ID: 961013431

View in Genome Browser
Species Human (GRCh38)
Location 3:123449885-123449907
Sequence AGGATGCCCGCGGGGCGCCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 205}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961013431_961013437 -8 Left 961013431 3:123449885-123449907 CCTCGGCGCCCCGCGGGCATCCT 0: 1
1: 0
2: 1
3: 14
4: 205
Right 961013437 3:123449900-123449922 GGCATCCTCAGGCCTGGCCGCGG 0: 1
1: 0
2: 4
3: 28
4: 256
961013431_961013438 -7 Left 961013431 3:123449885-123449907 CCTCGGCGCCCCGCGGGCATCCT 0: 1
1: 0
2: 1
3: 14
4: 205
Right 961013438 3:123449901-123449923 GCATCCTCAGGCCTGGCCGCGGG 0: 1
1: 1
2: 0
3: 37
4: 250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961013431 Original CRISPR AGGATGCCCGCGGGGCGCCG AGG (reversed) Intergenic