ID: 961022612

View in Genome Browser
Species Human (GRCh38)
Location 3:123521654-123521676
Sequence CAGAGTCACCACAGGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 446
Summary {0: 1, 1: 0, 2: 3, 3: 42, 4: 400}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961022607_961022612 0 Left 961022607 3:123521631-123521653 CCATGTCTAGGTGTTTTCAGGAG 0: 1
1: 0
2: 0
3: 17
4: 148
Right 961022612 3:123521654-123521676 CAGAGTCACCACAGGGAGGAGGG 0: 1
1: 0
2: 3
3: 42
4: 400
961022603_961022612 13 Left 961022603 3:123521618-123521640 CCTGAGAAGCTTCCCATGTCTAG 0: 1
1: 0
2: 0
3: 5
4: 103
Right 961022612 3:123521654-123521676 CAGAGTCACCACAGGGAGGAGGG 0: 1
1: 0
2: 3
3: 42
4: 400
961022602_961022612 14 Left 961022602 3:123521617-123521639 CCCTGAGAAGCTTCCCATGTCTA 0: 1
1: 0
2: 0
3: 21
4: 136
Right 961022612 3:123521654-123521676 CAGAGTCACCACAGGGAGGAGGG 0: 1
1: 0
2: 3
3: 42
4: 400
961022606_961022612 1 Left 961022606 3:123521630-123521652 CCCATGTCTAGGTGTTTTCAGGA 0: 1
1: 0
2: 1
3: 14
4: 165
Right 961022612 3:123521654-123521676 CAGAGTCACCACAGGGAGGAGGG 0: 1
1: 0
2: 3
3: 42
4: 400

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961022612 Original CRISPR CAGAGTCACCACAGGGAGGA GGG Intronic
900099799 1:956956-956978 CAGAGTCCCCAGAGGGCTGAAGG - Exonic
900151814 1:1182215-1182237 CAAAGTCCCCACAAGGAGAACGG + Intronic
900925311 1:5702073-5702095 CAGAGTCATCACATGGAGCAAGG + Intergenic
900950433 1:5855506-5855528 CAGGGTCCCCCCAGGAAGGAAGG + Intergenic
901054256 1:6441275-6441297 CAGAGTCACCCCAAGGGGTAAGG + Intronic
901773933 1:11546143-11546165 CAGTGACAGCTCAGGGAGGAGGG - Intergenic
902359151 1:15932613-15932635 GAGAGTCCCCAAAAGGAGGATGG + Exonic
902754646 1:18541059-18541081 TAGGGCCACAACAGGGAGGATGG - Intergenic
903575553 1:24337621-24337643 CAAAGTCACTGCAGGGAGGAGGG - Exonic
903624737 1:24722339-24722361 CAAAGTCTCCACAGTGTGGAAGG - Intergenic
905623103 1:39466306-39466328 CAGAGTCACAAGTGGTAGGAGGG - Intronic
906049249 1:42857030-42857052 CAGAGTCAGCAAAGGGAGATAGG - Intergenic
906722116 1:48015831-48015853 GAGAGTCACCGGAGGGAGGCTGG - Intergenic
907750400 1:57257728-57257750 CAGAGCCCCCAGAGGGAGTATGG - Intronic
908218283 1:61977581-61977603 TAGAGTCCCCCCAGGGATGAGGG + Intronic
908809608 1:67966553-67966575 CAGTGTCCTCACAGGGTGGAAGG - Intergenic
909345760 1:74584509-74584531 CAGAAAGACCACAGGGAGCAGGG - Intronic
909975472 1:82041732-82041754 CAGACTCATGAGAGGGAGGAAGG + Intergenic
912131018 1:106600480-106600502 CAGAGTCATCACATGGCAGAAGG - Intergenic
912968686 1:114259988-114260010 CACAGTCACCACACTGAGGTGGG + Intergenic
913064753 1:115240347-115240369 CACAGTGAGCACAGAGAGGAAGG - Intergenic
913195792 1:116454959-116454981 CTCATTCAGCACAGGGAGGAAGG - Intergenic
913445667 1:118948093-118948115 CTGAGTCACCACTGGGGAGATGG - Intronic
914838979 1:151232152-151232174 CAGAGTCACCTCATGGTGGGGGG - Intronic
915444891 1:155968987-155969009 CAGAGTGAGGACAGGGAGCAAGG + Intronic
915510605 1:156384983-156385005 CAGCGTCTCCACAGGGAGAGGGG + Exonic
915827026 1:159088811-159088833 CAGAGTCCCCACAAGCAAGAAGG + Intronic
916337175 1:163686005-163686027 CAGAGTCTGCAAAGGGAGCAAGG + Intergenic
916494266 1:165330636-165330658 GGGAGTCACCACATGGAAGAAGG + Intronic
917647771 1:177046002-177046024 CAGAGTGACTACAGGTAGGATGG + Intronic
917651125 1:177078286-177078308 CAGTGACCCCACAGGGATGAAGG - Intronic
917716398 1:177742065-177742087 CAGTGTCACCACAGTGGTGATGG + Intergenic
918097296 1:181345876-181345898 GAGAGTGGCCACAGGAAGGAGGG + Intergenic
920313577 1:205062380-205062402 CACAGGAGCCACAGGGAGGAGGG - Intronic
921897940 1:220420633-220420655 CAGAATCAGTACAGGTAGGATGG + Intergenic
922978116 1:229801909-229801931 CTGAGTCTCCACATGGTGGAAGG + Intergenic
923000659 1:230004086-230004108 CAGAGACACCTAAGGGAGAATGG - Intergenic
923201551 1:231717471-231717493 CAGAGTCAGCAGAGGGAGGCGGG - Intronic
923658032 1:235935319-235935341 CATAGACACCATATGGAGGAGGG + Intergenic
924498560 1:244614040-244614062 CAGAGTCCCCACCAGGAAGATGG + Intronic
924942380 1:248821113-248821135 CAAGGTCACCACAGGAGGGAGGG + Intronic
1062820444 10:530799-530821 AAGCGGCATCACAGGGAGGAAGG + Intronic
1063384689 10:5608724-5608746 CAGAGACACTGCAAGGAGGAAGG + Intergenic
1063558422 10:7102970-7102992 CTGAGTCACCACCTGGAAGAAGG - Intergenic
1063883551 10:10554601-10554623 CAGGGTCACCACAGGGAGGCTGG - Intergenic
1064301846 10:14129942-14129964 GAGGGCCACCACAGGGAAGAGGG - Intronic
1065236413 10:23657318-23657340 CAGAGTCTCTATAGGGAAGAGGG - Intergenic
1065731869 10:28716908-28716930 CTGTGTCACCCCATGGAGGAAGG - Intergenic
1067360064 10:45571454-45571476 GAGAGTCAGCAAAGGGAGAAAGG - Intronic
1067360773 10:45575971-45575993 AAGAGTCAGCAAAGGGAGAAAGG - Intronic
1067409626 10:46053125-46053147 CAGAACCACCCCAGGGTGGAGGG + Intergenic
1067714390 10:48678085-48678107 CAGAGTCTCCACTTTGAGGAAGG - Intergenic
1069860326 10:71467146-71467168 CAGAGACCCCAGAGGGAAGAGGG + Intronic
1071153705 10:82665791-82665813 AAAAGTCACCACAGAGAGGGTGG - Intronic
1071337929 10:84616904-84616926 CAGAGCCACCACAGAGAGCTAGG + Intergenic
1071795522 10:89001095-89001117 TAGAGTCATCACAGTGAAGAGGG - Intronic
1071915887 10:90295297-90295319 AAGAGTCAGCAAAGGGAGGTAGG - Intergenic
1072238195 10:93471282-93471304 CAAACTCACCCCAGGGGGGATGG + Intronic
1072712381 10:97724414-97724436 CAGGGCCACGAGAGGGAGGAGGG - Intergenic
1073148841 10:101298172-101298194 CTGAGTCAAAACAGGGCGGAGGG - Intergenic
1073440119 10:103547567-103547589 CAGAATCCCCAGAGGAAGGAGGG + Intronic
1074438278 10:113453008-113453030 GAGAGTCAGCTGAGGGAGGAAGG - Intergenic
1076236943 10:128870947-128870969 CTGAGGGACCACTGGGAGGAAGG - Intergenic
1076688507 10:132208901-132208923 CAGAGTCCCCAAAGAGAGCAGGG + Intronic
1076726035 10:132413762-132413784 CAGAGTCCCCCCAGGGAGTTGGG - Intronic
1076803175 10:132841981-132842003 AAAAGTCAGCACAGAGAGGAAGG - Intronic
1077246650 11:1542509-1542531 CGGCGGCACCACAGGGAGGCAGG + Intergenic
1078035156 11:7796205-7796227 CAGGGTAACCACAGTGAGGTGGG + Exonic
1078920212 11:15823417-15823439 CAAAGTCAGCACCGAGAGGAGGG - Intergenic
1081445576 11:43128785-43128807 CTGTGTCATCACATGGAGGAAGG - Intergenic
1081584771 11:44376748-44376770 CAGTGTGACCACACGGGGGATGG + Intergenic
1082579082 11:54844492-54844514 CAGAGTCAGCAAAGGGAGATAGG + Intergenic
1082632611 11:55559683-55559705 AAGAGTCAGCAAAGGGAGAAAGG - Intergenic
1083018204 11:59478154-59478176 CAGGGTCACCACAGTGATGTGGG - Exonic
1083019502 11:59492376-59492398 CAGGGTCACCACAGTGATGTGGG - Intergenic
1083020719 11:59504300-59504322 CAGGGTCACCACAGTGATGTGGG - Exonic
1083023750 11:59532509-59532531 CAGGGTCACCACAGTGATGTGGG - Intergenic
1083363575 11:62128152-62128174 CAGAGCCACCATGGGGACGACGG + Exonic
1083935039 11:65865631-65865653 CAGAGTTCCCACAGGGAGGGAGG + Intronic
1084608534 11:70186466-70186488 CAGAGTCAGGACAGACAGGAGGG + Intronic
1084683567 11:70680842-70680864 GAGAGTCCCCACAAGGAGGACGG - Intronic
1087021025 11:93603471-93603493 CTTATTCACCACAGGAAGGAAGG - Intergenic
1088576730 11:111279443-111279465 CAGAGGCTCCAGAGGGAGCATGG - Intronic
1089702884 11:120255863-120255885 CAAGGTCACCAGAGGGAGGAAGG - Intronic
1090621299 11:128563301-128563323 CTGAGTCAACACTGGGTGGATGG + Intronic
1091347962 11:134867959-134867981 CAGAGCCCACACAGGGAGCATGG + Intergenic
1091676703 12:2496273-2496295 GATAGTTTCCACAGGGAGGAGGG + Intronic
1091873061 12:3911294-3911316 GGGAGTCAGCACAGGGTGGAGGG + Intergenic
1092908302 12:13122512-13122534 CTGTGTCACCACATGGTGGAAGG + Intronic
1093186629 12:16027634-16027656 TAGAGTCTCCACAGAGAGTATGG + Intronic
1095596241 12:43961798-43961820 CATACTCACCACTGGGAAGAAGG - Intronic
1100345626 12:93727287-93727309 CAGAGTGACCACAGGAAGCCAGG - Intronic
1100930748 12:99607091-99607113 CAGAGTTAGGCCAGGGAGGATGG + Intronic
1101018063 12:100522710-100522732 CAGAGACTCAAAAGGGAGGAGGG - Intronic
1102028014 12:109724441-109724463 AAGAGGCACCACTGGGAAGAAGG - Intronic
1103321302 12:120094076-120094098 CACAGGCACCACGGGGTGGAGGG + Exonic
1103458683 12:121087079-121087101 CAGAGTCACAACACTAAGGAGGG + Intergenic
1103507987 12:121454282-121454304 CAGAGCCACCCCAGGGAGGATGG + Intronic
1103733100 12:123041759-123041781 CAGAGGCCCTTCAGGGAGGAAGG + Intronic
1103776473 12:123370217-123370239 AAGAGTCAATACAGGGGGGAAGG + Intergenic
1103905909 12:124327099-124327121 CCGGGTCCCCGCAGGGAGGAAGG + Intronic
1104036038 12:125097636-125097658 CACAGTCATGACAGGAAGGAGGG - Intronic
1104057280 12:125240113-125240135 CAGAATCACCAGAAGGTGGAAGG - Intronic
1105793969 13:23832281-23832303 CAGAGTCCCCACCAGTAGGAAGG + Intronic
1106083467 13:26519734-26519756 CAGAGCAGCCACTGGGAGGAAGG - Intergenic
1106419522 13:29574073-29574095 CAGAGACACCACAGGGGGTGAGG + Intronic
1106495768 13:30272980-30273002 CAGAGTCACAGTAGGGAGGCAGG - Intronic
1106708762 13:32309618-32309640 CAGAGATAGCACAGGAAGGAGGG - Intronic
1107440478 13:40422980-40423002 CAGACTCCCCAGAGGGAGGAGGG - Intergenic
1108171369 13:47745250-47745272 GAGAGCCACCAAACGGAGGATGG + Intergenic
1109960144 13:69618859-69618881 TAGAGCCTCCATAGGGAGGATGG + Intergenic
1111485627 13:88895554-88895576 CAGAGTGAGCACTGGGAGCAGGG - Intergenic
1111679133 13:91422715-91422737 CAGAGTCCCCACCAGCAGGAAGG - Intronic
1113793114 13:113041195-113041217 CAGAGTCACCAGAGGGATGAAGG - Intronic
1115909421 14:38239173-38239195 CTGAGTCAACACATGGAAGATGG + Intergenic
1116862721 14:50007493-50007515 CATAGTTACCACTGGGAGCAGGG - Exonic
1117967811 14:61223543-61223565 CAGAATCTTCCCAGGGAGGAGGG - Intronic
1118005928 14:61564136-61564158 CAGAGTCAGCACATGCAGGAGGG - Intronic
1118038484 14:61892963-61892985 CTGAGTCACCACACTGAGGAAGG - Intergenic
1119424572 14:74527384-74527406 CAGCGTGAGCTCAGGGAGGAGGG + Intronic
1120618715 14:86736945-86736967 GAGAGTCAGCACAGGGAGATAGG - Intergenic
1121332133 14:93056251-93056273 CAGAAAGATCACAGGGAGGACGG + Intronic
1121537591 14:94701494-94701516 CAGAGTCAGTGCAGTGAGGAGGG + Intergenic
1121579333 14:95015188-95015210 CTGAGTCACCACATGGAGAGCGG - Intergenic
1122038509 14:98965290-98965312 CAGGCTCACCACAGGCAGGTGGG + Intergenic
1122278001 14:100605105-100605127 CCTGGTCTCCACAGGGAGGAGGG + Intergenic
1122319595 14:100845732-100845754 CAGAGACAACACAAGGAGGCAGG - Intergenic
1122507372 14:102240204-102240226 CAGAGTCAGCAAAGGGAGATAGG - Intronic
1122536302 14:102465966-102465988 CAGAGTCACCAAATGGGGGCTGG - Intronic
1122861979 14:104586806-104586828 AAGAGGCAGCTCAGGGAGGAGGG + Intronic
1122950631 14:105042548-105042570 CAGTGACACCACAAGGAGGCAGG + Intergenic
1122992062 14:105241126-105241148 CAGAGTCAGCCCCGGGAGGCTGG + Intronic
1124129967 15:26974571-26974593 CAGAGACAGCAGAGGGAGGGAGG + Intronic
1124413554 15:29456429-29456451 CACAGTCACCAAAGGGATGGGGG + Intronic
1124577836 15:30925461-30925483 CCCAGTCTCCTCAGGGAGGAGGG - Intronic
1124580897 15:30954029-30954051 CAGAGGCACCACTGGCAGCAGGG - Intronic
1124688384 15:31801173-31801195 CACACTCAACACAGGCAGGATGG + Intronic
1125040582 15:35181407-35181429 AATAGTGAACACAGGGAGGATGG - Intergenic
1125236843 15:37524618-37524640 CAGAGGCTCCAGAGGGAGCATGG - Intergenic
1125510606 15:40290587-40290609 CAAAGTCACCACAGACAAGATGG - Exonic
1126929839 15:53635213-53635235 CAGAGCTACACCAGGGAGGATGG - Intronic
1127119227 15:55757035-55757057 CAGAGGAAGAACAGGGAGGAAGG + Intergenic
1127329286 15:57922974-57922996 CAGGATCAGCTCAGGGAGGAGGG + Intergenic
1129171340 15:73810014-73810036 CAGACTCAGGAGAGGGAGGAAGG + Intergenic
1129332938 15:74837058-74837080 CAGAGTAACCTGAGGGAGGCTGG + Exonic
1129756910 15:78104247-78104269 CAGGGTCAGGGCAGGGAGGAGGG - Exonic
1130179432 15:81610129-81610151 CAGAGGCTTCTCAGGGAGGAAGG + Intergenic
1130342657 15:83012315-83012337 TAGAGTAACCGCAGGGAGGGTGG + Intergenic
1131249051 15:90819041-90819063 CAGGGTCACCACTGGGAAGAAGG + Intergenic
1132074171 15:98805923-98805945 CACAGACTCCACAGGGATGAGGG + Intronic
1132799087 16:1742674-1742696 CAGTAACACCACAGGGAGGCAGG + Intronic
1132846469 16:2003161-2003183 CAGTGTCACCGCCGGGAGCAGGG + Intronic
1132915478 16:2341376-2341398 AGGAGTCACCTCAGGCAGGAGGG + Intergenic
1133237816 16:4395876-4395898 CAGATTATCCAAAGGGAGGATGG + Intronic
1134008226 16:10832680-10832702 CAGAGTCTCCAGTGGGAGGGGGG + Intergenic
1134028337 16:10971876-10971898 CGGAGTCACCACAGTGGAGATGG + Intronic
1135060101 16:19264071-19264093 CTGAGTCCCCACATGGTGGAAGG - Intronic
1135201195 16:20439069-20439091 CATACTTCCCACAGGGAGGAAGG - Intronic
1135217913 16:20588795-20588817 CATACTTCCCACAGGGAGGAAGG + Intergenic
1136271912 16:29153567-29153589 CAGAGCCCCCAGAGGGAGTACGG - Intergenic
1136271923 16:29153601-29153623 CAGAGCCCCCAGAGGGAGTACGG - Intergenic
1136271934 16:29153635-29153657 CAGAGCCCCCAGAGGGAGTACGG - Intergenic
1136271944 16:29153669-29153691 CAGAGCCCCCAGAGGGAGTACGG - Intergenic
1136271977 16:29153771-29153793 CAGAGCCCCCAGAGGGAGTACGG - Intergenic
1140280775 16:73553524-73553546 CATATTCACCACAGGGACCAAGG - Intergenic
1141163913 16:81647816-81647838 CAGGGTGGCCACAGGGATGAGGG - Intronic
1141384198 16:83604187-83604209 CCAAGACACCACAGGGAGAAAGG - Intronic
1141964614 16:87433390-87433412 CAGATTCACAACAGAAAGGAGGG + Intronic
1142012759 16:87725154-87725176 CAGCGTCACCTCTGGGCGGAGGG + Intronic
1142075552 16:88115655-88115677 CAGAGCCTCCAGAGGGAGTACGG - Intronic
1142887546 17:2922192-2922214 CAGTGTCCTCACAGGGAGGAAGG + Intronic
1142913809 17:3117153-3117175 GAGAGACACCACAGAGAGGTGGG - Intergenic
1142946411 17:3433065-3433087 CAGTGACACCACAGAGAGGTGGG + Exonic
1143101408 17:4506610-4506632 TAGAGACACAGCAGGGAGGAGGG + Intronic
1144779110 17:17799057-17799079 CACAGTCACAACAGGCAGGGCGG + Intronic
1144871592 17:18375544-18375566 CTGAGTCTGAACAGGGAGGAAGG - Intergenic
1145231242 17:21174885-21174907 CAGAGCCCCCACAGGAATGAGGG - Intronic
1147155440 17:38542400-38542422 CACACTCACCACACTGAGGAAGG - Intronic
1147319915 17:39639883-39639905 CAGAAAAGCCACAGGGAGGAGGG - Intronic
1147390118 17:40103889-40103911 CAAAGCCACCAAAGGGAGGGGGG + Intergenic
1148239345 17:45989825-45989847 AAAAGTCAGCACATGGAGGAGGG - Intronic
1148547660 17:48529936-48529958 CAGAGCCAGCCCCGGGAGGAGGG - Intronic
1148576920 17:48718903-48718925 CAGAGACACCGCAGGGAGTCAGG - Intergenic
1148804424 17:50257205-50257227 CAGCTTCTCCACAGGGAGGTAGG - Intergenic
1148978559 17:51550727-51550749 CTGAATCACTAAAGGGAGGAAGG + Intergenic
1149031609 17:52089305-52089327 AAGTGTCACCACAGGGACCAAGG + Intronic
1150135268 17:62691962-62691984 CACAGTAACCAGAGGTAGGATGG + Intronic
1151146323 17:72044935-72044957 CATAGTCACCACAGTCAGGGAGG + Intergenic
1151198805 17:72452673-72452695 CTGAGCAACCACAGGGAAGAAGG + Intergenic
1152064352 17:78102258-78102280 CAGAGTCACCACGGGGAAGTGGG + Intronic
1152302965 17:79506216-79506238 CAGAGCCAGAAAAGGGAGGAGGG + Intronic
1152736520 17:82000008-82000030 CAGAGTTCCCAGAGGGAGGATGG - Intronic
1152761215 17:82107914-82107936 CAGAGTCACGGCACGGACGAGGG + Intronic
1152945692 17:83196302-83196324 CAGAGCCACCAAAGGCAGGCAGG - Intergenic
1153025550 18:669242-669264 CAGAGGCACCTGAGGGAGGCAGG + Intronic
1154332845 18:13443726-13443748 CAAAGTCACAAAAGGGAGAAGGG - Intronic
1155025198 18:21934718-21934740 CAGAGAGTCCACAGGGAGGCAGG - Intergenic
1155498631 18:26465838-26465860 CAGAGGCAGGACTGGGAGGATGG - Intronic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1158748932 18:60236173-60236195 CAGGGTAACAACAGTGAGGATGG - Intergenic
1159719733 18:71873497-71873519 CAGAGTCACAATAGGTAGAAGGG + Intergenic
1160291561 18:77599239-77599261 CATAATCAACACAGAGAGGATGG + Intergenic
1160987317 19:1845047-1845069 CTGAGACACCACAGGGAGTGCGG + Intronic
1161100981 19:2421841-2421863 CAGAGTCACCCTAGAAAGGAAGG - Exonic
1161168543 19:2801717-2801739 CAGAGTCCCCACCAGGAAGAAGG - Intronic
1161226870 19:3150889-3150911 CAGAGTCACCCCCGGGAACAGGG - Intronic
1161373756 19:3928369-3928391 CAGTGTCCCCACTGGGTGGATGG - Intergenic
1161697207 19:5776079-5776101 CAGGGCCTCCGCAGGGAGGAGGG + Intronic
1161737942 19:6002951-6002973 CAGGGACAACACAGGGAGGAGGG + Intronic
1161914880 19:7221037-7221059 CAGAGTCCTGACAGGGAGCAGGG - Intronic
1161914885 19:7221060-7221082 CAGAGTCCCCACCGGCAAGAAGG + Intronic
1162596146 19:11630703-11630725 CATAGCCACCACAGGTAGAAAGG - Intergenic
1162916011 19:13874802-13874824 CAGAGTCACCGGCAGGAGGATGG - Intronic
1162989207 19:14291521-14291543 CAAAGTCACCTCACTGAGGAGGG - Intergenic
1164520190 19:28973187-28973209 CAGTGACACCAGAGGGAGGAGGG + Intergenic
1164631734 19:29766269-29766291 GAGTGTCACTGCAGGGAGGAGGG - Intergenic
1164633263 19:29775360-29775382 CAGAGTCCCCACAGGCTGCAGGG - Intergenic
1164869486 19:31631429-31631451 CAGAGTCACAGCATGGAGCATGG - Intergenic
1165259917 19:34604314-34604336 CATAGTGACCACAGGGATGTGGG - Intronic
1166103141 19:40583211-40583233 CAGATGCATCAAAGGGAGGAAGG + Intronic
1166300391 19:41909267-41909289 CAGACTCACCTCAGGGGTGAGGG + Intronic
1166315801 19:41988751-41988773 GAGAGTCACCAGAGGCAGAAGGG - Intronic
925079932 2:1056040-1056062 CAGAGTGGACACAGGGAGAAGGG + Intronic
925385984 2:3461914-3461936 CACAGGCAGCACAGGGAGAATGG - Intronic
925590908 2:5508043-5508065 CAGACTCCGCACAGGGAGCAGGG - Intergenic
926012884 2:9422873-9422895 CAGGGTCACCAGAGTAAGGACGG + Exonic
927336763 2:21933525-21933547 CAGGGTCACCACAGGTAAGTAGG + Intergenic
927640373 2:24841876-24841898 CCCAGGCACCACAGGGAGGGAGG - Intronic
929384305 2:41385597-41385619 GAGAGTCAGCAAAGGGAGGTAGG - Intergenic
930016698 2:46975573-46975595 CAGACCCACCACAGGGAGTGGGG - Intronic
930611840 2:53553524-53553546 CAGAGGCACCACATGGAGTAGGG + Intronic
931846943 2:66213751-66213773 CTCAGTCACCACAGTGAGGTAGG - Intergenic
931926441 2:67078087-67078109 CAAAACCAACACAGGGAGGAAGG - Intergenic
931998207 2:67859099-67859121 CTGAATCACCATATGGAGGATGG + Intergenic
932326890 2:70869156-70869178 CTGAGTCATCACATGGTGGAGGG - Intergenic
933798517 2:85941276-85941298 CAGAGCCTCCAGAGGGAGCAAGG - Intergenic
934590585 2:95546660-95546682 CAGGGACAGCCCAGGGAGGACGG - Intergenic
934901368 2:98162503-98162525 CAGGGTCACCGCTGCGAGGAGGG - Intronic
936249381 2:110855875-110855897 CAAAGTTTCCACAGGGTGGAAGG + Intronic
937098005 2:119248222-119248244 CTGAGTTGCCAGAGGGAGGAAGG - Intronic
937282785 2:120731751-120731773 CTGAGTCCTCACATGGAGGAAGG - Intergenic
937341936 2:121096757-121096779 CAGAGCCAGCCCAGGAAGGAAGG + Intergenic
937987471 2:127644529-127644551 CAGAGGCACCGCAGGGGGCATGG - Intronic
938017626 2:127880610-127880632 CAGCGTCCCCACAGAGAGGGAGG - Intronic
938294813 2:130171620-130171642 CAGATTCCCCAGAGGGTGGAGGG - Intronic
938303085 2:130229768-130229790 CAGAGTCCCCAGAGGGCTGAAGG + Intergenic
938341917 2:130541475-130541497 CTGAGCCAACACAGGAAGGAGGG + Intronic
938347915 2:130579236-130579258 CTGAGCCAACACAGGAAGGAGGG - Intronic
938369841 2:130762205-130762227 CAGAGGCCCCACAGTGAGAAGGG + Exonic
938453586 2:131444458-131444480 CAGAGTCCCCAGAGGGCTGAAGG - Intergenic
938461818 2:131502224-131502246 CAGATTCCCCAGAGGGTGGAGGG + Intergenic
939008677 2:136819619-136819641 CTGAGCCACCACCTGGAGGAAGG + Intronic
939284410 2:140110511-140110533 CAGAGTTGCCACTGGCAGGAAGG + Intergenic
939460247 2:142489773-142489795 CAGAGTCAGCAAAGGGAGATGGG + Intergenic
942990942 2:182201793-182201815 CAGAGTCACCAAAAGGAGAAAGG + Intronic
943691245 2:190871751-190871773 GAGAGTCATCTCATGGAGGAAGG + Intergenic
943851099 2:192724090-192724112 CAGAGTCCCCACCAGGAAGAAGG - Intergenic
947085185 2:226443344-226443366 CAGAGTCAGCACAGACAGCAGGG - Intergenic
947638699 2:231693954-231693976 CAGAGACCCCACAGGCAGGCTGG - Intergenic
947678304 2:232005642-232005664 CAGGGTAAACAAAGGGAGGAAGG - Intronic
947742567 2:232491287-232491309 CAGAGTAACCAGAGGAAAGAGGG - Intergenic
948708296 2:239809471-239809493 CAGCGCCCACACAGGGAGGAGGG - Intergenic
948822818 2:240558432-240558454 AAGAGTCACCGCAGAGAAGAGGG + Intronic
949039826 2:241843080-241843102 GGGAGTCACCTCAGGAAGGAAGG - Intergenic
1171037353 20:21726340-21726362 CAGAGTCACCACCAGCAGGAAGG - Intergenic
1171251581 20:23653107-23653129 CATGGTCACCATAGGGAGGCAGG - Intergenic
1171408979 20:24933533-24933555 CAGAGCCCCCACTGGGAGGGAGG - Intergenic
1172768684 20:37364441-37364463 CAGGGGCCCCACAAGGAGGAGGG - Intronic
1172827046 20:37798008-37798030 CAGAGTGAACGCAGGAAGGAGGG - Intronic
1173225371 20:41159541-41159563 CAGAGTCAACACCGAAAGGAGGG - Intronic
1173262706 20:41451073-41451095 CCCAGTCCCCAGAGGGAGGAAGG - Exonic
1173495079 20:43513047-43513069 CTGAATCCCCAGAGGGAGGAGGG + Intronic
1174318061 20:49718184-49718206 CAGAGTGAGGGCAGGGAGGAAGG - Intergenic
1175121932 20:56722470-56722492 AGGAGGCACCACAGGAAGGAAGG - Intergenic
1175285635 20:57834897-57834919 CAGAGCCTCCAGAGGGAGTACGG - Intergenic
1177677653 21:24322621-24322643 GACAGTCACCACTGGGAGCATGG - Intergenic
1178565530 21:33680814-33680836 CAGAGTCAGCACAGCCAGGGTGG + Intronic
1178785464 21:35649348-35649370 CTGAGTCACCACCTGGAGGAGGG + Intronic
1179030989 21:37719183-37719205 CAGAGTCATCACAGGGAATGGGG + Intronic
1180064168 21:45404714-45404736 TAGAGTCACCGCGGGGGGGACGG - Intergenic
1180980829 22:19877262-19877284 CGGGGTCAGCACAGGGAGGGGGG + Intronic
1181513888 22:23400852-23400874 CAGGGCAACCACAGGGAGGAGGG + Intergenic
1181915158 22:26273933-26273955 CAGAGTCACCTGAGAGAGCAGGG + Intronic
1182369742 22:29802324-29802346 CAAAGTTCCCACAGGCAGGAGGG - Intronic
1182732765 22:32508384-32508406 GAGAGTCAGCAAAGGGAGTAGGG - Intergenic
1182853035 22:33492868-33492890 CTGAATCTCCACAGGGAGGGAGG + Intronic
1182955136 22:34417422-34417444 CTGAGTCCCCACATGGTGGAAGG + Intergenic
1183036291 22:35143269-35143291 CTGAGTCACCACTTGGAGGAGGG + Intergenic
1183094353 22:35543169-35543191 CACAGTAACCACAGCCAGGAAGG - Intronic
1183484662 22:38082527-38082549 CAGGGTTCCCACAGGCAGGAAGG + Intronic
1183642996 22:39103629-39103651 GTGGGACACCACAGGGAGGAAGG - Intronic
1184583121 22:45430340-45430362 CAGAGTTTTCACAGTGAGGAGGG + Intronic
1185294241 22:50045542-50045564 CAGAGACACTGCAGGGAGAAGGG - Intronic
949953604 3:9249533-9249555 CAGAGGCACCGAAGGGAGGGAGG - Intronic
952014544 3:28941168-28941190 TGGAGACACCACAGAGAGGAAGG - Intergenic
952342179 3:32455839-32455861 CAGAGTCTGCTCAGTGAGGAAGG + Intronic
953896626 3:46808219-46808241 CTGAGTACCCACAGGGAGGAGGG - Intronic
954596180 3:51826938-51826960 GAGAGTCCTCACAGGGAAGAAGG + Exonic
955369179 3:58336283-58336305 CTGAGTCACCAGAAGGATGAAGG + Intronic
956032144 3:65050107-65050129 TAGAGTCTCCAAAGGGAGCATGG - Intergenic
956392044 3:68784668-68784690 CAAAGTTTCCACAGGGTGGAAGG + Intronic
956825154 3:72991241-72991263 TGGAGTCACCACAGGCATGATGG - Intronic
957043679 3:75357358-75357380 CAGGGTCAGCCCAGCGAGGACGG + Intergenic
958177719 3:90017899-90017921 TAGAGCCTCCACAGGGAGTATGG - Intergenic
960309644 3:116105454-116105476 CAGAGTCAGCGAAGGGAGGTAGG + Intronic
961022612 3:123521654-123521676 CAGAGTCACCACAGGGAGGAGGG + Intronic
961144114 3:124579956-124579978 CATGGTCTCCAAAGGGAGGAAGG + Intronic
961209776 3:125116706-125116728 CAGAGTCCCTAAAGGGTGGAAGG + Intronic
961213530 3:125142907-125142929 CAGAGTCAGGGAAGGGAGGAGGG - Intronic
961455344 3:127021102-127021124 CAGAGTCACCACAAGGGACATGG - Intronic
961649634 3:128410926-128410948 CAGAGGCACAGAAGGGAGGAGGG + Intergenic
962970109 3:140392911-140392933 CAGAGTCCCCACCGGCAAGAAGG - Intronic
966942637 3:184756608-184756630 CAGGGGCAGCACAGGGAGAACGG - Intergenic
968348289 3:198030297-198030319 CATAATCACCACTGGGAGGATGG - Intronic
968733218 4:2281477-2281499 CTATGTCACCACATGGAGGAAGG + Intronic
968903413 4:3441357-3441379 CAGAGTCAGAACAGGCAGGTGGG + Intergenic
969057637 4:4412195-4412217 CTGGTTCCCCACAGGGAGGAGGG + Intronic
969058026 4:4414132-4414154 CAGGTTCCCCACAGGGAGGAGGG + Intronic
969293473 4:6255319-6255341 CTGAGTCACCATGTGGAGGAAGG - Intergenic
969390833 4:6890270-6890292 CAGAGTCAACACAGTGGGAATGG + Intergenic
969458674 4:7315702-7315724 GAGAGTCCTCACAGGGAGAAAGG - Intronic
969921514 4:10544803-10544825 CAGAGTCACCACCCGCAAGAAGG - Intronic
970811589 4:20100458-20100480 CAGAGTCTCCACAAGGAAGCTGG + Intergenic
971905077 4:32715945-32715967 CAAAGCCTCCACAGGGTGGAAGG + Intergenic
973076885 4:45940350-45940372 AAGAGTCTCCTCAGGAAGGAAGG + Intergenic
973547471 4:51996038-51996060 CAGAGAGGCCCCAGGGAGGAAGG - Exonic
975632782 4:76419519-76419541 CAGAGCCTCCAGAGGGAGGGAGG - Intronic
975862584 4:78693091-78693113 CACAGTCATCACAGAGAGCAGGG + Intergenic
978649386 4:110981997-110982019 TAGAGTCATCACAGTGAGGAGGG - Intergenic
982434415 4:155367269-155367291 CAGAGAAAACACAGGGAAGAAGG + Intronic
983279964 4:165667953-165667975 CAGATTCACCAGAGGGAAAAGGG + Intergenic
983493114 4:168412153-168412175 CATAGCCACCACAGCTAGGAAGG - Intronic
984928703 4:184827690-184827712 CACACACACCACAGGGAAGATGG - Intergenic
986174053 5:5336963-5336985 CATGGGCAGCACAGGGAGGAGGG + Intergenic
986737966 5:10681782-10681804 CAGAGTCCCTGCAGGAAGGATGG + Intronic
991093103 5:62711782-62711804 CAGAGTGTCCACAGGGAAGTGGG + Intergenic
991119947 5:63001073-63001095 CAGAGCCTCCAAAGGGAGCATGG - Intergenic
993926289 5:93870202-93870224 TAGTTTCACCAAAGGGAGGAGGG + Intronic
998651839 5:144129336-144129358 CACAGTCATTACATGGAGGAAGG + Intergenic
999648273 5:153740446-153740468 CATAGTCACAGCAGGGACGAAGG + Intronic
999972317 5:156877397-156877419 CAAAGTCACCACACTGAGGATGG - Intergenic
1000467789 5:161601188-161601210 AGGAGCCACCACAAGGAGGAGGG - Intronic
1001298956 5:170519722-170519744 CAAAGTCAAGAAAGGGAGGAAGG + Intronic
1002538643 5:179892117-179892139 CAGAGCCACCAAAGGGGTGAGGG - Intronic
1003329796 6:5120529-5120551 CAAAGTCTCCACAGCGTGGAAGG + Intronic
1004310836 6:14543519-14543541 CGCAGTCACCAAGGGGAGGAAGG + Intergenic
1004706133 6:18125412-18125434 CAGAGACGCCCCTGGGAGGAGGG - Intergenic
1006901755 6:37507345-37507367 CATAGTTAGCCCAGGGAGGAAGG + Intergenic
1009626669 6:66144787-66144809 CAGAGGCACCTCAAGCAGGACGG - Intergenic
1010012199 6:71061201-71061223 CAGAGGCACCAAGGGGAGCAGGG - Intergenic
1010524503 6:76884203-76884225 CAGAGTCCACATGGGGAGGATGG + Intergenic
1010813685 6:80329615-80329637 CAGCACCAGCACAGGGAGGAGGG - Intronic
1011629691 6:89311711-89311733 CAGGGCCTGCACAGGGAGGAGGG - Intronic
1011677265 6:89746995-89747017 CAGTGTCACCACAGGTAGTCTGG - Intronic
1013480585 6:110549607-110549629 CGGGGTCACCACAGGGAGCCTGG + Intergenic
1013963285 6:115927398-115927420 CAAAGCCACCACAGTGTGGAAGG + Intergenic
1014019189 6:116568039-116568061 CAGAGTCCCCACATGCAAGAAGG + Intergenic
1015190603 6:130467816-130467838 CAGAGTGAGCAGAGGGAGGGAGG - Intergenic
1017129922 6:151099410-151099432 CAGAGCCACTACAGTGAGGCTGG + Intronic
1017193515 6:151677798-151677820 CAGAGTTTGCAAAGGGAGGAGGG + Intronic
1017803865 6:157925953-157925975 CTGAGTCCCCACATGGTGGAAGG + Intronic
1018547663 6:164956024-164956046 CACAGTCACAAGAAGGAGGAAGG - Intergenic
1019328421 7:451018-451040 CAGACTCAGCAGAGGCAGGAAGG - Intergenic
1019341059 7:509160-509182 CAGCGCAACCCCAGGGAGGAAGG + Intronic
1019401877 7:859451-859473 CAGAGGCCACACAGGCAGGAGGG + Intronic
1019516322 7:1441712-1441734 CCGGGACACCACAGGGGGGACGG + Intronic
1020834197 7:13127921-13127943 AAGAGACACAACAGAGAGGAAGG - Intergenic
1020891242 7:13880440-13880462 CAGTGTCAACACAGGCAGGCAGG - Intergenic
1021839691 7:24712636-24712658 CAGAGTGACCAGCGGGTGGAGGG + Intronic
1022197742 7:28084995-28085017 TAGAGTCCCCACTTGGAGGAAGG + Intronic
1023798815 7:43815239-43815261 AAGAGTTACCACAAGGAGGGGGG + Intergenic
1024272800 7:47655295-47655317 CAGAGTCAACAGAAGGAAGACGG + Exonic
1024626873 7:51215428-51215450 CAGAAACATCACAGGGAGGTTGG + Intronic
1024673350 7:51616531-51616553 CAGAGTCCCCACTAGCAGGAAGG - Intergenic
1029483768 7:100827364-100827386 CAGAGCCACTCCAGGGAGGGGGG - Exonic
1030327885 7:108240702-108240724 GAGGGTGACTACAGGGAGGAAGG - Intronic
1031296358 7:120009512-120009534 GAGAGTCAGCACAGGGAGATAGG - Intergenic
1031824257 7:126543354-126543376 CAGAATCACTAGAGGAAGGAGGG - Intronic
1031924602 7:127627567-127627589 CAGAGTTACAGCAGGGAGGATGG - Intergenic
1032446801 7:131991186-131991208 TAGGTTCACCACAGGGAGGCAGG + Intergenic
1032465310 7:132140709-132140731 CTGAGCCACCACAGAGAGGCAGG + Exonic
1032480006 7:132238802-132238824 CAGAGTCACAAGAGGGGGGGGGG + Intronic
1034590918 7:152138214-152138236 CAGAGTCACCTCTGAGAGCACGG + Intronic
1034936910 7:155205763-155205785 CAGAGTCAGCTCACGGAAGATGG - Intergenic
1034960535 7:155361757-155361779 CAGAGACAGCCCACGGAGGAAGG + Intronic
1035038650 7:155911658-155911680 CTGGATCACCACAGGGAGGCCGG + Intergenic
1035109321 7:156467378-156467400 CAGAGTCCCCAAAGGTTGGAGGG - Intergenic
1035220778 7:157405455-157405477 CCCAGTCACCACGAGGAGGAAGG - Intronic
1035610318 8:957995-958017 CAGAGTTTCTACAGGGATGACGG - Intergenic
1035836373 8:2757605-2757627 GAGAGTCTCCAAAGAGAGGAGGG + Intergenic
1036296300 8:7540926-7540948 CAGAGAGACCACAGTGAGGGAGG - Intronic
1036326266 8:7780093-7780115 CAGAGAGACCACAGTGAGGGAGG + Intronic
1038272031 8:26082999-26083021 CAGAGACACCACAGAGAACAAGG + Intergenic
1038691864 8:29771614-29771636 CAGAGTCCCCACCAGCAGGAAGG + Intergenic
1038701846 8:29856256-29856278 CAGAGCCTCCAGAGGGAGCACGG + Intergenic
1039399959 8:37261082-37261104 CAGAGCCTCTACAGGGTGGAAGG + Intergenic
1039743842 8:40406035-40406057 CCGAGTCAACCCAGGAAGGATGG + Intergenic
1041005204 8:53491453-53491475 CAGAGCCCCCAGAGGGAGTATGG - Intergenic
1041037500 8:53809452-53809474 GAGAGTCACTAAAGGGAAGAAGG + Intronic
1041435232 8:57831870-57831892 CAGAGCCACCCCAGGGAGACTGG + Intergenic
1043270628 8:78329197-78329219 CAGAGCCTCCACAGGGTGGAAGG + Intergenic
1043891146 8:85654193-85654215 TAGAGGCACCACAGGGAGGTGGG - Intergenic
1043892222 8:85661030-85661052 TAGAGGCACCACAGGGAGGTGGG - Intergenic
1043893341 8:85716310-85716332 TAGAGGCACCACAGGGAGGTGGG + Intergenic
1043896024 8:85737759-85737781 TAGAGGCACCACAGGGAGGTGGG + Intergenic
1043896655 8:85744049-85744071 TAGAGGCACCACAGGGAGGTGGG - Intergenic
1043898978 8:85762416-85762438 TAGAGGCACCACAGGGAGGTGGG - Intergenic
1043900589 8:85774610-85774632 TAGAGGCACCACAGGGAGGTGGG - Intergenic
1043902553 8:85789885-85789907 TAGAGGCACCACAGGGAGGTGGG - Intergenic
1043904163 8:85802078-85802100 TAGAGGCACCACAGGGAGGTGGG - Intergenic
1043905775 8:85814272-85814294 TAGAGGCACCACAGGGAGGTGGG - Intergenic
1043907383 8:85826459-85826481 TAGAGGCACCACAGGGAGGTGGG - Intergenic
1045173398 8:99695745-99695767 CAGTGTCCCCACATGAAGGAAGG + Intronic
1048565920 8:135597181-135597203 CAGTGTCCCCACAGGGCAGAAGG + Intronic
1049148946 8:141022007-141022029 CAGGGTGACCACCGGCAGGACGG + Intergenic
1049319427 8:141988100-141988122 CAGGGTCACAAAAGGGAGCATGG - Intergenic
1049424774 8:142533132-142533154 GAGACTCACCCCAGAGAGGAAGG + Intronic
1050380625 9:5024475-5024497 TAGAGTCAGCACAAGCAGGAAGG - Intronic
1051077489 9:13257256-13257278 CAGAGTCCCCACATGCATGATGG - Intronic
1053103217 9:35389140-35389162 AGGAGTCACCACAGGGAGGGTGG - Intronic
1053152845 9:35753941-35753963 CAGAGAGGGCACAGGGAGGATGG - Exonic
1053320857 9:37097810-37097832 CAGAATCAGCAGAGGGTGGAGGG + Intergenic
1057308895 9:93929043-93929065 CAGAGTCAGCACGGGAAGCATGG + Intergenic
1058927767 9:109684400-109684422 CTCAGTGACCACAGGGAGAAGGG + Intronic
1059459038 9:114418146-114418168 CACAGTCCCCACCGGCAGGAAGG + Intronic
1059459340 9:114420007-114420029 CACAGTCCCCACCGGCAGGAAGG + Intronic
1060017548 9:120099645-120099667 CAGAGACACCACTGGGACCAAGG + Intergenic
1060197993 9:121635607-121635629 CAGGGCAACCACAGGAAGGAGGG + Intronic
1060331565 9:122675857-122675879 CAGAATCACCACAGTGAGATGGG - Exonic
1061196882 9:129111428-129111450 TAAAGTCACCACAGCGAAGACGG - Exonic
1061277728 9:129579069-129579091 CACAGTCTCCACAGGGAAAAGGG + Intergenic
1203377099 Un_KI270442v1:384910-384932 GAGAGTCTCCACACAGAGGAGGG - Intergenic
1185630510 X:1513396-1513418 TAGAGCCTCCACAGGGAGGATGG - Intronic
1187543625 X:20225185-20225207 CAGAGGCACCATAGGAGGGAAGG + Intronic
1188023642 X:25186037-25186059 CTGAGTCACTACTTGGAGGAGGG + Intergenic
1188870912 X:35370645-35370667 CAGTGTCCCCACAGGGATTAAGG - Intergenic
1189082366 X:37988293-37988315 TAGAGTCCCCAGAGGGAGTATGG + Intronic
1193515527 X:82457379-82457401 CAGAGAAACCAAAGTGAGGAGGG - Intergenic
1194674993 X:96783683-96783705 CAGAATCAAGACTGGGAGGAGGG - Intronic
1195975128 X:110518484-110518506 CGGTGTCACCACAGTCAGGATGG - Intergenic
1197172295 X:123447795-123447817 CTGAGTCACCAAAGGGGGCATGG - Intronic
1197286672 X:124603120-124603142 CAGAGTCTCCAGAGGGAGTGTGG + Intronic
1199864940 X:151836315-151836337 CAAAGTTACCAAAGGAAGGATGG + Intergenic
1201857318 Y:18559103-18559125 AAGAGTCACCAAAGTGAGGGTGG - Intronic
1201876003 Y:18761277-18761299 AAGAGTCACCAAAGTGAGGGTGG + Intronic
1201972848 Y:19815830-19815852 GAGAGGTACCACAGGGTGGAGGG - Intergenic