ID: 961013429

View in Genome Browser
Species Human (GRCh38)
Location 3:123449880-123449902
Sequence GCCCGCGGGGCGCCGAGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 217}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961013429_961013438 -2 Left 961013429 3:123449880-123449902 CCCAGCCTCGGCGCCCCGCGGGC 0: 1
1: 0
2: 0
3: 23
4: 217
Right 961013438 3:123449901-123449923 GCATCCTCAGGCCTGGCCGCGGG 0: 1
1: 1
2: 0
3: 37
4: 250
961013429_961013435 -9 Left 961013429 3:123449880-123449902 CCCAGCCTCGGCGCCCCGCGGGC 0: 1
1: 0
2: 0
3: 23
4: 217
Right 961013435 3:123449894-123449916 CCCGCGGGCATCCTCAGGCCTGG 0: 1
1: 0
2: 1
3: 13
4: 161
961013429_961013437 -3 Left 961013429 3:123449880-123449902 CCCAGCCTCGGCGCCCCGCGGGC 0: 1
1: 0
2: 0
3: 23
4: 217
Right 961013437 3:123449900-123449922 GGCATCCTCAGGCCTGGCCGCGG 0: 1
1: 0
2: 4
3: 28
4: 256

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961013429 Original CRISPR GCCCGCGGGGCGCCGAGGCT GGG (reversed) Intergenic