ID: 961025261

View in Genome Browser
Species Human (GRCh38)
Location 3:123550181-123550203
Sequence ACCCCATTCTCCCATGCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 405
Summary {0: 1, 1: 0, 2: 2, 3: 42, 4: 360}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961025259_961025261 24 Left 961025259 3:123550134-123550156 CCCTGTTTCAACAACAACAACAA 0: 7
1: 215
2: 477
3: 1242
4: 4891
Right 961025261 3:123550181-123550203 ACCCCATTCTCCCATGCCCCAGG 0: 1
1: 0
2: 2
3: 42
4: 360
961025260_961025261 23 Left 961025260 3:123550135-123550157 CCTGTTTCAACAACAACAACAAA 0: 5
1: 92
2: 408
3: 1177
4: 4704
Right 961025261 3:123550181-123550203 ACCCCATTCTCCCATGCCCCAGG 0: 1
1: 0
2: 2
3: 42
4: 360

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961025261 Original CRISPR ACCCCATTCTCCCATGCCCC AGG Intronic
900366494 1:2313946-2313968 GCCCCACTCTGCCCTGCCCCTGG + Intergenic
900980174 1:6041710-6041732 CCACCAATGTCCCATGCCCCCGG - Intronic
901307908 1:8246531-8246553 CTCCCATTCTCCCCAGCCCCTGG - Intergenic
901654514 1:10761807-10761829 ACCCCATTCTCACATCCACGAGG - Intronic
902133541 1:14284420-14284442 ACCACATTCTCTCCTGCCACAGG - Intergenic
902437549 1:16408236-16408258 ACCCCACTCCCCCATCACCCTGG - Intronic
902444973 1:16456814-16456836 ACCACATTCTCCCATGTTGCTGG + Intronic
902523696 1:17039470-17039492 ACCTCAGCCTCCCATGTCCCTGG - Intronic
902720649 1:18302038-18302060 TCCCCATCTTCCCCTGCCCCTGG + Intronic
903008230 1:20312468-20312490 GCCCCAATCTTCCATGCCACAGG + Intronic
905349102 1:37332196-37332218 ATCTCATTCTCTCATGGCCCAGG + Intergenic
906303793 1:44703357-44703379 TCCCCATTCACCCAGGCACCTGG + Intronic
906410270 1:45573373-45573395 ACCCCATTCTCCCAGTGCGCAGG + Intergenic
906658291 1:47564634-47564656 TCCTCCTTCTCCCAGGCCCCTGG + Intergenic
907598034 1:55737827-55737849 ACCAATTTCTCCCATGGCCCTGG - Intergenic
908225919 1:62055994-62056016 ACACCATTTTCTCCTGCCCCTGG - Intronic
909520541 1:76563241-76563263 ATCCCTTTCTCCCCTTCCCCGGG - Intronic
910312125 1:85835730-85835752 TCCCTATTCCCCCAAGCCCCTGG - Intronic
912214863 1:107597853-107597875 ACCCCATTATCCCATGTGCCAGG + Intronic
913172844 1:116247907-116247929 ACTCCATCCTTCCCTGCCCCTGG + Intergenic
917901056 1:179543696-179543718 ACCACATTCTGTCCTGCCCCAGG + Intronic
919744886 1:201002467-201002489 TCACCAGTCTCCCCTGCCCCAGG + Intronic
919751195 1:201039409-201039431 AGCCCAGTCTCCCAAGCCCATGG + Intergenic
919800070 1:201348527-201348549 TCCCTTTCCTCCCATGCCCCAGG - Intergenic
920670109 1:207997610-207997632 TCTCCATCCTCCCATGCCCAGGG + Intergenic
920729915 1:208473772-208473794 TCCCCACTCTTCTATGCCCCAGG - Intergenic
920929783 1:210376634-210376656 TTCCCAGTCTCCCAGGCCCCTGG + Intronic
921051535 1:211515181-211515203 ATGCCCTTCTCCCCTGCCCCGGG - Intergenic
921067104 1:211630883-211630905 TCCCCATTCCCCAATGCCTCTGG - Intergenic
921183022 1:212646194-212646216 GCCCCCTTCTCCCACTCCCCCGG + Intergenic
921419310 1:214927460-214927482 ACCCCATTCTTTCTTGCCTCAGG + Intergenic
922234672 1:223713521-223713543 ACCCCCTTATCCCGTCCCCCAGG + Intronic
923143385 1:231180580-231180602 ACCCCCTTCCTCCATGCTCCAGG - Intronic
1063433989 10:6015927-6015949 TCCCCATTCTCCCCAGCCCCGGG - Intronic
1066505820 10:36041693-36041715 ACCCCATTCTCCCAAGCCCTAGG + Intergenic
1067407709 10:46038103-46038125 ATCCCCTTCTCCCCAGCCCCTGG - Intronic
1067472079 10:46544773-46544795 ACCCCTTTTTCCCATGGCCATGG - Intergenic
1067494588 10:46750373-46750395 ACCCCATTCCCCCATGACAGGGG - Intergenic
1069779445 10:70945598-70945620 AACCTGTCCTCCCATGCCCCAGG - Intergenic
1070768935 10:79071083-79071105 GCCCTACTCTCCCATGCCCTGGG - Intronic
1070773966 10:79099309-79099331 ACCCCATGCTCCCATGAGCAGGG + Intronic
1071939476 10:90573222-90573244 ATCTCATGCTCCCATGCCCCTGG - Intergenic
1072616142 10:97049904-97049926 ACCCCATGCTGGCATGCCCACGG + Intronic
1073446294 10:103582484-103582506 ACCCCAATCAGCCAGGCCCCAGG + Intronic
1074830080 10:117241613-117241635 CCCCCATTCTCCCGTCCCCCAGG - Intronic
1075063650 10:119274233-119274255 ACCACAGTCTCCCATGTCACCGG - Intronic
1075901405 10:126045359-126045381 ACCCCCTCCCCCCATGCACCCGG + Intronic
1076191869 10:128488850-128488872 CCTCCATTCACCCATGCCCCTGG - Intergenic
1076272308 10:129164748-129164770 ACCTCATACTCTCATACCCCAGG + Intergenic
1076463670 10:130663850-130663872 ATCCCTTTTCCCCATGCCCCAGG - Intergenic
1076682644 10:132181880-132181902 ACCCGATGCTGCCATGCCCCAGG + Intronic
1076721758 10:132396267-132396289 ACCCCCTTCCCCCAGGCGCCCGG - Intergenic
1076788012 10:132760712-132760734 GCCCCTCTCTCCCATGGCCCAGG + Intronic
1077110144 11:858722-858744 ACCCCAGGCTCCCATGCACCTGG + Intronic
1078737010 11:14029648-14029670 ACCCCATTCTCCCAGTGCTCAGG + Intronic
1079103361 11:17555298-17555320 CTCCCCTTCCCCCATGCCCCTGG - Intronic
1079307022 11:19332442-19332464 AGGCCATTCACCCATCCCCCTGG + Intergenic
1081565980 11:44261589-44261611 AGCCCTCGCTCCCATGCCCCAGG + Exonic
1081710161 11:45211093-45211115 TCCCCGTTCTGCCAAGCCCCTGG - Intronic
1083692666 11:64419735-64419757 ACCCCACTCTTCCATACCCCGGG + Intergenic
1083962991 11:66024857-66024879 TCCCCATGCTGCCATGGCCCAGG + Intronic
1084085696 11:66854111-66854133 ACCCACTCCTCCCATGCCACTGG + Intronic
1085294164 11:75421269-75421291 ACCCCATCTTCCAAAGCCCCAGG - Intronic
1086921499 11:92592961-92592983 TCCCCATTCTTCCCTCCCCCAGG + Intronic
1089113560 11:116075811-116075833 ACCAAATTCTTCCACGCCCCAGG + Intergenic
1089346583 11:117795431-117795453 ACCCCAGTCTCCCTCTCCCCAGG - Intronic
1089655575 11:119944473-119944495 ACCCCATTCTCCCAACCCCCAGG - Intergenic
1090277815 11:125432017-125432039 ATCCCTTTCTCCCATGTCCATGG - Exonic
1090350675 11:126105867-126105889 TCCCCACACTCCCAGGCCCCAGG + Intergenic
1090509393 11:127358055-127358077 ACCCCCCTCTCCCCTCCCCCAGG + Intergenic
1090880897 11:130830666-130830688 ACCCCTTCCTCCCACACCCCAGG - Intergenic
1090950805 11:131471609-131471631 ACCTCAACCTCCAATGCCCCTGG - Intronic
1091695277 12:2624096-2624118 ACCCCATCCTCCAATGAGCCTGG - Intronic
1091985232 12:4905609-4905631 ACCCCATTCTTCTGTTCCCCTGG + Intergenic
1092156234 12:6283416-6283438 CCCCCATTCTCCTCTCCCCCGGG - Intergenic
1095349253 12:41189125-41189147 ACCCCAATCGACCATGCCCGCGG - Intronic
1095621850 12:44265751-44265773 TTCCCATTCTCCCCTTCCCCAGG + Intronic
1097182636 12:57179969-57179991 ACCCCATGCTCCCCGGCCCTGGG - Intronic
1097246705 12:57611246-57611268 AGCCCGTGCTCCCCTGCCCCGGG - Intronic
1098056657 12:66513828-66513850 ACCCCATTCCCTCCTGACCCTGG + Intronic
1098932099 12:76430278-76430300 ACCACATCCACCAATGCCCCAGG + Intronic
1101144332 12:101827241-101827263 ACCCCAGTCTCCCAAGCAACTGG + Intronic
1102549509 12:113681413-113681435 CCCCCATTCTTCCCCGCCCCTGG - Intergenic
1103055194 12:117814409-117814431 CCCCCATCCTCCCATGCTCCAGG - Intronic
1103576529 12:121881579-121881601 ACCCCATGCTCACCAGCCCCAGG + Intergenic
1103901856 12:124307525-124307547 GCCCCTCTCTCCCATTCCCCTGG + Intronic
1104002298 12:124867768-124867790 TCCTCATTCTCCCCAGCCCCTGG - Intronic
1104143906 12:126013921-126013943 ACCACATTCTCCCTTGCACCTGG - Intergenic
1104665048 12:130641877-130641899 ACCCCATCCTCGGATGGCCCTGG - Intronic
1106837783 13:33654458-33654480 CCCCCATTCTCCCCTTCCCCAGG - Intergenic
1107312103 13:39090258-39090280 ACTTCCTTCTCCCAGGCCCCAGG - Intergenic
1108299958 13:49063694-49063716 ACCCTATGCACCCATGCCCAGGG - Intronic
1108730037 13:53225474-53225496 ACCTCAGTCTCCCATGGACCTGG - Intergenic
1108941756 13:55964056-55964078 ACCCCACTCACCCCTGCCACTGG + Intergenic
1109268616 13:60229270-60229292 ACCGGATTCGGCCATGCCCCAGG - Intergenic
1112100504 13:96183761-96183783 TCCCCATTCTCCCTTCCCCCGGG - Intronic
1113338696 13:109401433-109401455 ACCCCATTCTCCCAGGGCGCAGG - Intergenic
1114354109 14:21888533-21888555 ACCCAAACCTGCCATGCCCCAGG + Intergenic
1115496237 14:34007425-34007447 ACCACAATCTCCCAGGCCCCTGG - Intronic
1118051542 14:62034708-62034730 AACCCATTCTCCCCCACCCCTGG - Intronic
1118137556 14:63045807-63045829 ACCCTCTTCTCCCATTCCACCGG - Intronic
1118719118 14:68581229-68581251 ACCACATTCTCCCATGATGCTGG + Intronic
1119329151 14:73781084-73781106 ACCCCATTCTCCATTTCCACTGG - Intronic
1120164937 14:81187521-81187543 TCCCCATTCTCCCTGTCCCCTGG + Intronic
1120296044 14:82642547-82642569 ACCCCATTCTCCCAGTGCGCAGG - Intergenic
1121606121 14:95241277-95241299 CCCCAAATGTCCCATGCCCCAGG - Intronic
1122923920 14:104891226-104891248 ACCCCATCCTCCCCAGCGCCTGG - Intronic
1122936215 14:104957550-104957572 CCCCCATTCTCCCTGGGCCCTGG - Intronic
1122976768 14:105174065-105174087 ACCCCACTCTGCCATGCTACGGG - Intronic
1123028588 14:105440025-105440047 ACCCCATGCTCCTCGGCCCCAGG - Intronic
1123040906 14:105489938-105489960 ACCTCCTGCTCCCATCCCCCTGG + Intronic
1126064538 15:44816056-44816078 ACCCCATACTACCATGGCCTAGG + Intergenic
1126109635 15:45167763-45167785 ACCCCTTACTCCAAGGCCCCAGG + Exonic
1127104563 15:55599163-55599185 ACCCCAGTCTCCCAAGCAGCTGG - Intergenic
1128251151 15:66165235-66165257 ACCCCAAAATCCCATGACCCTGG + Intronic
1129319407 15:74765955-74765977 TCCCCCTTCTCCCCAGCCCCAGG - Intergenic
1129737171 15:77972923-77972945 ACCCTATACTCGCATGGCCCTGG - Intergenic
1129848907 15:78780712-78780734 ACCCTATACTCGCATGGCCCCGG + Intronic
1130322265 15:82850973-82850995 ACCGCATCCACCCCTGCCCCCGG - Intronic
1130674712 15:85941518-85941540 AACCCATTCTCCCATTCCCAGGG + Intergenic
1131885070 15:96903723-96903745 ACCCCATTCTCCCAGTGCCAGGG - Intergenic
1132195251 15:99909779-99909801 TCTCCATCCTCCCAGGCCCCCGG + Intergenic
1132550047 16:550596-550618 GCCCCACTCAGCCATGCCCCTGG + Intronic
1132577360 16:670204-670226 ACCCCTGGCTCCCCTGCCCCTGG + Intronic
1132731936 16:1366983-1367005 TCCCCTTCCTCCCCTGCCCCAGG - Intronic
1133055926 16:3145447-3145469 ACACCATTAACCCCTGCCCCGGG - Intronic
1134600116 16:15527228-15527250 TCCCCATTTTCCCTTTCCCCTGG + Intronic
1135764719 16:25167559-25167581 ACCCCAGTCTCCCAAAGCCCTGG + Intronic
1136153670 16:28368175-28368197 ACCCCCATCGCCCCTGCCCCCGG + Intergenic
1136284656 16:29233799-29233821 ACCCCATTCTTCCTAGGCCCGGG - Intergenic
1136428680 16:30184994-30185016 GCCCCCTTCTCCCTGGCCCCAGG - Intronic
1136516885 16:30773811-30773833 ACCTCATCCTCCCATAACCCTGG - Intronic
1137067208 16:35859935-35859957 ACAACATTCTCACATGACCCTGG + Intergenic
1137802060 16:51270640-51270662 ACCCCATTGTCCCATCCTCCTGG + Intergenic
1137859411 16:51831172-51831194 ACCACATTTTCTCCTGCCCCAGG + Intergenic
1138451884 16:57098072-57098094 CCCCCACCCTCCCAGGCCCCAGG - Intronic
1140245744 16:73246305-73246327 GCCTCATTCTCCCAAGCTCCTGG - Intergenic
1143166303 17:4898936-4898958 ACCACTGTCTCCCATGCCGCTGG - Intronic
1144009147 17:11128751-11128773 TCCCCATTCTCCCTTCTCCCAGG - Intergenic
1144123894 17:12183118-12183140 AAGCCATTCTCCAATGCTCCAGG + Intergenic
1144228583 17:13175950-13175972 CCCCTACTCTCCCAAGCCCCTGG - Intergenic
1144446074 17:15330499-15330521 CCCCCGTTCTCTCTTGCCCCTGG + Intronic
1144478792 17:15612046-15612068 ACCCCATCAGCCCATGCCTCTGG - Intronic
1144729665 17:17519199-17519221 ACCCTATCCTGCCATGTCCCTGG - Intronic
1144919510 17:18751687-18751709 ACCCCATCAGCCCATGCCTCTGG + Intronic
1145064891 17:19755626-19755648 ACCCCCTGCTACCAGGCCCCTGG - Intergenic
1145266290 17:21381074-21381096 ACCCCTTTCTCAGCTGCCCCAGG + Intronic
1146413769 17:32612881-32612903 ACCCCAGCCTCCCATGCAGCTGG + Intronic
1147160877 17:38568890-38568912 ACCCCATCCACCTCTGCCCCGGG - Intronic
1147195304 17:38762577-38762599 ACCCCATTTTCCCAGCCCCCTGG + Intronic
1147229443 17:39006482-39006504 ATCTCCTTCTCCCATGCTCCAGG - Intergenic
1148185779 17:45642785-45642807 CTCCCATTCTCCCATTCTCCTGG + Intergenic
1148579781 17:48735500-48735522 AGCCCAGTCTCCCATGACCCTGG - Intergenic
1148734196 17:49855579-49855601 GCCCTCTTCTCCCAAGCCCCAGG - Intergenic
1149475540 17:56957895-56957917 AGCCCATTCTCTTAAGCCCCAGG - Intronic
1149494852 17:57110926-57110948 ACCGCATTCTCCCAGGGCCCTGG + Intronic
1149607495 17:57935519-57935541 ACCCCCTTCACCCCGGCCCCAGG - Intronic
1149686771 17:58540259-58540281 ACCCCTTTCTGGAATGCCCCAGG + Intronic
1150727894 17:67666408-67666430 GCCTCATTCTCCAAAGCCCCAGG - Intronic
1151686190 17:75648088-75648110 ACCCCATCCTGCCCTGCCCCTGG + Intronic
1152109555 17:78350153-78350175 GCCCCATTCTCCCAAGCCTGTGG + Intergenic
1152231752 17:79117402-79117424 ACCCCACGCTCCCATCACCCGGG + Intronic
1152327059 17:79647779-79647801 ACCCCACTCTCCAATGGCCCGGG + Intergenic
1152526472 17:80890776-80890798 ACCCCAGCCTTACATGCCCCGGG - Intronic
1156626272 18:38913428-38913450 ACTCCATTCTCAAATGCCCTTGG + Intergenic
1156972293 18:43170923-43170945 ACCCCATTCTCCCAGTGCTCAGG - Intergenic
1159226486 18:65544351-65544373 TCCCCCTTCTCCCTAGCCCCCGG + Intergenic
1159584612 18:70271825-70271847 ACTCCAGTCTCCCATTCACCTGG + Intergenic
1160394022 18:78559022-78559044 ACCCCCTCCTCCCCAGCCCCTGG + Intergenic
1160512712 18:79461404-79461426 ACCCCAGCCTCCCAAGCCCTGGG - Intronic
1160725616 19:616679-616701 ACCCCCATCGCCCCTGCCCCCGG + Exonic
1160726720 19:620813-620835 TCTCCCTTCTCCCCTGCCCCAGG - Intronic
1161750424 19:6092321-6092343 ACCCCCTGCTGCCATGGCCCGGG - Intronic
1161981128 19:7630957-7630979 ACCTCAGCCTCCCATGCCCTGGG - Intronic
1162255838 19:9488932-9488954 CCCTCATTCTCCCTTGCTCCTGG + Intronic
1163322822 19:16584558-16584580 ACCTCATTCTCCCACACCCTGGG + Intronic
1164406778 19:27955640-27955662 ACCCCATTCTCCCAGTGCACAGG - Intergenic
1165375283 19:35437480-35437502 ACCCCAGACTCCCAAGACCCAGG - Intergenic
1165456727 19:35916121-35916143 ACCTCATTCTCCCAAAGCCCTGG + Intergenic
1166040733 19:40201039-40201061 ACCCCTCTCTCCCATGTCCTTGG - Intronic
1166714444 19:44957697-44957719 CCACCCTTCTCCCATGCCCAGGG + Intronic
1166823835 19:45597430-45597452 CCCCGACTCTCCCCTGCCCCAGG + Intronic
1167972484 19:53197186-53197208 TCCCCCTTCTTCCATCCCCCGGG + Intergenic
925614177 2:5729614-5729636 TCCCCATCCTCTCATCCCCCAGG + Intergenic
927619907 2:24644027-24644049 ACATCATTATCCCATTCCCCGGG + Exonic
929466689 2:42151246-42151268 TCCCCATTCTACCCAGCCCCTGG - Intergenic
930106080 2:47640528-47640550 ACCCCATCCTCCGGCGCCCCTGG - Intergenic
930379242 2:50606435-50606457 CCCCATTTCTCCCTTGCCCCAGG - Intronic
931205415 2:60141121-60141143 ACCCCACTAGCCCATGTCCCAGG + Intergenic
931225030 2:60322097-60322119 TTCCCACTCTCCCAGGCCCCCGG - Intergenic
931709432 2:64975462-64975484 ACACCCTCCTCCCATGCCCAGGG - Intergenic
932761193 2:74440244-74440266 ACCCCTTTGTCCCATTCCCTGGG - Intronic
932769602 2:74493134-74493156 GCCCCATCCTCTCAAGCCCCAGG + Exonic
932817942 2:74876647-74876669 GCCCCATCATCCCCTGCCCCAGG + Intronic
933541415 2:83647705-83647727 ACCCCATTCTCCCAGTGCGCAGG - Intergenic
933777506 2:85779888-85779910 ACCCCATCCTCCCAGGGCCTGGG - Intronic
934665767 2:96169094-96169116 ACCCCTCTCTCCCCAGCCCCTGG - Intergenic
934733204 2:96672496-96672518 GCCCCATTCTTGCATTCCCCCGG - Intergenic
935205143 2:100890584-100890606 GCCCCATTTTCTCATGCCCCAGG + Intronic
937017188 2:118616846-118616868 ACCCCTTTCTCCCATCCACTTGG - Intergenic
938007946 2:127803831-127803853 ACCTCAGTCTCCCAAGCACCTGG - Intronic
938067494 2:128289164-128289186 ACTCTATACTCCCATGGCCCTGG + Intronic
940011749 2:149061612-149061634 CCCCCATCCTCCAAAGCCCCGGG - Intronic
940013160 2:149076090-149076112 AACCCATTCTCCCGCGCCTCTGG - Intronic
942201989 2:173580546-173580568 TCCCCATTCTCCCCTCCCCCAGG + Intergenic
943149787 2:184097707-184097729 ACCCCATTCTCCCCATGCCCAGG - Intergenic
943640352 2:190351218-190351240 TCTCCATTCCCCCATGGCCCAGG + Intronic
944381400 2:199114904-199114926 CCCCCAGTCTCCCCAGCCCCAGG - Intergenic
944940807 2:204624093-204624115 AACCCATTATCCCATTCCCCAGG - Intronic
945167568 2:206962161-206962183 ACTCCATGCTTCCATGGCCCGGG - Intronic
945275882 2:207987212-207987234 ACCACATTCTCTCATGCTCTAGG - Intronic
946156187 2:217808233-217808255 CCCCCATTCCCCCATTCCCCAGG + Intronic
947136268 2:226979485-226979507 ACCCCATCCTCCCATTGCACAGG + Intronic
947611561 2:231528042-231528064 AGCCCCTTCTCCCAGGCCCCAGG + Intronic
948886649 2:240888237-240888259 ATTCCACCCTCCCATGCCCCCGG + Intronic
1170896769 20:20422122-20422144 GCCACATTCTCCCCTGCCTCTGG - Intronic
1171100333 20:22377125-22377147 ACCACATTCACCCAGTCCCCTGG + Intergenic
1171150364 20:22822171-22822193 AAAGCTTTCTCCCATGCCCCGGG - Intergenic
1171290404 20:23979736-23979758 AACCCCTTCACCCATGACCCTGG + Intergenic
1172046961 20:32087063-32087085 AGCCCCTTCTCCCATTGCCCAGG - Intronic
1172122436 20:32606366-32606388 ACTGCATTCTCCCCTGGCCCAGG + Intronic
1173028377 20:39330970-39330992 ATTCCATTCTCCCTTGCCCAAGG + Intergenic
1174507082 20:51023638-51023660 ACCCCACTCTCCGCTGCCCCGGG + Intergenic
1175494694 20:59405412-59405434 AGCTCATTCTCCCCTGACCCCGG - Intergenic
1176108684 20:63401340-63401362 CCCCCATTCACTCATGCTCCCGG + Intergenic
1176205359 20:63885235-63885257 ATCCCCATCACCCATGCCCCAGG - Intronic
1177405515 21:20662702-20662724 ACCCCATTCTCCCAGTGCTCAGG - Intergenic
1179108096 21:38421606-38421628 ACTCAATTCTCCCTTGCTCCTGG - Intronic
1179541306 21:42084688-42084710 ATCCCATTCTCCCATTCTCCTGG - Intronic
1179956190 21:44740438-44740460 ACCCCATTCTCCCAGTGCACAGG - Intergenic
1180153143 21:45962735-45962757 ACCCCATTCTCCCAGTGCACAGG + Intergenic
1180767023 22:18351274-18351296 AACCCCTTCACCCATGACCCTGG - Intergenic
1180779290 22:18511105-18511127 AACCCCTTCACCCATGACCCTGG + Intergenic
1180812007 22:18768425-18768447 AACCCCTTCACCCATGACCCTGG + Intergenic
1180921825 22:19525120-19525142 CCCCCACTCTCCCAAGCCGCAGG + Intronic
1181103019 22:20554194-20554216 ACCCCATGCTCCAATGCCAAGGG - Intronic
1181198162 22:21202669-21202691 AACCCCTTCACCCATGACCCTGG + Intergenic
1181277950 22:21698549-21698571 AACCCAGCCTCCGATGCCCCGGG - Exonic
1181401582 22:22653135-22653157 AACCCCTTCACCCATGACCCTGG - Intergenic
1181442185 22:22942313-22942335 ACCCCAGTCTACCCGGCCCCGGG + Intergenic
1181627899 22:24133792-24133814 ACACCATTCTCCCCTGGGCCTGG + Intronic
1181647970 22:24243982-24244004 AACCCCTTCACCCATGACCCTGG + Intronic
1181703543 22:24634232-24634254 AACCCCTTCACCCATGACCCTGG - Intergenic
1182354814 22:29718044-29718066 AGCCCACTCTCCCTTGGCCCAGG + Intergenic
1182377898 22:29861461-29861483 TTCACATTCTTCCATGCCCCTGG + Intergenic
1183537757 22:38413058-38413080 ACCTCATTCTCCCCTCCCCCGGG - Intergenic
1183767000 22:39887324-39887346 ACCTCAGCCTCCCATGCACCAGG + Intronic
1184373068 22:44094984-44095006 ACCCTAATCTCCCCTGGCCCTGG - Intronic
1184692790 22:46124825-46124847 ATCCCATGCTCCCAAGGCCCTGG - Intergenic
1184704827 22:46203774-46203796 ACCCCATTCTCCCAATGCCCAGG + Intronic
1185225358 22:49648792-49648814 TCCGCATTTTCCCATGCCCCCGG + Intronic
1203228645 22_KI270731v1_random:92168-92190 AACCCCTTCACCCATGACCCTGG - Intergenic
949519430 3:4836242-4836264 ACCCCATTCCCGCCGGCCCCGGG - Intronic
950101176 3:10357903-10357925 ATCCCATCCTCCCCTGACCCCGG + Intronic
950178515 3:10894146-10894168 TACCCATTCCCCCAGGCCCCTGG + Intronic
950467402 3:13163436-13163458 ACCCCCATCTCCCATGACCATGG + Intergenic
950567672 3:13780725-13780747 ACCCCATCTCCCCATCCCCCTGG - Intergenic
952052691 3:29404649-29404671 ACCCCTTACTGCCATGCCCTAGG + Intronic
953915936 3:46921301-46921323 TCCCCACTCTCCCCAGCCCCAGG - Intergenic
954165257 3:48751919-48751941 TCCCCATTCTCCCACAGCCCTGG + Intronic
954375071 3:50189797-50189819 GCCCCATTCCTCCATACCCCAGG + Intergenic
954403127 3:50329808-50329830 AGCCAATTCTCTCAGGCCCCAGG + Exonic
955277984 3:57566158-57566180 TCCCCATTCTCCCTAGCTCCTGG + Exonic
955891228 3:63652208-63652230 ACCACATTCCCTCCTGCCCCAGG + Intergenic
956048510 3:65222256-65222278 ACCCCATTCTCCCCCTGCCCCGG + Intergenic
956833136 3:73073160-73073182 ACCCCTCTCCCCCATGCCCCAGG + Intergenic
961025261 3:123550181-123550203 ACCCCATTCTCCCATGCCCCAGG + Intronic
961336912 3:126186025-126186047 TCCCCATTCTCCCCTCCCCATGG - Intronic
965550959 3:169964649-169964671 ACCCAATTCTCACATGTTCCTGG - Intergenic
966234418 3:177685280-177685302 ACCACATTCTCCTTTTCCCCAGG - Intergenic
966506168 3:180704085-180704107 AAACCTTTGTCCCATGCCCCTGG + Intronic
966716977 3:183022367-183022389 ACAGTTTTCTCCCATGCCCCAGG + Intronic
967165369 3:186775126-186775148 TCCTCATTCTCCCCTCCCCCAGG + Intergenic
967531031 3:190549246-190549268 ACCCCATTCTCCCAGTGCGCAGG + Intronic
971572409 4:28230195-28230217 ACCTCATTCTCCCAGTGCCCAGG - Intergenic
972711537 4:41601083-41601105 ATCACATTCCCCCATGACCCTGG + Intronic
973602636 4:52557289-52557311 ACCCCATTGTGCCAGGCACCTGG + Intergenic
975344868 4:73282128-73282150 ACCACAGGCACCCATGCCCCAGG - Intergenic
975756706 4:77578512-77578534 ACCCCATTCTCCCAGTGCACAGG - Intronic
976013316 4:80518758-80518780 GCCCCATACTCCCATTCGCCAGG - Intronic
977039897 4:92002527-92002549 ACCCTATTCTCCTATTCCCCTGG - Intergenic
977823426 4:101502580-101502602 ACCCCAGTCTCCCAGGGCTCAGG - Intronic
977898418 4:102391122-102391144 CCCCCATTCCCCCAAGCCCTTGG - Intronic
980037811 4:127905225-127905247 CCGCCATGCTCCCATGTCCCAGG + Intergenic
981455463 4:144948188-144948210 ACTCCACTCTCTCCTGCCCCAGG + Intergenic
981770051 4:148298950-148298972 ACCCCATTCTCCCACTGCACAGG - Intronic
982185617 4:152795096-152795118 ACCCCTTTCTCACCTGCCCAGGG + Intronic
982268179 4:153559595-153559617 TACCCATTCTCTCATCCCCCTGG + Intronic
982526637 4:156487318-156487340 ACCCCATTCTCCCAGTGCACAGG - Intergenic
983795374 4:171855279-171855301 ACTCCCTTCCCCCAAGCCCCAGG + Intronic
984512773 4:180698977-180698999 ACCCCATTCTCCCAGTGCACAGG - Intergenic
985593172 5:775780-775802 ACCCCTTCCTTCCATGCCCTCGG + Intergenic
985782806 5:1879910-1879932 AGCCCATCCTGGCATGCCCCTGG - Intronic
985793507 5:1945574-1945596 AGCCCCTCCTCCCATGCTCCTGG - Intergenic
985914981 5:2910700-2910722 ACTCCACTCCACCATGCCCCAGG - Intergenic
987450632 5:18079486-18079508 ACCTCCCTCTCCCAAGCCCCTGG + Intergenic
990444902 5:55885540-55885562 ACCCCATTCTCCCAGTGCACAGG + Intronic
990766893 5:59194141-59194163 ACACCTTGCTCCCATACCCCAGG - Intronic
991711147 5:69409829-69409851 TCCCCATTTTCCCTTCCCCCTGG + Intronic
992426494 5:76663052-76663074 ACCCCATTCTCCCATAGCTGGGG - Intronic
992623453 5:78616065-78616087 TCCCCATCCTCCCATTCCCTTGG + Intronic
994226930 5:97263735-97263757 AAGCCATTTTCCTATGCCCCAGG + Intergenic
997435708 5:133873366-133873388 ACCCCCTGCTCCCATCTCCCGGG - Intergenic
997803075 5:136886595-136886617 AGCCCACTTTCCCATGCCCATGG - Intergenic
998776531 5:145609784-145609806 ACCCCATTCATCCCTGCCACTGG - Intronic
999439990 5:151593515-151593537 CCTCCAGTCTCCCATGCACCAGG + Intergenic
999447593 5:151652548-151652570 ACCTCAGCCTCCCATGCACCTGG + Intergenic
1000318013 5:160111517-160111539 ACCCCAGCCTCCCATGTACCTGG - Intronic
1001051692 5:168419168-168419190 AGCCCTTTCTCCCAGGCCCCAGG + Intronic
1001075815 5:168627297-168627319 TCCCCATCCCCGCATGCCCCTGG - Intergenic
1002074949 5:176702937-176702959 ACCTCTTTCTCCCAGGCCCTTGG - Intergenic
1002545260 5:179938399-179938421 TCCCCATTCTGCAATCCCCCCGG - Intronic
1003003390 6:2358416-2358438 TCCCCATTCTCCCTGCCCCCAGG + Intergenic
1004003935 6:11622052-11622074 CCTCCATTCTCCCATGGCTCAGG - Intergenic
1005018362 6:21394625-21394647 ACCCCATTCACCTTTCCCCCAGG - Intergenic
1005412047 6:25559821-25559843 ACCCTTTTGTCCCCTGCCCCTGG + Intronic
1005635234 6:27746803-27746825 TTCCCCTTCTCCCAAGCCCCTGG - Intergenic
1006192362 6:32217379-32217401 ACCCCACGCTCACCTGCCCCAGG - Intronic
1009268527 6:61588675-61588697 ACCTCAGTCTCCCAAGCCACTGG - Intergenic
1011882379 6:92045773-92045795 ACCCCATTCTCCCAGTGCACAGG - Intergenic
1012448838 6:99333811-99333833 CCCCCATCATCCCTTGCCCCTGG - Intronic
1012795199 6:103750760-103750782 ACCCCATTCTCCCAGTGCACAGG - Intergenic
1013013911 6:106144125-106144147 CCCCCACCCTCCCATCCCCCTGG + Intergenic
1013523591 6:110954729-110954751 CCACCATCCTCCCAAGCCCCTGG + Intergenic
1013611904 6:111803624-111803646 ACCCCACACCCCCATGCCCCAGG - Intronic
1014674720 6:124349327-124349349 ACCCCATTCTCCCAGTGCACAGG + Intronic
1016080573 6:139850052-139850074 CCCCCACTCCCCCATCCCCCAGG + Intergenic
1017233976 6:152100270-152100292 CCACCCTTCTCCCGTGCCCCAGG - Exonic
1019498055 7:1349693-1349715 GCCCCATTCTGCCCAGCCCCGGG + Intergenic
1020024480 7:4889167-4889189 GCCCCATTCTCTCCTGCCCCTGG + Intergenic
1020901408 7:14008253-14008275 CCCCAATTCTTCCATACCCCAGG + Intergenic
1022289567 7:28987956-28987978 GCCCCTTTCTCCCTAGCCCCAGG - Intergenic
1022322472 7:29299918-29299940 ATCCCATTTCCCCATGCCCATGG - Intronic
1023476407 7:40583770-40583792 ACTCCATCCTGCCATGCACCTGG + Intronic
1023930269 7:44701087-44701109 ACCCCATACTCCCACCCCCGCGG - Intronic
1023984900 7:45088726-45088748 ACCCCTCTCCCCCATCCCCCTGG - Intronic
1024041786 7:45561568-45561590 ACCCCAGCCTCCTGTGCCCCTGG - Intergenic
1026257319 7:68723862-68723884 ACCCCCTTCCTCCCTGCCCCAGG + Intergenic
1027954104 7:84857656-84857678 ACCCCAGTCTCCCATTCAGCTGG + Intergenic
1028149936 7:87360453-87360475 GCCTCAGTCTCCCATGCACCTGG + Intronic
1028305354 7:89256428-89256450 ACCCCAGTCTCCCATGTAGCTGG - Intronic
1029001463 7:97159428-97159450 CCCCCAATATCCCTTGCCCCAGG + Intronic
1029734732 7:102459312-102459334 ACCCCATTCTCCCAAGCTGCAGG - Intronic
1032250886 7:130256329-130256351 ACCCCATTCTCCCAGTGCACAGG - Intergenic
1034145682 7:148869458-148869480 ACCTCACTCTCCCATGCAGCTGG + Intronic
1034756012 7:153620110-153620132 ACCCCTTTGTCCTATTCCCCGGG + Intergenic
1034808899 7:154112891-154112913 TTCCCCTTCTCCCAAGCCCCTGG + Intronic
1035020611 7:155797930-155797952 ACTCCACTCTCCGAGGCCCCAGG + Intergenic
1035315709 7:157996816-157996838 AAACCATTTTCCCTTGCCCCAGG + Intronic
1036155589 8:6339203-6339225 ACCCCATTCTCCCAGTGCACAGG - Intergenic
1036989093 8:13571362-13571384 TCCCCATTCTCCTCTCCCCCTGG + Intergenic
1039003222 8:33005028-33005050 ACCCCACTCTACCTTGACCCAGG - Intergenic
1039125521 8:34197193-34197215 ACCCCATTCTCCCAGTGCCCAGG + Intergenic
1039416176 8:37395978-37396000 CCCACATTCTCCTAGGCCCCAGG - Intergenic
1039798675 8:40936159-40936181 ACCCCCTGCTCCCACTCCCCTGG - Intergenic
1042858288 8:73289084-73289106 TCCCCATCCTCCCTGGCCCCAGG + Intergenic
1043740917 8:83810564-83810586 ACCCCAGTCTCCCATACGGCTGG + Intergenic
1045298045 8:100889327-100889349 ACTCCCTTCACCCATTCCCCTGG - Intergenic
1046740751 8:117826317-117826339 ACCCCATAATCCCATTCCCATGG + Intronic
1047851582 8:128863197-128863219 ACCCCACTCTCCAATCCCCAGGG + Intergenic
1049150237 8:141030406-141030428 ACCCATTTCTTCCATGCCTCCGG - Intergenic
1049222034 8:141432721-141432743 CCCCCATTCCCCCGTCCCCCCGG - Intergenic
1049277563 8:141727501-141727523 ACCCCAGTCTCCCAGGCCGGTGG - Intergenic
1049763861 8:144343856-144343878 CCCCCATGCTCCCCTACCCCAGG + Intergenic
1051483144 9:17579813-17579835 ACCCCAGCCTTCCATTCCCCTGG - Intronic
1052059264 9:23941209-23941231 ACCCCATTCTCCCAGTGCACAGG + Intergenic
1053105338 9:35403671-35403693 ACCCCAGTCTGCCATCCCCCCGG - Intronic
1053174363 9:35911573-35911595 AACCCATTCTCCCATGGCCATGG + Intergenic
1057736336 9:97664895-97664917 ACCCCTTTCCCCCATCCCTCAGG - Intronic
1057910336 9:99015367-99015389 TGCCCCTTCGCCCATGCCCCTGG - Intronic
1058017302 9:100048851-100048873 TGCCCATTCTCCCCAGCCCCTGG - Intronic
1059119327 9:111627810-111627832 AACCCATCCTTCCTTGCCCCAGG - Intergenic
1059811085 9:117856377-117856399 ACCCCATTCTCCCAGTGCGCAGG + Intergenic
1060176401 9:121500058-121500080 ACCCCATCCTCCAACGCCCGGGG - Intergenic
1060615298 9:125007770-125007792 ACCCCAGTCTCCCAAGCAGCTGG + Intronic
1061866512 9:133494181-133494203 TCCCCGCTCTCCCATGTCCCGGG - Intergenic
1061873813 9:133534332-133534354 ACCCCATTCTCAGGAGCCCCAGG + Intronic
1062607163 9:137353489-137353511 CACCCATTCACCCATGGCCCAGG + Intronic
1062642064 9:137524068-137524090 ATCCCAACCTCCAATGCCCCTGG + Intronic
1062743064 9:138192336-138192358 ACCTCAGTCTCTCCTGCCCCTGG + Intergenic
1062743313 9:138194337-138194359 ACCTCAGTCTCTCCTGCCCCTGG + Intergenic
1062743562 9:138196338-138196360 ACCTCAGTCTCTCCTGCCCCTGG + Intergenic
1185767920 X:2741020-2741042 CCCCCATTCTCCAAGGCCCGGGG + Exonic
1186544448 X:10434307-10434329 ACCCGATTCTCCAGGGCCCCAGG + Intergenic
1187351304 X:18520243-18520265 CCCCCATTTTCCCTTGCCCCTGG + Intronic
1187521597 X:20019276-20019298 ACCCCATTCTCCCAAAGCACTGG + Intronic
1188747300 X:33862008-33862030 ACTCCATTCTCCCATTCAGCCGG - Intergenic
1189021973 X:37350035-37350057 CCCCCGCTCTCCCATCCCCCAGG - Intronic
1189291736 X:39890853-39890875 AACCCATTCTCACATGGCTCCGG + Intergenic
1189552725 X:42110399-42110421 ACTCCCATCTCCCATCCCCCTGG + Intergenic
1189905716 X:45757176-45757198 ACCCCCATCTCCCCTACCCCAGG + Intergenic
1190549472 X:51563872-51563894 ACCCCATTCTCCCAGTTCACAGG + Intergenic
1192236508 X:69299615-69299637 ATCCCCTCCTCCCATGACCCTGG + Intergenic
1192432963 X:71125125-71125147 CACCCATTTTCCCATCCCCCAGG + Exonic
1193044107 X:77033908-77033930 ACCCCACCTACCCATGCCCCTGG + Intergenic
1193120780 X:77820969-77820991 TCCCCCTTCTCCCCAGCCCCTGG + Intergenic
1193545294 X:82819362-82819384 TCCCAATTCTCCCCTGTCCCAGG + Intergenic
1194076494 X:89400537-89400559 TCCCCACACCCCCATGCCCCAGG + Intergenic
1196032732 X:111108648-111108670 ACCCCATTGCCCCATGTCCATGG + Intronic
1198667957 X:139045305-139045327 ATTCCATTCTCCCAGGCCTCTGG + Intronic
1199071348 X:143478951-143478973 TCCCCATTCTCCCCTGGCCCTGG + Intergenic
1200232874 X:154453292-154453314 TCCCCATTCCCCCACTCCCCAGG + Intergenic
1200242959 X:154507329-154507351 ACCCCTTCCTCCCATGCTGCAGG - Exonic
1200429134 Y:3056057-3056079 TCCCCACACCCCCATGCCCCAGG + Intergenic
1201282127 Y:12351358-12351380 GCCCCATTATCCCATGCCAGGGG + Intergenic