ID: 961025259 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:123550134-123550156 |
| Sequence | TTGTTGTTGTTGTTGAAACA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 6832 | |||
| Summary | {0: 7, 1: 215, 2: 477, 3: 1242, 4: 4891} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 961025259_961025261 | 24 | Left | 961025259 | 3:123550134-123550156 | CCCTGTTTCAACAACAACAACAA | 0: 7 1: 215 2: 477 3: 1242 4: 4891 |
||
| Right | 961025261 | 3:123550181-123550203 | ACCCCATTCTCCCATGCCCCAGG | 0: 1 1: 0 2: 2 3: 42 4: 360 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 961025259 | Original CRISPR | TTGTTGTTGTTGTTGAAACA GGG (reversed) | Intronic | ||
| Too many off-targets to display for this crispr | |||||