ID: 961013425

View in Genome Browser
Species Human (GRCh38)
Location 3:123449873-123449895
Sequence GGGCGCCGAGGCTGGGGCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 663
Summary {0: 1, 1: 0, 2: 8, 3: 54, 4: 600}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961013425_961013438 5 Left 961013425 3:123449873-123449895 CCATGGCCCCAGCCTCGGCGCCC 0: 1
1: 0
2: 8
3: 54
4: 600
Right 961013438 3:123449901-123449923 GCATCCTCAGGCCTGGCCGCGGG 0: 1
1: 1
2: 0
3: 37
4: 250
961013425_961013432 -7 Left 961013425 3:123449873-123449895 CCATGGCCCCAGCCTCGGCGCCC 0: 1
1: 0
2: 8
3: 54
4: 600
Right 961013432 3:123449889-123449911 GGCGCCCCGCGGGCATCCTCAGG 0: 1
1: 0
2: 1
3: 8
4: 93
961013425_961013437 4 Left 961013425 3:123449873-123449895 CCATGGCCCCAGCCTCGGCGCCC 0: 1
1: 0
2: 8
3: 54
4: 600
Right 961013437 3:123449900-123449922 GGCATCCTCAGGCCTGGCCGCGG 0: 1
1: 0
2: 4
3: 28
4: 256
961013425_961013435 -2 Left 961013425 3:123449873-123449895 CCATGGCCCCAGCCTCGGCGCCC 0: 1
1: 0
2: 8
3: 54
4: 600
Right 961013435 3:123449894-123449916 CCCGCGGGCATCCTCAGGCCTGG 0: 1
1: 0
2: 1
3: 13
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961013425 Original CRISPR GGGCGCCGAGGCTGGGGCCA TGG (reversed) Intergenic