ID: 961013428

View in Genome Browser
Species Human (GRCh38)
Location 3:123449879-123449901
Sequence CCCCAGCCTCGGCGCCCCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 402
Summary {0: 1, 1: 0, 2: 4, 3: 40, 4: 357}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961013419_961013428 -5 Left 961013419 3:123449861-123449883 CCCCCGGCCTGGCCATGGCCCCA 0: 1
1: 0
2: 1
3: 41
4: 417
Right 961013428 3:123449879-123449901 CCCCAGCCTCGGCGCCCCGCGGG 0: 1
1: 0
2: 4
3: 40
4: 357
961013410_961013428 27 Left 961013410 3:123449829-123449851 CCTCGGCTCACAGCCGCGCGAGG 0: 1
1: 0
2: 0
3: 1
4: 57
Right 961013428 3:123449879-123449901 CCCCAGCCTCGGCGCCCCGCGGG 0: 1
1: 0
2: 4
3: 40
4: 357
961013418_961013428 -2 Left 961013418 3:123449858-123449880 CCGCCCCCGGCCTGGCCATGGCC 0: 1
1: 1
2: 5
3: 77
4: 640
Right 961013428 3:123449879-123449901 CCCCAGCCTCGGCGCCCCGCGGG 0: 1
1: 0
2: 4
3: 40
4: 357
961013416_961013428 1 Left 961013416 3:123449855-123449877 CCTCCGCCCCCGGCCTGGCCATG 0: 1
1: 1
2: 16
3: 263
4: 1977
Right 961013428 3:123449879-123449901 CCCCAGCCTCGGCGCCCCGCGGG 0: 1
1: 0
2: 4
3: 40
4: 357
961013412_961013428 14 Left 961013412 3:123449842-123449864 CCGCGCGAGGCCGCCTCCGCCCC 0: 1
1: 0
2: 2
3: 42
4: 412
Right 961013428 3:123449879-123449901 CCCCAGCCTCGGCGCCCCGCGGG 0: 1
1: 0
2: 4
3: 40
4: 357
961013420_961013428 -6 Left 961013420 3:123449862-123449884 CCCCGGCCTGGCCATGGCCCCAG 0: 1
1: 1
2: 3
3: 41
4: 539
Right 961013428 3:123449879-123449901 CCCCAGCCTCGGCGCCCCGCGGG 0: 1
1: 0
2: 4
3: 40
4: 357
961013422_961013428 -8 Left 961013422 3:123449864-123449886 CCGGCCTGGCCATGGCCCCAGCC 0: 1
1: 0
2: 8
3: 101
4: 808
Right 961013428 3:123449879-123449901 CCCCAGCCTCGGCGCCCCGCGGG 0: 1
1: 0
2: 4
3: 40
4: 357
961013421_961013428 -7 Left 961013421 3:123449863-123449885 CCCGGCCTGGCCATGGCCCCAGC 0: 1
1: 1
2: 10
3: 79
4: 945
Right 961013428 3:123449879-123449901 CCCCAGCCTCGGCGCCCCGCGGG 0: 1
1: 0
2: 4
3: 40
4: 357
961013415_961013428 4 Left 961013415 3:123449852-123449874 CCGCCTCCGCCCCCGGCCTGGCC 0: 1
1: 1
2: 17
3: 189
4: 1626
Right 961013428 3:123449879-123449901 CCCCAGCCTCGGCGCCCCGCGGG 0: 1
1: 0
2: 4
3: 40
4: 357

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961013428 Original CRISPR CCCCAGCCTCGGCGCCCCGC GGG Intergenic