ID: 961025259

View in Genome Browser
Species Human (GRCh38)
Location 3:123550134-123550156
Sequence TTGTTGTTGTTGTTGAAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 6832
Summary {0: 7, 1: 215, 2: 477, 3: 1242, 4: 4891}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961025259_961025261 24 Left 961025259 3:123550134-123550156 CCCTGTTTCAACAACAACAACAA 0: 7
1: 215
2: 477
3: 1242
4: 4891
Right 961025261 3:123550181-123550203 ACCCCATTCTCCCATGCCCCAGG 0: 1
1: 0
2: 2
3: 42
4: 360

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961025259 Original CRISPR TTGTTGTTGTTGTTGAAACA GGG (reversed) Intronic
Too many off-targets to display for this crispr