ID: 961013046

View in Genome Browser
Species Human (GRCh38)
Location 3:123448576-123448598
Sequence CTCCCCCGGAAGCCGGGCCG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 238}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961013030_961013046 15 Left 961013030 3:123448538-123448560 CCGGACATCCCCCCCTCGGCCTC 0: 1
1: 0
2: 0
3: 40
4: 495
Right 961013046 3:123448576-123448598 CTCCCCCGGAAGCCGGGCCGGGG 0: 1
1: 0
2: 0
3: 21
4: 238
961013033_961013046 5 Left 961013033 3:123448548-123448570 CCCCCTCGGCCTCGTCGTCTCCT 0: 1
1: 0
2: 7
3: 91
4: 528
Right 961013046 3:123448576-123448598 CTCCCCCGGAAGCCGGGCCGGGG 0: 1
1: 0
2: 0
3: 21
4: 238
961013037_961013046 -4 Left 961013037 3:123448557-123448579 CCTCGTCGTCTCCTTCCTCCTCC 0: 1
1: 1
2: 16
3: 412
4: 3243
Right 961013046 3:123448576-123448598 CTCCCCCGGAAGCCGGGCCGGGG 0: 1
1: 0
2: 0
3: 21
4: 238
961013034_961013046 4 Left 961013034 3:123448549-123448571 CCCCTCGGCCTCGTCGTCTCCTT 0: 1
1: 0
2: 0
3: 4
4: 109
Right 961013046 3:123448576-123448598 CTCCCCCGGAAGCCGGGCCGGGG 0: 1
1: 0
2: 0
3: 21
4: 238
961013036_961013046 2 Left 961013036 3:123448551-123448573 CCTCGGCCTCGTCGTCTCCTTCC 0: 1
1: 0
2: 0
3: 18
4: 240
Right 961013046 3:123448576-123448598 CTCCCCCGGAAGCCGGGCCGGGG 0: 1
1: 0
2: 0
3: 21
4: 238
961013035_961013046 3 Left 961013035 3:123448550-123448572 CCCTCGGCCTCGTCGTCTCCTTC 0: 1
1: 0
2: 0
3: 13
4: 147
Right 961013046 3:123448576-123448598 CTCCCCCGGAAGCCGGGCCGGGG 0: 1
1: 0
2: 0
3: 21
4: 238
961013031_961013046 7 Left 961013031 3:123448546-123448568 CCCCCCCTCGGCCTCGTCGTCTC 0: 1
1: 0
2: 0
3: 14
4: 190
Right 961013046 3:123448576-123448598 CTCCCCCGGAAGCCGGGCCGGGG 0: 1
1: 0
2: 0
3: 21
4: 238
961013032_961013046 6 Left 961013032 3:123448547-123448569 CCCCCCTCGGCCTCGTCGTCTCC 0: 1
1: 0
2: 0
3: 17
4: 298
Right 961013046 3:123448576-123448598 CTCCCCCGGAAGCCGGGCCGGGG 0: 1
1: 0
2: 0
3: 21
4: 238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961013046 Original CRISPR CTCCCCCGGAAGCCGGGCCG GGG Exonic
900149886 1:1173757-1173779 CAGCCCGGGAAGCCGGGCTGAGG - Intergenic
900402040 1:2476606-2476628 CTCCCCCGACAGCCGGACCAAGG + Exonic
901934491 1:12618243-12618265 CTCCCCGGGCAGCCGCGTCGCGG + Intergenic
903132646 1:21289933-21289955 CCCTCCCGGATGCCGGGACGAGG + Intronic
903485676 1:23688222-23688244 CTCCCTCTGATGCCGAGCCGAGG + Intergenic
903961946 1:27063480-27063502 CTCCCTCTGATGCCGAGCCGAGG + Intergenic
904252990 1:29237838-29237860 CTCCTGCGGTGGCCGGGCCGCGG + Intronic
904761158 1:32805189-32805211 CTCCCTCTGATGCCGAGCCGAGG - Intronic
904799153 1:33080966-33080988 CTCCCCCGGAGGCCTGGCGGTGG - Intronic
904831810 1:33310264-33310286 CTCCCTCTGATGCCGAGCCGAGG - Intronic
905390817 1:37634500-37634522 CTTCCCCGGGAGCTGGGGCGCGG - Intronic
905684965 1:39901582-39901604 CGTCCCGGGAAGCCGGGCCCCGG + Intronic
907364337 1:53946472-53946494 CTTCCCCGTCAGCCGGGCCGCGG + Exonic
910897055 1:92080393-92080415 CTCCCAGAGAAGCCGGACCGCGG - Exonic
913186526 1:116374046-116374068 CCCCGCCGGAACCGGGGCCGCGG - Exonic
913548790 1:119896448-119896470 CTCCCCCGGAAACCCTGCCAGGG - Exonic
916049895 1:161029002-161029024 CTCCCTCTGATGCCGAGCCGAGG + Intronic
918172319 1:182010261-182010283 CTCCCTCTGATGCCGAGCCGAGG + Intergenic
919880673 1:201898683-201898705 CTCCCCTGGAAGTCTGGCCTGGG - Intronic
921192624 1:212724280-212724302 CTCCCTCTGATGCCGAGCCGAGG + Intergenic
922768123 1:228166386-228166408 CTCCCCCGGGTGCTGGGCCCTGG - Intronic
923716529 1:236429155-236429177 CTCCCTCTGATGCCGAGCCGAGG - Intronic
1064209050 10:13348022-13348044 CTCCTCCCGAAAACGGGCCGCGG + Exonic
1065215012 10:23439945-23439967 CTCCTCCAGGAGCCAGGCCGAGG - Exonic
1066325211 10:34352380-34352402 CTCCCTCTGATGCCGAGCCGAGG + Intronic
1067116115 10:43436849-43436871 CGCCCCCGGACGCCCAGCCGCGG + Intronic
1067669499 10:48306561-48306583 CGCCCCCGCAATCCGGGCCCCGG + Intergenic
1069677001 10:70255490-70255512 CGCCCCCGGGGGCCGGGCCCGGG + Exonic
1070327782 10:75399594-75399616 CTACCCAGGCAGCCTGGCCGGGG - Exonic
1070367598 10:75751276-75751298 CTCCCTCTGATGCCGAGCCGAGG - Intronic
1070767962 10:79067335-79067357 CTCCCCCCGCAGCCCGGCCGGGG + Intergenic
1072983015 10:100115335-100115357 CCCCGACGGCAGCCGGGCCGGGG - Intergenic
1073053029 10:100681415-100681437 CTCCTCCGGAAGCCGGCCCAGGG + Intergenic
1074592092 10:114822366-114822388 CTCCTCCAGGAGCCGGGGCGGGG + Intronic
1075693744 10:124418757-124418779 CATCCCCCGAACCCGGGCCGCGG + Intronic
1077441069 11:2569509-2569531 CTCCCTCAGAAGCCGGGCCCTGG - Intronic
1077532079 11:3102061-3102083 GTCCCCTGGAAGCCGGCCCTCGG + Intronic
1078615726 11:12863852-12863874 ATCCCCAGGATGCCGGGGCGTGG - Intronic
1079402817 11:20119458-20119480 CCCCACCGGAAGCTGGGGCGGGG - Intronic
1080538234 11:33243121-33243143 CTCCCTCTGATGCCGAGCCGAGG + Intergenic
1082166612 11:48956487-48956509 CTCCCTCTGATGCCGAGCCGAGG - Intergenic
1083033479 11:59615472-59615494 CTCCCCCGGCCCCCGGGCCCGGG + Exonic
1087487145 11:98770716-98770738 CTCCCTCTGATGCCGAGCCGAGG - Intergenic
1087713745 11:101583523-101583545 CTCCCCCGGGAGCGGGGCCCAGG - Exonic
1092743283 12:11649985-11650007 CTCTCCCGGCAGCCGCCCCGGGG - Exonic
1092881567 12:12891336-12891358 CACCCCTGGAAGCTGGGCGGGGG - Exonic
1094607294 12:31959641-31959663 CGGCCCCGGAACCCGGGCCTCGG + Intronic
1096495436 12:52037120-52037142 CTCCCCCGGCGGGCGGGGCGGGG - Intronic
1096841029 12:54379242-54379264 CCGCCCCGGAGGCGGGGCCGAGG + Intronic
1097110215 12:56652398-56652420 CTCCCTCTGAAGCCGAGCCGAGG - Intergenic
1097228777 12:57495961-57495983 CTCCCTCTGATGCCGAGCCGAGG - Intronic
1098369134 12:69738841-69738863 CTGCGCCGGAAGCGGGGCCGGGG - Intronic
1098774041 12:74588894-74588916 CTCCCTCTGATGCCGAGCCGAGG - Intergenic
1100606746 12:96158139-96158161 CTCCCTCTGATGCCGAGCCGAGG + Intergenic
1101493872 12:105235855-105235877 CTCCCGCGGCTGCCCGGCCGGGG + Intronic
1102492951 12:113299714-113299736 CTCCCCCGGCAGGAGGGGCGGGG + Exonic
1103324016 12:120108522-120108544 CTCTCCCGGAAGAAGGGCTGGGG - Intronic
1104038538 12:125114823-125114845 CTTCCCCGGGCGCCGGCCCGTGG + Intronic
1104038551 12:125114859-125114881 CTTCCCCGGGCGCCGGCCCGTGG + Intronic
1106115563 13:26814887-26814909 CTCCCACGGGAGCAGGGCCCCGG - Intergenic
1106799375 13:33241575-33241597 CTCCCTCTGATGCCGAGCCGAGG + Intronic
1111388456 13:87561128-87561150 CTCCCTCTGATGCCGAGCCGAGG + Intergenic
1111979716 13:95003171-95003193 CTCCCGCGGAAAGCGGCCCGGGG + Intergenic
1114578600 14:23736364-23736386 CTCCCTCTGATGCCGAGCCGAGG + Intergenic
1115257599 14:31419983-31420005 CTCGCCCGAAGGCCGGGCCGGGG + Intronic
1115494054 14:33985049-33985071 CTCCCTCTGATGCCGAGCCGAGG - Intronic
1116959785 14:50957193-50957215 CTCCCTCTGATGCCGAGCCGAGG - Intergenic
1117010782 14:51468252-51468274 CTCCCTCTGATGCCGAGCCGAGG - Intergenic
1117140994 14:52791307-52791329 CACCCCCGGGGGCCTGGCCGGGG + Intronic
1120892714 14:89505309-89505331 CTCCCTCTGATGCCGAGCCGAGG + Intronic
1121221364 14:92288132-92288154 GTCCCCTGGAAGCCGGGCTGGGG + Intergenic
1121786198 14:96663083-96663105 CTCCGCGGGAATCCGGGCCACGG - Intergenic
1122317547 14:100835030-100835052 GTCCCCAGGAGGGCGGGCCGGGG + Intergenic
1122505113 14:102227239-102227261 CTGACCCTGAAGCCAGGCCGGGG + Intronic
1124049129 15:26178804-26178826 CTCCTCCGAAAGCCAGGCTGGGG - Intergenic
1124093844 15:26630138-26630160 CACCTCCGGGAGCCTGGCCGAGG - Intronic
1124607732 15:31184002-31184024 CTCCCTCTGATGCCGAGCCGAGG + Intergenic
1124999372 15:34754765-34754787 ATCCCGCGGACGCCGGGACGAGG + Exonic
1126816684 15:52460607-52460629 CTCCCTCTGATGCCGAGCCGAGG - Intronic
1127611219 15:60639477-60639499 GTCCACTGGAAGCCGGGACGTGG - Intronic
1128230509 15:66031446-66031468 CTCCCATGGAGGCCGGGCTGGGG + Intronic
1128843875 15:70872356-70872378 CTCCCTCTGATGCCGAGCCGAGG - Intronic
1129082189 15:73051735-73051757 CTCCCACGGGAGCCGCGCCAGGG + Exonic
1129661878 15:77557357-77557379 CTCCCCGGGAGGCAGGCCCGAGG + Intergenic
1130352957 15:83107614-83107636 CGCCGCCGGAAGCTGGGGCGGGG + Exonic
1130564462 15:84981843-84981865 TTTCCCCGGAAGCGCGGCCGAGG + Intronic
1132696734 16:1205281-1205303 CTCCCCAGGAAGAGGGGCCCGGG + Intronic
1132719784 16:1309894-1309916 CTCCCCGGAAAGCTCGGCCGCGG - Intronic
1132775538 16:1591715-1591737 CTCCCCATGAAGGCTGGCCGGGG + Intronic
1133464896 16:6019654-6019676 CTGCTCCGGACGCCGGGGCGGGG - Intronic
1133467221 16:6039184-6039206 CTTCCCTGGAAGCCTGGTCGGGG + Intronic
1133784164 16:8962751-8962773 CTCCCCCGGAGGGCGCGCCGTGG - Intronic
1135382709 16:22008053-22008075 CTCACCCGGAAGCGAAGCCGCGG - Intronic
1135776067 16:25258139-25258161 CTTCCCCGGCAGCCAGGCCCCGG - Intergenic
1136165015 16:28447994-28448016 CTCCCTCTGATGCCGAGCCGAGG + Intergenic
1136197950 16:28666986-28667008 CTCCCTCTGATGCCGAGCCGAGG - Intergenic
1136214297 16:28781163-28781185 CTCCCTCTGATGCCGAGCCGAGG - Intergenic
1136259017 16:29061008-29061030 CTCCCTCTGATGCCGAGCCGAGG - Intergenic
1136295105 16:29297165-29297187 CTCTCCCGGAAGCCAGGCCTGGG - Intergenic
1137439207 16:48483807-48483829 CTCCCTCTGATGCCGAGCCGAGG - Intergenic
1137668698 16:50266767-50266789 CTCACCCGGCAGCCTGGCCTGGG + Intronic
1137787655 16:51151638-51151660 GGCCCCCGGCGGCCGGGCCGCGG - Intergenic
1137988490 16:53130537-53130559 CTCCCCCGGCAGCCCCGCCGCGG - Intronic
1138230310 16:55331497-55331519 CTCCCCAGGAATCCAGGCCTTGG - Intergenic
1138521137 16:57571423-57571445 CAGCCCCTGAAGCAGGGCCGGGG + Intronic
1141054822 16:80804722-80804744 CTGCTCCCGAAGCCGGCCCGGGG - Intergenic
1141544450 16:84755394-84755416 CTCAGCCAGAAGCCGGGCTGAGG - Intronic
1141660873 16:85440863-85440885 GTCCTCGGGAAGCCAGGCCGGGG - Intergenic
1142070074 16:88087049-88087071 CTCCCCCAGCAGCCGGGCTGTGG + Intronic
1142101005 16:88271174-88271196 CTCTCCGGGAAGCCAGGCCTGGG - Intergenic
1143155423 17:4833447-4833469 CTCCCCCGGAGACCGGGGAGGGG - Exonic
1145165766 17:20612587-20612609 TTGCCACGGAAGCCTGGCCGTGG - Intergenic
1146271359 17:31487923-31487945 CGGCCCCGGAACCCGAGCCGCGG - Intronic
1147382425 17:40063431-40063453 CTCCCCCGCCCGCCGCGCCGCGG + Intronic
1148733429 17:49851377-49851399 CCCCCGCGGGAGCCGGGCCGGGG + Intergenic
1149038363 17:52158865-52158887 CGCCCCCGGGTGCCGGGCTGCGG - Intronic
1151907140 17:77056112-77056134 GCCCCCGGAAAGCCGGGCCGGGG + Intergenic
1154218752 18:12434166-12434188 CCGCTGCGGAAGCCGGGCCGCGG + Intergenic
1157513666 18:48296084-48296106 CTCCCCCTGAAGATGGCCCGTGG + Intronic
1157857878 18:51118042-51118064 CTCCCTCTGATGCCGAGCCGAGG - Intergenic
1159636952 18:70816642-70816664 CTCCCCTGGAAGCCTGGCAAGGG - Intergenic
1160808286 19:1001859-1001881 CACCGCCGCAAGCCGGGGCGTGG + Intronic
1160842999 19:1154791-1154813 CTCCCCTGGGTGCCGGGCCCGGG - Intronic
1161114274 19:2488201-2488223 CTCCCCAGGACGCTGGGCCAGGG + Intergenic
1161685609 19:5701366-5701388 CTCCCTCTGATGCCGAGCCGAGG + Intronic
1162602287 19:11677837-11677859 CTCCCTCTGATGCCGAGCCGAGG - Intergenic
1163334305 19:16661076-16661098 CTCCCGCGGGGGCCGGGCCTGGG + Intergenic
1163725185 19:18919312-18919334 AGCCGCCGGAGGCCGGGCCGGGG + Exonic
1164217171 19:23160773-23160795 CTCCCGGGGCAGCCGGGCAGAGG + Intergenic
1167525134 19:49978958-49978980 CTCCCTGGGAAGCTGGGCCCTGG + Intronic
1167638257 19:50667409-50667431 CCCCCTCGGAGGACGGGCCGGGG - Exonic
927591353 2:24360533-24360555 CTCCGCAGGAAGCCGGGGGGCGG + Exonic
929133561 2:38602376-38602398 CTCCCCGGGAAGCAGGGCCTCGG - Intronic
929966810 2:46542751-46542773 CTCCTGGGGAGGCCGGGCCGGGG + Exonic
934768361 2:96893235-96893257 CTCCCCAGGAAGCTGAGCCCGGG + Intronic
934993479 2:98936984-98937006 CTCCTCCGGAGCCCGAGCCGCGG + Intergenic
936158364 2:110064603-110064625 CTCCCTCTGATGCCGAGCCGAGG - Intergenic
936186297 2:110306723-110306745 CTCCCTCTGATGCCGAGCCGAGG + Intergenic
936345464 2:111672111-111672133 CTCCCTCTGATGCCGAGCCGAGG + Intergenic
936585669 2:113756142-113756164 CTCCCCGGGGAGCCGAGGCGAGG + Intronic
938108804 2:128550924-128550946 CTCCTGCGGAACCCGGGCCTGGG + Intergenic
941350765 2:164431864-164431886 CTCCCCTGGTAGCCGTGCAGAGG - Intergenic
941934277 2:170971128-170971150 CTCCCCAGGAAGCAAGGCCATGG - Intergenic
942453578 2:176123132-176123154 CCGCCCGGGAAGCCGGGCAGCGG - Exonic
942653691 2:178194223-178194245 TTCCCACGGAGGCCGGGCCAGGG + Intergenic
944433239 2:199659428-199659450 CTCCTCCCGAAAACGGGCCGCGG - Intergenic
944570692 2:201041991-201042013 CTCCCTCTGATGCCGAGCCGAGG + Intronic
945102461 2:206274806-206274828 CTCCGCGGGCAGCGGGGCCGTGG + Exonic
945864993 2:215164234-215164256 CTCCCTCTGATGCCGAGCCGAGG - Intergenic
946019898 2:216633755-216633777 CTCGTCCGGGAGCCGGGCTGCGG + Exonic
946394095 2:219434765-219434787 CTCCCTCGCAACCCGAGCCGGGG + Intergenic
946447507 2:219751960-219751982 CTCCCTCTGATGCCGAGCCGAGG - Intergenic
946856715 2:223957387-223957409 TTCCCCCGGAACCCGGAACGCGG - Exonic
1168765825 20:381196-381218 CTCGCCCGGAGGCCGGGGGGCGG + Intronic
1170969860 20:21105917-21105939 TTTCCCCGCAGGCCGGGCCGAGG - Intergenic
1174416000 20:50367695-50367717 CTCACTCTGAAGCCGGGGCGAGG + Intergenic
1175281452 20:57806722-57806744 CTCCCCTGGAGGCTGGGCAGAGG - Intergenic
1175314778 20:58039711-58039733 CTCCCCCGGGAGCCAAGCCCTGG - Intergenic
1175983662 20:62753762-62753784 CTCCATTGGAAGCCGGGCCATGG + Intronic
1176194420 20:63830862-63830884 CACCCGCGGGGGCCGGGCCGGGG + Intronic
1178992656 21:37367760-37367782 CTCCCCCGGCGGCCGGCCCTGGG - Intronic
1180007935 21:45031863-45031885 CACCCCCCGCAGCCTGGCCGTGG - Intergenic
1180048032 21:45318677-45318699 CTCACCCTGGAGCTGGGCCGGGG - Intergenic
1181270850 22:21657699-21657721 CTCCCCCCGAGGCCGGAGCGTGG - Intronic
1181563099 22:23717038-23717060 GTCGCCCGGAAGCCCGGCGGTGG - Intergenic
1182236945 22:28883603-28883625 CTCCCCCGGCCGTCGCGCCGCGG - Exonic
1184676308 22:46045143-46045165 CTTCGCCGGGGGCCGGGCCGCGG - Intergenic
1185239380 22:49734539-49734561 CTCCCCTGGAGCCCTGGCCGTGG - Intergenic
1185259564 22:49853968-49853990 CCGCCCCAGAGGCCGGGCCGAGG + Exonic
1185299410 22:50071855-50071877 CTCCCCAGCAGGCCGGGCTGGGG - Intronic
954567225 3:51608787-51608809 CTCCCTCTGATGCCGAGCCGAGG - Intronic
958641547 3:96813538-96813560 GTCTCCCGGAAGCCGAGGCGCGG - Intergenic
960577341 3:119242000-119242022 CTCCCTCTGATGCCGAGCCGAGG + Intergenic
961013046 3:123448576-123448598 CTCCCCCGGAAGCCGGGCCGGGG + Exonic
961081557 3:124033031-124033053 CTCCCCGGGAGGCCGGCGCGGGG + Intergenic
966967088 3:185004441-185004463 CTCCCTCTGAGGCCGAGCCGAGG - Intronic
967388119 3:188929878-188929900 CTCCCCCAGAAGATGGGCCCAGG + Intergenic
968405609 4:337131-337153 CTCCCCCGGAAGCGCGGTCCTGG - Intergenic
968675004 4:1872151-1872173 TCCCCCGGGAAGCCGGGCCGCGG + Intronic
968952906 4:3703745-3703767 CCCCACGGGAAGACGGGCCGCGG + Intergenic
969394189 4:6909963-6909985 CTCCCGCGAGGGCCGGGCCGCGG + Intronic
969632172 4:8345192-8345214 CTCCCAGGGCAGCCCGGCCGTGG + Intergenic
972939585 4:44181280-44181302 CTCCCTCTGATGCCGAGCCGAGG + Intronic
976180378 4:82393258-82393280 CTCCCCAGGAACCAGGGACGAGG - Intergenic
978224759 4:106320781-106320803 CTCCCTCTGATGCCGAGCCGAGG + Intronic
979941616 4:126770640-126770662 CTCCCTCTGATGCCGAGCCGAGG + Intergenic
981429779 4:144645838-144645860 CCCGCCGGGAACCCGGGCCGTGG + Intergenic
981994679 4:150963220-150963242 CTCCCTCTGATGCCGAGCCGAGG + Intronic
982292241 4:153791408-153791430 CTCCCGCGGAGGCTGGGACGCGG + Intergenic
983664615 4:170167041-170167063 CTCCCTCTGATGCCGAGCCGAGG - Intergenic
983906186 4:173184559-173184581 CTCCCTCTGATGCCGAGCCGAGG - Intronic
984830296 4:183966534-183966556 CTCCCCCAGAAGCCGTTCCCAGG + Intronic
985064246 4:186105319-186105341 CTCCGCCGCCAGCCGCGCCGCGG + Intronic
987108749 5:14665026-14665048 CCCCTCCGGAAGCCGGGCTGGGG + Intronic
988419889 5:30992466-30992488 CTACCCCAGAAGCAGGGCAGAGG - Intergenic
989648928 5:43666553-43666575 CTCCCCCTGATGCCGAGCTGAGG - Intronic
996057569 5:118998526-118998548 CTCCCTCTGATGCCGAGCCGAGG + Intergenic
996948135 5:129094596-129094618 CCGCCCCGGAGGGCGGGCCGCGG - Intergenic
997582896 5:135028389-135028411 CTCCCCCGGCCGCTGGGCCTCGG + Exonic
999693171 5:154166298-154166320 CTTCCCCAGAGGCCGGGGCGGGG + Intronic
1002059882 5:176620021-176620043 GTCCCCCGGAAGGCAGGTCGGGG - Intergenic
1002061913 5:176630275-176630297 CTCACCTGGATGCGGGGCCGGGG + Exonic
1002139822 5:177132243-177132265 CTCCCCGGGGAACCGGGCTGCGG + Intergenic
1002662775 5:180802846-180802868 CTTCCCCGGCAGGCGGGGCGGGG + Intronic
1002898534 6:1392822-1392844 CTCCCAGGGAAGGCCGGCCGCGG - Intronic
1005710719 6:28501590-28501612 CTACCTCTGATGCCGGGCCGAGG + Intergenic
1007545143 6:42687445-42687467 CTCCCTCTGATGCCGAGCCGAGG - Intronic
1011443125 6:87408358-87408380 CTACCCCAGAAGCCGGACCTCGG + Intronic
1014463807 6:121730419-121730441 CTCCCTCTGATGCCGAGCCGAGG - Intergenic
1017063329 6:150507002-150507024 CTCCCTCTGATGCCGAGCCGAGG + Intergenic
1017774850 6:157672826-157672848 CTGCCCGGGAAGCCTGGCCTGGG + Exonic
1019343731 7:519929-519951 CTCCCCCGGATTCCGGGCCTGGG + Intronic
1019651391 7:2161141-2161163 CTCCCTCTGATGCCGAGCCGAGG + Intronic
1022317924 7:29263063-29263085 CTCCCTCTGATGCCGAGCCGAGG + Intronic
1022732051 7:33036333-33036355 CACCCACGGAAGCTGGGCCAGGG - Intronic
1025254596 7:57375045-57375067 CTCACTCTGAAGCCGGGGCGAGG - Intergenic
1026891185 7:73983771-73983793 CTCCCCCTGAGGCAGGGCCTTGG + Intergenic
1034508979 7:151519394-151519416 CTCGCCTGGGAGCCGGGTCGCGG - Intronic
1034639019 7:152587194-152587216 CTCCCTCTGATGCCGAGCCGAGG - Intergenic
1035266048 7:157690858-157690880 CTAGCCCGGGGGCCGGGCCGGGG - Intronic
1037134742 8:15446688-15446710 CTCCCTCTGATGCCGAGCCGAGG - Intronic
1039244769 8:35596697-35596719 CTCCCCTGGAAGCAGGGAGGGGG + Intronic
1039753322 8:40497188-40497210 CTCCCTCTGATGCCGAGCCGAGG - Intergenic
1040043676 8:42940443-42940465 CTCCCTCTGATGCCGAGCCGAGG - Intronic
1043891228 8:85654475-85654497 GTCCCCCGGAATCCCTGCCGCGG - Intergenic
1043892302 8:85661312-85661334 GTCCCCCGGAATCCCTGCCGCGG - Intergenic
1043893259 8:85716028-85716050 GTCCCCCGGAATCCCTGCCGCGG + Intergenic
1043895942 8:85737477-85737499 GTCCCCCGGAATCCCTGCCGCGG + Intergenic
1043896737 8:85744331-85744353 GTCCCCCGGAATCCCTGCCGCGG - Intergenic
1043899060 8:85762698-85762720 GTCCCCCGGAATCCCTGCCGCGG - Intergenic
1043900671 8:85774892-85774914 GTCCCCCGGAATCCCTGCCGCGG - Intergenic
1043902635 8:85790167-85790189 GTCCCCCGGAATCCCTGCCGCGG - Intergenic
1043904245 8:85802360-85802382 GTCCCCCGGAATCCCTGCCGCGG - Intergenic
1043905857 8:85814554-85814576 GTCCCCCGGAATCCCTGCCGCGG - Intergenic
1043907465 8:85826741-85826763 GTCCCCCGGAATCCCTGCCGCGG - Intergenic
1044969280 8:97604389-97604411 CTCCCTCTGATGCCGAGCCGAGG + Intergenic
1049177577 8:141203111-141203133 CTCCCTCTGATGCCGAGCCGAGG - Intergenic
1049178863 8:141210220-141210242 CTGCCACGGACGCCCGGCCGAGG + Intronic
1049565245 8:143334780-143334802 CACCCCGGGAGGCCGGGCGGCGG + Exonic
1052941751 9:34136873-34136895 CTCCCTCTGATGCCGAGCCGAGG + Intergenic
1053198419 9:36136932-36136954 GTTCCCCGGAAACCGCGCCGGGG - Intronic
1053294481 9:36902994-36903016 CTGCCCCGGGACCTGGGCCGAGG + Intronic
1060369821 9:123058014-123058036 CTCCCTCTGATGCCGAGCCGAGG - Intronic
1062015232 9:134287945-134287967 CTCCTCCTGCAGCCGGGCCCAGG + Intergenic
1062238514 9:135523954-135523976 CTGCACGGGAAGCCGGTCCGAGG + Exonic
1062646620 9:137551332-137551354 CTCCCCCGCAGGCCGGGCAGTGG - Exonic
1185457539 X:318412-318434 CTCCCCCGAAAGCCCTGCCGCGG + Intronic
1185617998 X:1434995-1435017 CTACCCCGAAACCTGGGCCGCGG + Intronic
1187279435 X:17846680-17846702 CTCCCCCTGCAGCCAGGCCTAGG - Intronic
1191679509 X:63826279-63826301 CTCCCTCTGATGCCGAGCCGAGG - Intergenic
1193890145 X:87033934-87033956 CTCCCCCTGATGCCGAGCGGAGG - Intergenic
1194254958 X:91624135-91624157 CTCCCCCAGAAGCGGGGACATGG - Intergenic
1195687849 X:107601985-107602007 CTCCCCCGGAGGCTGGGCACTGG - Exonic
1196778373 X:119361430-119361452 CTCCCTCTGATGCCGAGCCGAGG + Intergenic
1198534006 X:137569105-137569127 CTCGGCCCGACGCCGGGCCGCGG + Intronic
1200074136 X:153542936-153542958 GTCTCCCGGAAGCAGGGACGCGG - Intronic
1200235593 X:154466405-154466427 TGCCCCCGGACGCCGGGCCACGG - Exonic
1200324736 X:155224563-155224585 CTCCCTCTGATGCCGAGCCGAGG - Intronic
1200573744 Y:4863738-4863760 CTCCCCCAGAAGCGGGGACATGG - Intergenic
1201948167 Y:19535234-19535256 CTCCCCCTGATGCCGAGCGGAGG + Intergenic