ID: 961013663

View in Genome Browser
Species Human (GRCh38)
Location 3:123450929-123450951
Sequence TTGCCCCCAAGCTGTCCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 1, 2: 2, 3: 10, 4: 191}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961013658_961013663 8 Left 961013658 3:123450898-123450920 CCTGTAGAATGATGTGTCTACCC 0: 1
1: 0
2: 0
3: 6
4: 62
Right 961013663 3:123450929-123450951 TTGCCCCCAAGCTGTCCTGCTGG 0: 1
1: 1
2: 2
3: 10
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961013663 Original CRISPR TTGCCCCCAAGCTGTCCTGC TGG Intergenic
900132295 1:1092267-1092289 TTTCCCCCGAGCTGGCCTCCTGG + Intronic
901433660 1:9233565-9233587 TTGGCCCCATTCAGTCCTGCCGG + Intergenic
903175822 1:21579820-21579842 ATGCCCCCAAGCTGTGGAGCTGG + Intergenic
905169269 1:36099641-36099663 TTGCCCCCAAGATGTCCCCTGGG - Intronic
905301558 1:36989506-36989528 TTGCCGCCAAGCGCTCCTCCCGG + Intronic
905791119 1:40790081-40790103 TTCTCCAGAAGCTGTCCTGCGGG + Intronic
906689271 1:47781937-47781959 CTGCCCCCTATCTGTCCTGTTGG + Intronic
907240081 1:53076346-53076368 CAGCCCCCAAACTGTCCTGGAGG - Intronic
910226149 1:84938645-84938667 TTCCTCCCAGCCTGTCCTGCAGG - Intronic
912511944 1:110195553-110195575 TTGCCCCCAAACCGGCCTCCCGG + Intronic
915108188 1:153547154-153547176 TTGTCCCCACGCCCTCCTGCTGG + Intronic
916390911 1:164330102-164330124 TTTCCCCCATGCTGTTCTCCTGG + Intergenic
916889800 1:169104755-169104777 TTCCCAGCAACCTGTCCTGCTGG + Intergenic
1063438388 10:6052887-6052909 ATGCCCCCAAGCTGCTCTGGGGG + Intronic
1063782944 10:9347815-9347837 TTTCCCCCATACTGTCCTCCTGG + Intergenic
1067066392 10:43106369-43106391 TGGCCACCACGGTGTCCTGCAGG - Exonic
1067836627 10:49645556-49645578 TGGCCCCCAACAGGTCCTGCCGG + Intronic
1068770966 10:60820224-60820246 TCACCCTCAAGATGTCCTGCGGG + Intergenic
1070415604 10:76186506-76186528 TTGAGCCCAGGCTGTCCTGGTGG + Intronic
1075282135 10:121148277-121148299 TTTTCCGGAAGCTGTCCTGCAGG + Intergenic
1075536790 10:123278248-123278270 TTTCCCCCAAGCTCTTCTCCTGG - Intergenic
1075954338 10:126509011-126509033 ATGCCCCCAGGCTGTGCTGAGGG + Intronic
1076162648 10:128257152-128257174 CTGCCCCCAAACTTGCCTGCAGG + Intergenic
1076219240 10:128719644-128719666 TTGCCCCCATGGAGTCGTGCTGG - Intergenic
1076243489 10:128928069-128928091 GTGCCCCCCAGCTGGCCTGGGGG - Intergenic
1076474985 10:130745525-130745547 TTCTCCCCAAGCCGTACTGCTGG - Intergenic
1076571523 10:131436261-131436283 CAGCCCCGAAGGTGTCCTGCTGG - Intergenic
1077208070 11:1353543-1353565 TGCCCCCCAGGCTGTCCTGTGGG - Intergenic
1077521345 11:3037167-3037189 TTTCACCCAAGCTGTGCTTCTGG - Intronic
1077934697 11:6771229-6771251 TTAGCGCCAAGCAGTCCTGCAGG + Intergenic
1079596952 11:22261712-22261734 TTTCCCCCATGCTGTTCTCCTGG - Intronic
1079611666 11:22440174-22440196 TTGGCCCCAAGCTGTCCTAGTGG - Intergenic
1080136653 11:28862949-28862971 TTACCTCCATGCTGTCCTTCAGG + Intergenic
1081240426 11:40698871-40698893 TTTCCCCCATGCTGTTCTCCTGG - Intronic
1085128078 11:74015492-74015514 CTGACCCCCAGCTGTACTGCAGG + Intronic
1086165659 11:83774933-83774955 TTGGCCCCAAGCTGTCATAAAGG - Intronic
1087008479 11:93491762-93491784 TGGCCCCCATGCTGGCATGCTGG + Intronic
1089614107 11:119685515-119685537 CTGACCCCAGCCTGTCCTGCTGG - Intronic
1090733182 11:129589373-129589395 TTGCCCCCAAGAGGCTCTGCAGG + Intergenic
1090853877 11:130594867-130594889 GTACCATCAAGCTGTCCTGCTGG - Intergenic
1091651182 12:2311264-2311286 TTGCCCCCAAACTGTGGTTCTGG + Intronic
1094300718 12:28962169-28962191 TTGCCCACATGCTGTACAGCAGG - Intergenic
1095392837 12:41729191-41729213 TTCTCCCCAACCTGTCATGCAGG - Intergenic
1097663766 12:62457923-62457945 ATGCCACAAAGCTCTCCTGCTGG + Intergenic
1100282007 12:93127236-93127258 TTGCCTCCAAGCTGTCCTGCAGG + Intergenic
1100445342 12:94655016-94655038 TTGCCCAAAAGCTGCTCTGCTGG + Intergenic
1101514507 12:105421772-105421794 TTGCCCCTATGCTATCCTGCAGG + Intergenic
1102454569 12:113063653-113063675 GTGCCCCCAAGCTGGCCAACAGG + Intronic
1103781980 12:123404918-123404940 TTGCCACCAAGCAGTTCTCCCGG + Exonic
1105217620 13:18298366-18298388 TTGCCACCAAGCAGTTCTCCCGG + Intergenic
1106589434 13:31086844-31086866 CTGTCCCCATGCTGCCCTGCTGG + Intergenic
1107321597 13:39194704-39194726 TTGTCCCCCAGCAGTCCTACAGG - Intergenic
1112359135 13:98701104-98701126 TTTTCCCCAAGCTGACCTGTAGG - Intronic
1113848011 13:113403515-113403537 ATGCCTCCATCCTGTCCTGCAGG + Intergenic
1114461349 14:22887987-22888009 TTACCCCCACTCTATCCTGCAGG + Intergenic
1114752790 14:25224362-25224384 TTTCTCCCTAACTGTCCTGCGGG - Intergenic
1115163285 14:30419438-30419460 TTTCCCCCAAGCATTCCTCCTGG - Intergenic
1119601720 14:75981166-75981188 TTGCCCTCCACCTGGCCTGCTGG - Exonic
1119780101 14:77271480-77271502 TTGCCACCCACCTGGCCTGCAGG + Intergenic
1120707786 14:87762143-87762165 TTTCCCCCATGCTGTCCTTGTGG + Intergenic
1121439478 14:93939740-93939762 TGGCGCCCGAGCTCTCCTGCTGG - Intronic
1122784468 14:104157481-104157503 CTGCCTCCAAGGAGTCCTGCTGG + Intronic
1123149895 14:106170635-106170657 TTGTCCCCAAGGTGCCCTGGTGG + Intergenic
1123169597 14:106359727-106359749 TTTCCCCCCAGCGTTCCTGCAGG + Intergenic
1123175220 14:106410430-106410452 TTTCCCCCCAGCGTTCCTGCAGG + Intergenic
1202943466 14_KI270726v1_random:5349-5371 TTTCCCCCCAGCGTTCCTGCAGG - Intergenic
1123408408 15:20038538-20038560 TTTCCCCCATGCTGTCCTCATGG + Intergenic
1123517732 15:21045179-21045201 TTTCCCCCATGCTGTCCTCATGG + Intergenic
1124858463 15:33413682-33413704 GTGCCCCCATGCTGTGCAGCAGG + Intronic
1125538853 15:40458429-40458451 TTGCCCACCTTCTGTCCTGCAGG + Exonic
1126447168 15:48760590-48760612 TTGGCACCAAGCAGTCCTCCAGG - Intronic
1127888766 15:63228561-63228583 TTTCCCACATGCTGTCTTGCAGG + Intronic
1129714748 15:77840467-77840489 TTGCCCCCAGGCTACCCTGAAGG + Intergenic
1131156759 15:90080418-90080440 GTGCCCCCCAGCTGTCCTGCAGG - Exonic
1132572920 16:651813-651835 TTGTCCCCCAGCAGTCCGGCCGG + Exonic
1133239957 16:4408377-4408399 TTGCCCCCATGGTGTCCAGAGGG - Intronic
1135659878 16:24286955-24286977 TTGCCGCCAGGCTGACCTCCAGG + Intronic
1135969187 16:27060063-27060085 CTGCCCCGAAGCGGGCCTGCAGG - Intergenic
1136109267 16:28054327-28054349 TTGGCCCCAAGCTTGCCTGGAGG - Intronic
1141673006 16:85502693-85502715 TTGACCCCAGGCTCCCCTGCAGG - Intergenic
1142351341 16:89582143-89582165 TGGCCACCCAGCTGACCTGCAGG + Intronic
1145939852 17:28737653-28737675 TAGGCCCCCATCTGTCCTGCAGG + Exonic
1146361673 17:32181157-32181179 TTCCCTCCAAGCTCTCTTGCAGG + Intronic
1148202706 17:45760312-45760334 TTGGCCCTGAGCTGTCCTGATGG + Intergenic
1148902928 17:50892204-50892226 TCACCCCCAACCTTTCCTGCAGG + Intergenic
1151218787 17:72595996-72596018 TTTCCCCCATACTGTCCTCCTGG - Intergenic
1152726296 17:81948347-81948369 GTGACCCCAGGCTGTCCTGCAGG - Intergenic
1152726313 17:81948432-81948454 GTGACCCCAGGCTGTCCTGCAGG - Intergenic
1152726328 17:81948517-81948539 TCGCTGCCATGCTGTCCTGCAGG - Intergenic
1157425865 18:47583815-47583837 ATGCCCCCTTGCTGTCTTGCAGG + Intergenic
1158542990 18:58373747-58373769 TTGCCCCCACGCTGTTATTCAGG + Intronic
1158558219 18:58492579-58492601 TGGCCACCAGTCTGTCCTGCAGG + Intronic
1160889667 19:1370664-1370686 TGGTCCCCAAGACGTCCTGCTGG - Exonic
1161083209 19:2321715-2321737 TGGCCTCCATGCCGTCCTGCGGG + Exonic
1161348586 19:3779786-3779808 CCACCCCCCAGCTGTCCTGCAGG - Exonic
1162032462 19:7923417-7923439 CTGTCCCCAAGGTGCCCTGCCGG - Intergenic
1163335545 19:16669181-16669203 CTGCAACCAAGATGTCCTGCAGG - Intronic
1164598926 19:29548248-29548270 TTGCAGACAAGCTGTCCTCCTGG - Intronic
1168061636 19:53896189-53896211 TTGCCCACCATCTGCCCTGCTGG - Intronic
1168434101 19:56303856-56303878 TTGCCCCCAAGCTGCTCTGAAGG - Intronic
925829828 2:7883035-7883057 CTGCCCCCAATCTTTTCTGCAGG - Intergenic
926498117 2:13616867-13616889 TTTCCCTCAAGCTGTTCTGGTGG + Intergenic
935077251 2:99757025-99757047 TGGCTCCCACGCTGTCCTCCTGG + Intronic
935671102 2:105557772-105557794 CTGCCCCAAGGCTGACCTGCAGG - Intergenic
935794881 2:106631491-106631513 TAGCCTCCAGGCTTTCCTGCAGG + Intergenic
939530473 2:143353910-143353932 TTGCCCCAAAGTTGTCATGATGG + Intronic
941816115 2:169797803-169797825 TTTCCCCCATGCTGTTCTCCTGG - Intronic
942869368 2:180716230-180716252 TTTCCCCCATACTGTCCTCCTGG + Intergenic
944527207 2:200631433-200631455 TTCCCCACAACCTATCCTGCTGG + Intronic
946173871 2:217910971-217910993 TTGGCCCCCAGCCATCCTGCTGG + Intronic
946175406 2:217919393-217919415 GTGCCCGCAAGGTGTCCTTCCGG + Intronic
946183135 2:217960817-217960839 TTCCCCCTAGGCTGTCCTCCAGG + Intronic
946637352 2:221744293-221744315 TTGCACACAAGCTGTCATGTGGG + Intergenic
1169065305 20:2691851-2691873 TGGCCCCCATGCTGTTCTGCAGG + Intergenic
1169342765 20:4809208-4809230 TTACCCCCAAGCTGTCTTTCAGG - Intronic
1171199785 20:23231792-23231814 TTGCCCCACAGCCTTCCTGCAGG + Intergenic
1172846741 20:37934202-37934224 TTGTCACCAGGCTGTGCTGCAGG + Intronic
1173038945 20:39442041-39442063 TTTCCCCCATGCTGTTCTCCAGG - Intergenic
1173789414 20:45818048-45818070 TTGACCCCAAACTGCCCTCCAGG + Intergenic
1176194120 20:63829391-63829413 TTGTCCCCAGGCTGGCCTGAAGG + Intronic
1178354851 21:31901980-31902002 TTGCCCACAGTCTGTCCAGCTGG - Intronic
1179028559 21:37700620-37700642 ATGCCACCAAGCCCTCCTGCTGG - Intronic
1179655392 21:42841581-42841603 TTGCCCCCAGGCTGTGCTCTTGG - Intergenic
1181392071 22:22590614-22590636 TTGCAGCCAAGCTGTCAGGCGGG + Intergenic
1182454077 22:30438728-30438750 TTTCCCCCAGCCCGTCCTGCAGG + Intergenic
1182486379 22:30641449-30641471 TTGCCCCAAATCTGTCTGGCAGG - Intronic
1183300729 22:37057796-37057818 TTGCACCTGAGCTGTCCTTCGGG - Intronic
1183671547 22:39275854-39275876 TGGCCCCCATGCTTTCCTGATGG - Intergenic
1185082194 22:48715647-48715669 TTACCCCAAGCCTGTCCTGCTGG + Intronic
949863762 3:8530235-8530257 TTGCCCACATTCTGTTCTGCAGG - Intronic
949956773 3:9275583-9275605 TTTCCCCCATACTGTCCTCCTGG + Intronic
950400687 3:12767312-12767334 TTTCCCCCCTGCTGTCCTGGAGG - Intronic
950613191 3:14139158-14139180 CTGCCCCCACCTTGTCCTGCAGG + Exonic
953387891 3:42517049-42517071 TTTCCCCCAACCTGTCTTGAGGG - Intronic
953420049 3:42747328-42747350 TGGCCACCAGCCTGTCCTGCAGG + Exonic
953545056 3:43858199-43858221 TAGTCCCCAAGCTGTCCTGCTGG - Intergenic
953666668 3:44930578-44930600 CTCCATCCAAGCTGTCCTGCTGG + Intronic
958701210 3:97592716-97592738 TTGCCCCCCAGGATTCCTGCTGG + Exonic
959546803 3:107605909-107605931 TTGTCCCCAAGCTTTGCTGTTGG + Intronic
961013663 3:123450929-123450951 TTGCCCCCAAGCTGTCCTGCTGG + Intergenic
961588698 3:127958412-127958434 TTACCACCAGTCTGTCCTGCAGG - Intronic
963229055 3:142891487-142891509 TTTCCCCCATGCTGTTCTCCTGG - Intergenic
964273787 3:154987137-154987159 GTGCCTCCATGCTGTCCTCCTGG - Intergenic
964910996 3:161779637-161779659 TTGCCCCCATGCTGTTCTCATGG + Intergenic
965189301 3:165507488-165507510 TTTCCCCCAAGCTGTTCTCATGG - Intergenic
968983371 4:3862897-3862919 CCGCCCCCAGGCTGTGCTGCTGG + Intergenic
969228415 4:5813826-5813848 TTGCCGCCCAGCTGTTGTGCTGG + Exonic
972731869 4:41802721-41802743 TTGCCCTCCAGCTGCCCTCCAGG + Intergenic
974017491 4:56661707-56661729 TTAGCCCCAAGATGTCATGCAGG - Intronic
976516277 4:85970740-85970762 TCACTCCCAAGCTGTGCTGCAGG - Intronic
977033333 4:91916518-91916540 TTGCCCCCAACTTTGCCTGCTGG + Intergenic
977179482 4:93856826-93856848 GTGCCTCCATGCTGTCCTCCTGG - Intergenic
981517413 4:145624895-145624917 TGGCCCCCAAGTGGTCATGCAGG + Intronic
982255046 4:153443455-153443477 CTGGCCCCAACCTGTCCTCCAGG - Intergenic
984012396 4:174385925-174385947 TTACCCCCATGCTGTCCTCATGG - Intergenic
985103753 4:186482565-186482587 TTTCCCCAAATCTGTCCTCCTGG + Intronic
985291678 4:188393834-188393856 TTTCGCCCAAGCTGTAGTGCAGG - Intergenic
985951257 5:3222988-3223010 TTGGTCCTAGGCTGTCCTGCAGG - Intergenic
986083152 5:4414937-4414959 TTGCCACCAGGATGTCCTGCTGG + Intergenic
986689832 5:10305204-10305226 TGGCCACCAGGGTGTCCTGCAGG - Intronic
989101641 5:37828984-37829006 TTGCTTCAAAGCTGTCTTGCAGG - Intronic
989184764 5:38612814-38612836 TTGCCCACAAGGTGTTCTGCTGG - Intergenic
990238568 5:53794239-53794261 TTCCCCCCATGCTGTTCTCCTGG - Intergenic
992111229 5:73496171-73496193 TGGCTCCCACGCTTTCCTGCTGG - Intergenic
993587340 5:89747041-89747063 TTGGAACCAAGCTGTCCAGCAGG + Intergenic
993740205 5:91529510-91529532 TTTCCCCCATGCTGTTCTGATGG - Intergenic
998185892 5:139979779-139979801 TTGCAGTCAAGCTGTCCTCCAGG - Intronic
1000283472 5:159803757-159803779 TTGCCTCCAAGGTGTCTTCCAGG + Intergenic
1000728643 5:164803013-164803035 TTGCCCCCATGCTGTTCTCGTGG - Intergenic
1001913591 5:175541213-175541235 CCGCCCCCAAGCTGTCCCACAGG + Intergenic
1002988489 6:2215465-2215487 TTGCCCCCATGCTGTTCTTGTGG - Intronic
1003977039 6:11354265-11354287 TTGCCCCCACGTTTTCCAGCTGG - Intronic
1005475874 6:26207305-26207327 TTACCTCCATGCTTTCCTGCTGG - Intergenic
1006673226 6:35743035-35743057 CTGACTCCAACCTGTCCTGCGGG + Intronic
1006716063 6:36121402-36121424 CTGCCCTCAAGCTGCCCAGCTGG + Intergenic
1010234804 6:73566472-73566494 TTCCCTCCAAGCAGTCCTTCAGG - Intergenic
1012463521 6:99491156-99491178 TTGCCCCCAAGCTCTAGTGTGGG - Intronic
1016450662 6:144179211-144179233 TTTCCCCCATGCTGTTCTGGTGG - Intronic
1018644829 6:165938214-165938236 TTGCCCACAAGCTGCTCTGTTGG - Intronic
1019327415 7:445305-445327 GTGCCCCCATGATGTGCTGCAGG + Intergenic
1020462050 7:8437108-8437130 TTTACCCCAAGGTGTCCTGTGGG - Intronic
1020481755 7:8669749-8669771 TTCTCCCCATGCTGTGCTGCAGG + Intronic
1022611045 7:31873408-31873430 TTCTCCCCACCCTGTCCTGCAGG - Exonic
1025611190 7:63076969-63076991 TTGTCCCCAACATGTCCTGGGGG + Intergenic
1025728719 7:64091099-64091121 CTGGCCTCAAGCTGTCCTCCCGG + Intronic
1026616259 7:71907365-71907387 TGGCCCCCAATTTGTCCTTCTGG - Intronic
1027641857 7:80745061-80745083 ATGCCCCCATGATGTCCTTCGGG + Exonic
1028850014 7:95527654-95527676 TTGCCCCCAGGCTCTCTTCCTGG - Intronic
1028983466 7:96992478-96992500 TTGCCACCGAGCTTTCCCGCGGG + Intergenic
1029507547 7:100971444-100971466 TTACCTCGAAGGTGTCCTGCAGG - Intronic
1031891140 7:127294438-127294460 TGGCCCCCCAACTGTCTTGCTGG + Intergenic
1036668892 8:10766563-10766585 AAGCCCCCAAGCTGGCCTGTTGG - Intronic
1049758315 8:144320597-144320619 TTGTCCCCGACCTGCCCTGCAGG + Intronic
1049931339 9:459815-459837 TTACCCTAAAGCTGTCATGCAGG - Intronic
1057835234 9:98439269-98439291 TTGCTGCCAGGCTGTCCTCCAGG + Intronic
1057941717 9:99290752-99290774 TTCCCCCCAAACTTTTCTGCAGG - Intergenic
1060977773 9:127775263-127775285 TTGACCTCAAGCAGTCCTCCTGG - Intronic
1061864393 9:133484987-133485009 CTGCCCCCAAGCTGGACTCCAGG - Intergenic
1185679784 X:1879177-1879199 TTTCCCCCAGACTGTCCTGGAGG - Intergenic
1192362196 X:70447033-70447055 TTGCCCCCTCTCTGTCCTGGAGG + Intronic
1193944866 X:87722860-87722882 CTGCCCCCAGGCTGTTCTGCAGG - Intergenic
1194603354 X:95950811-95950833 TTACCCCTATGCTTTCCTGCTGG + Intergenic
1196458216 X:115904553-115904575 ATGCCCCCAACATGTGCTGCAGG + Intergenic
1199499655 X:148495810-148495832 TTGTCCCCAAGCTGGTTTGCTGG - Intergenic
1200238159 X:154479070-154479092 TTCCCGCCAAGCGGCCCTGCCGG + Exonic