ID: 961013424

View in Genome Browser
Species Human (GRCh38)
Location 3:123449868-123449890
Sequence CCTGGCCATGGCCCCAGCCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 816
Summary {0: 1, 1: 0, 2: 6, 3: 98, 4: 711}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961013412_961013424 3 Left 961013412 3:123449842-123449864 CCGCGCGAGGCCGCCTCCGCCCC 0: 1
1: 0
2: 2
3: 42
4: 412
Right 961013424 3:123449868-123449890 CCTGGCCATGGCCCCAGCCTCGG 0: 1
1: 0
2: 6
3: 98
4: 711
961013408_961013424 22 Left 961013408 3:123449823-123449845 CCCGGGCCTCGGCTCACAGCCGC 0: 1
1: 0
2: 2
3: 27
4: 263
Right 961013424 3:123449868-123449890 CCTGGCCATGGCCCCAGCCTCGG 0: 1
1: 0
2: 6
3: 98
4: 711
961013407_961013424 25 Left 961013407 3:123449820-123449842 CCGCCCGGGCCTCGGCTCACAGC 0: 1
1: 0
2: 4
3: 36
4: 222
Right 961013424 3:123449868-123449890 CCTGGCCATGGCCCCAGCCTCGG 0: 1
1: 0
2: 6
3: 98
4: 711
961013415_961013424 -7 Left 961013415 3:123449852-123449874 CCGCCTCCGCCCCCGGCCTGGCC 0: 1
1: 1
2: 17
3: 189
4: 1626
Right 961013424 3:123449868-123449890 CCTGGCCATGGCCCCAGCCTCGG 0: 1
1: 0
2: 6
3: 98
4: 711
961013416_961013424 -10 Left 961013416 3:123449855-123449877 CCTCCGCCCCCGGCCTGGCCATG 0: 1
1: 1
2: 16
3: 263
4: 1977
Right 961013424 3:123449868-123449890 CCTGGCCATGGCCCCAGCCTCGG 0: 1
1: 0
2: 6
3: 98
4: 711
961013406_961013424 30 Left 961013406 3:123449815-123449837 CCGCGCCGCCCGGGCCTCGGCTC 0: 1
1: 0
2: 0
3: 53
4: 431
Right 961013424 3:123449868-123449890 CCTGGCCATGGCCCCAGCCTCGG 0: 1
1: 0
2: 6
3: 98
4: 711
961013410_961013424 16 Left 961013410 3:123449829-123449851 CCTCGGCTCACAGCCGCGCGAGG 0: 1
1: 0
2: 0
3: 1
4: 57
Right 961013424 3:123449868-123449890 CCTGGCCATGGCCCCAGCCTCGG 0: 1
1: 0
2: 6
3: 98
4: 711
961013409_961013424 21 Left 961013409 3:123449824-123449846 CCGGGCCTCGGCTCACAGCCGCG 0: 1
1: 0
2: 0
3: 18
4: 173
Right 961013424 3:123449868-123449890 CCTGGCCATGGCCCCAGCCTCGG 0: 1
1: 0
2: 6
3: 98
4: 711

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961013424 Original CRISPR CCTGGCCATGGCCCCAGCCT CGG Intergenic