ID: 961018397

View in Genome Browser
Species Human (GRCh38)
Location 3:123484412-123484434
Sequence CAAATTATTAAACATGTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961018389_961018397 27 Left 961018389 3:123484362-123484384 CCTCAGCCTCCCAAAGTGCTGGG 0: 84188
1: 205795
2: 234195
3: 260821
4: 298692
Right 961018397 3:123484412-123484434 CAAATTATTAAACATGTTGCTGG No data
961018394_961018397 17 Left 961018394 3:123484372-123484394 CCAAAGTGCTGGGATTACAGGTG 0: 68945
1: 203244
2: 249087
3: 204446
4: 175427
Right 961018397 3:123484412-123484434 CAAATTATTAAACATGTTGCTGG No data
961018393_961018397 18 Left 961018393 3:123484371-123484393 CCCAAAGTGCTGGGATTACAGGT 0: 71908
1: 300079
2: 246221
3: 151210
4: 174122
Right 961018397 3:123484412-123484434 CAAATTATTAAACATGTTGCTGG No data
961018391_961018397 21 Left 961018391 3:123484368-123484390 CCTCCCAAAGTGCTGGGATTACA 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
Right 961018397 3:123484412-123484434 CAAATTATTAAACATGTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961018397 Original CRISPR CAAATTATTAAACATGTTGC TGG Intergenic
No off target data available for this crispr