ID: 961013422

View in Genome Browser
Species Human (GRCh38)
Location 3:123449864-123449886
Sequence GGCTGGGGCCATGGCCAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 918
Summary {0: 1, 1: 0, 2: 8, 3: 101, 4: 808}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961013422_961013428 -8 Left 961013422 3:123449864-123449886 CCGGCCTGGCCATGGCCCCAGCC 0: 1
1: 0
2: 8
3: 101
4: 808
Right 961013428 3:123449879-123449901 CCCCAGCCTCGGCGCCCCGCGGG 0: 1
1: 0
2: 4
3: 40
4: 357
961013422_961013437 13 Left 961013422 3:123449864-123449886 CCGGCCTGGCCATGGCCCCAGCC 0: 1
1: 0
2: 8
3: 101
4: 808
Right 961013437 3:123449900-123449922 GGCATCCTCAGGCCTGGCCGCGG 0: 1
1: 0
2: 4
3: 28
4: 256
961013422_961013438 14 Left 961013422 3:123449864-123449886 CCGGCCTGGCCATGGCCCCAGCC 0: 1
1: 0
2: 8
3: 101
4: 808
Right 961013438 3:123449901-123449923 GCATCCTCAGGCCTGGCCGCGGG 0: 1
1: 1
2: 0
3: 37
4: 250
961013422_961013432 2 Left 961013422 3:123449864-123449886 CCGGCCTGGCCATGGCCCCAGCC 0: 1
1: 0
2: 8
3: 101
4: 808
Right 961013432 3:123449889-123449911 GGCGCCCCGCGGGCATCCTCAGG 0: 1
1: 0
2: 1
3: 8
4: 93
961013422_961013426 -9 Left 961013422 3:123449864-123449886 CCGGCCTGGCCATGGCCCCAGCC 0: 1
1: 0
2: 8
3: 101
4: 808
Right 961013426 3:123449878-123449900 GCCCCAGCCTCGGCGCCCCGCGG 0: 1
1: 1
2: 2
3: 56
4: 1024
961013422_961013435 7 Left 961013422 3:123449864-123449886 CCGGCCTGGCCATGGCCCCAGCC 0: 1
1: 0
2: 8
3: 101
4: 808
Right 961013435 3:123449894-123449916 CCCGCGGGCATCCTCAGGCCTGG 0: 1
1: 0
2: 1
3: 13
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961013422 Original CRISPR GGCTGGGGCCATGGCCAGGC CGG (reversed) Intergenic