ID: 961013415

View in Genome Browser
Species Human (GRCh38)
Location 3:123449852-123449874
Sequence GGCCAGGCCGGGGGCGGAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1834
Summary {0: 1, 1: 1, 2: 17, 3: 189, 4: 1626}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961013415_961013426 3 Left 961013415 3:123449852-123449874 CCGCCTCCGCCCCCGGCCTGGCC 0: 1
1: 1
2: 17
3: 189
4: 1626
Right 961013426 3:123449878-123449900 GCCCCAGCCTCGGCGCCCCGCGG 0: 1
1: 1
2: 2
3: 56
4: 1024
961013415_961013432 14 Left 961013415 3:123449852-123449874 CCGCCTCCGCCCCCGGCCTGGCC 0: 1
1: 1
2: 17
3: 189
4: 1626
Right 961013432 3:123449889-123449911 GGCGCCCCGCGGGCATCCTCAGG 0: 1
1: 0
2: 1
3: 8
4: 93
961013415_961013438 26 Left 961013415 3:123449852-123449874 CCGCCTCCGCCCCCGGCCTGGCC 0: 1
1: 1
2: 17
3: 189
4: 1626
Right 961013438 3:123449901-123449923 GCATCCTCAGGCCTGGCCGCGGG 0: 1
1: 1
2: 0
3: 37
4: 250
961013415_961013424 -7 Left 961013415 3:123449852-123449874 CCGCCTCCGCCCCCGGCCTGGCC 0: 1
1: 1
2: 17
3: 189
4: 1626
Right 961013424 3:123449868-123449890 CCTGGCCATGGCCCCAGCCTCGG 0: 1
1: 0
2: 6
3: 98
4: 711
961013415_961013437 25 Left 961013415 3:123449852-123449874 CCGCCTCCGCCCCCGGCCTGGCC 0: 1
1: 1
2: 17
3: 189
4: 1626
Right 961013437 3:123449900-123449922 GGCATCCTCAGGCCTGGCCGCGG 0: 1
1: 0
2: 4
3: 28
4: 256
961013415_961013435 19 Left 961013415 3:123449852-123449874 CCGCCTCCGCCCCCGGCCTGGCC 0: 1
1: 1
2: 17
3: 189
4: 1626
Right 961013435 3:123449894-123449916 CCCGCGGGCATCCTCAGGCCTGG 0: 1
1: 0
2: 1
3: 13
4: 161
961013415_961013428 4 Left 961013415 3:123449852-123449874 CCGCCTCCGCCCCCGGCCTGGCC 0: 1
1: 1
2: 17
3: 189
4: 1626
Right 961013428 3:123449879-123449901 CCCCAGCCTCGGCGCCCCGCGGG 0: 1
1: 0
2: 4
3: 40
4: 357

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961013415 Original CRISPR GGCCAGGCCGGGGGCGGAGG CGG (reversed) Intergenic