCTGCGGGCAGAGG - Intergenic
1191797265 X:65034724-65034746 GTGGCAGCAGTCGCCGACAGGGG + Intergenic
1195923186 X:110002678-110002700 GCCGCGGCGGCGGCCGCCAGGGG + Intronic
1196388902 X:115189724-115189746 GTCCCGCCAACCCCCGGCAGCGG + Exonic
1196684070 X:118495887-118495909 GCCGCGGCCGCCGCGGGCCGGGG + Exonic
1196684150 X:118496206-118496228 GCACCGGCAGCCGCCGGCCGGGG + Intronic
1198750464 X:139932680-139932702 GGCGCGGCAGCCGCGGACCGAGG - Intronic
1200251992 X:154558771-154558793 GTCGGGGCAGACGTCGGGAGAGG + Intronic
1200265776 X:154645645-154645667 GTCGGGGCAGACGTCGGGAGAGG - Intergenic