ID: 961022748

View in Genome Browser
Species Human (GRCh38)
Location 3:123522996-123523018
Sequence TCACCATGATACCACGTTCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 66}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961022745_961022748 17 Left 961022745 3:123522956-123522978 CCTCATCTGAATGATGGGGGTAA 0: 1
1: 0
2: 18
3: 159
4: 1218
Right 961022748 3:123522996-123523018 TCACCATGATACCACGTTCACGG 0: 1
1: 0
2: 1
3: 5
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961022748 Original CRISPR TCACCATGATACCACGTTCA CGG Intronic
904786538 1:32987298-32987320 TGACCAGCATACCAGGTTCAAGG + Intergenic
908372362 1:63495855-63495877 TCAGCATGAAACCAGATTCATGG + Intronic
909821822 1:80073568-80073590 TTTCCATGATACCATGGTCAAGG - Intergenic
911076144 1:93877619-93877641 GCACCATGATACCATTTTAAGGG - Exonic
912257164 1:108072051-108072073 TCACCATGTTACCACCACCATGG + Intergenic
915097562 1:153474193-153474215 TCAACATGATACCACTCTGAGGG + Intergenic
920755233 1:208723842-208723864 TCACCCTAACACCATGTTCAAGG + Intergenic
924883012 1:248183655-248183677 TCACCATAATACCAAAATCAGGG - Intergenic
1070483029 10:76903736-76903758 TCTCCATAACACCAGGTTCAAGG + Intronic
1073865561 10:107800467-107800489 CCACCATGACACCACGTTACTGG + Intergenic
1081936175 11:46905383-46905405 TCACCATGATACCCCATGAAGGG - Intronic
1086644045 11:89196875-89196897 ATACCATAATACCAGGTTCATGG - Intronic
1087568981 11:99899709-99899731 TCACCATGATACCAAAATCAGGG - Intronic
1097845987 12:64367479-64367501 TCACTATGAGACAACGTTTAAGG + Intronic
1099469665 12:83032079-83032101 TCACCATGGAACGACATTCATGG - Intronic
1108010840 13:46007402-46007424 TGACCATGATTCCACTTTCTTGG - Intronic
1108916135 13:55614338-55614360 TCACCATGACACAAAGATCATGG - Intergenic
1117012192 14:51482308-51482330 TCTCCATGACACCACGTGCGAGG - Intergenic
1127248214 15:57201872-57201894 TCACTAAGATACAAAGTTCAAGG + Intronic
1128488977 15:68126855-68126877 TCACCATTATTCCACATTGAAGG + Intronic
1129022138 15:72529931-72529953 TCTCCATAAAACAACGTTCAAGG - Intronic
1129274602 15:74436697-74436719 TCTCCATGATTCCACATTCAGGG + Intergenic
1130744973 15:86641994-86642016 TTACCATGAGAACAAGTTCAAGG - Intronic
1142994617 17:3753330-3753352 GCTCCATTTTACCACGTTCATGG - Exonic
1149568332 17:57654755-57654777 TTAGCATGGTACCAGGTTCAAGG - Intronic
1164057222 19:21631966-21631988 TCACCATGATATCCTCTTCAAGG + Intergenic
1167661398 19:50797978-50798000 ACACCCTGACACCATGTTCAAGG - Exonic
929390427 2:41462654-41462676 TCTCCATGATACACCTTTCAAGG + Intergenic
930160329 2:48148745-48148767 TCACCATGATAACACATTAAAGG + Intergenic
934611834 2:95744422-95744444 TCACCAAGATACCACATTTTGGG + Intergenic
934649147 2:96079485-96079507 TCACCAAGATACCACATTTTAGG - Intergenic
937738387 2:125319032-125319054 TCTCCATGATCCCAGGTTCTAGG - Intergenic
940471080 2:154101185-154101207 TCACCATGATGCCAAAATCAGGG - Intronic
941496308 2:166208917-166208939 TCATCAAGATACCACTTTCAAGG + Intronic
942734853 2:179097641-179097663 TCACCTTGTTGCCACTTTCAGGG + Intergenic
943726092 2:191253259-191253281 TCACCATTGTACCACGTTTTGGG + Intronic
948570048 2:238912343-238912365 TCACCAGGAAACCAGGCTCAGGG - Intergenic
951708643 3:25568378-25568400 ATACCGTGATACCATGTTCAAGG + Intronic
953354001 3:42238955-42238977 TAACCATGATAACACATTCTGGG + Intergenic
956304489 3:67809015-67809037 TCACCATTCTACCATGTACAAGG + Intergenic
957196410 3:77073847-77073869 TCTGCATAATTCCACGTTCAAGG - Intronic
961022748 3:123522996-123523018 TCACCATGATACCACGTTCACGG + Intronic
973646195 4:52953525-52953547 TCCCCTTGACACCACCTTCAGGG - Intronic
975213455 4:71727841-71727863 TCACAATGTTCCCAAGTTCAAGG + Intergenic
977050511 4:92123385-92123407 TCACCATGAAACCACTTTATGGG - Intergenic
977364472 4:96049990-96050012 ACAGCATGATATCACGTACATGG + Intergenic
977785029 4:101022837-101022859 TCACCATGACACCACGTTCTGGG + Intergenic
979896748 4:126167591-126167613 TCACCCTGATACCAAAGTCAGGG + Intergenic
980256527 4:130387041-130387063 TCACCATGTTTCCAGGTTCAGGG + Intergenic
980836648 4:138202208-138202230 TCATCATTATACCACATTAATGG + Intronic
981532543 4:145766014-145766036 TAAACATGTTACCACGTTCCAGG + Intronic
985148204 4:186917073-186917095 CCACCATGATACAAAGTTAAAGG - Intergenic
995360584 5:111292196-111292218 TCTCCATGATATCACCCTCATGG + Intronic
998063700 5:139139288-139139310 TCATCCAGATACCACGGTCAGGG + Intronic
1001614902 5:173035203-173035225 TCACCATGGTACCATCTTTAAGG - Exonic
1011027150 6:82881486-82881508 TAACCTGGATACCACCTTCAAGG + Intergenic
1024189367 7:46989955-46989977 TCAGCATAATACCACTTACATGG + Intergenic
1026158763 7:67850863-67850885 TCACCCTGCTGCCAAGTTCAGGG - Intergenic
1029887917 7:103892488-103892510 TCCCCATGACACCACAGTCATGG + Intronic
1030505489 7:110416917-110416939 TCTCCATGAAACCACGCCCATGG + Intergenic
1031836107 7:126683974-126683996 TCAACATGATCCCTCTTTCATGG - Intronic
1033411447 7:141121771-141121793 AGACAATGATACCAGGTTCATGG - Intronic
1034827484 7:154279425-154279447 TCCCCATGATACCACCACCAAGG - Intronic
1036406529 8:8460328-8460350 TCGCCATGATCCCAGGTTCCAGG + Intergenic
1036792978 8:11735507-11735529 TCACCATGATCCCATCTCCAGGG - Intronic
1037071194 8:14651485-14651507 TCACCATTATACAATGTTAAAGG + Intronic
1049097198 8:140555961-140555983 TGACCATGATTCCAAATTCACGG + Exonic
1050686088 9:8170865-8170887 TCAGCATGATACCTCCCTCAAGG + Intergenic
1051122725 9:13769338-13769360 TAACCATGCTACCAGCTTCAGGG - Intergenic
1051161707 9:14215953-14215975 TCAGCACGATACCTTGTTCATGG + Intronic
1051749475 9:20326247-20326269 TCAAAATGATACCATGTTTAAGG - Intergenic
1188988227 X:36787101-36787123 ACACCATGATACCAAGGGCATGG - Intergenic
1192896419 X:75447208-75447230 TCAACCTGATACCAGGTTGATGG - Intronic