ID: 961026519

View in Genome Browser
Species Human (GRCh38)
Location 3:123563144-123563166
Sequence CAGTGGTACTGGTGGGGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 321
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 296}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961026513_961026519 24 Left 961026513 3:123563097-123563119 CCAGGATACAGAGATCAATAAGA 0: 1
1: 0
2: 3
3: 33
4: 263
Right 961026519 3:123563144-123563166 CAGTGGTACTGGTGGGGACATGG 0: 1
1: 0
2: 2
3: 22
4: 296

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961026519 Original CRISPR CAGTGGTACTGGTGGGGACA TGG Intronic
900429639 1:2595606-2595628 CAGGGGTCCGGGTGGGGGCAGGG + Intronic
900808120 1:4781224-4781246 CAGTGATTCTGGTTGGGACTGGG - Intronic
901678436 1:10900036-10900058 CAGTGCTACTGGATGGGAAAGGG + Intergenic
902792974 1:18781622-18781644 CAGTGGTGGGGGTGGTGACAAGG + Intergenic
903547931 1:24138475-24138497 CACCAGTCCTGGTGGGGACATGG + Intronic
903814872 1:26057572-26057594 CAGAGGTCCTGGTGGGAACTAGG + Intronic
904265344 1:29315522-29315544 AAGTAATAATGGTGGGGACAGGG - Intronic
905244331 1:36602315-36602337 CTGTGGTGGGGGTGGGGACAGGG - Intergenic
907390148 1:54152866-54152888 CAGTGGCACTGCTGGGCCCAGGG - Exonic
907530890 1:55095611-55095633 AAGTGATATAGGTGGGGACAAGG + Intronic
909041673 1:70660707-70660729 CAGTGGTATTGATGATGACATGG - Intergenic
909384014 1:75035362-75035384 CAGGGGTAGTGGTGGCCACAGGG + Intergenic
910716345 1:90235727-90235749 CAGTGGTGGTGGTGGCCACAGGG - Intergenic
911669691 1:100593697-100593719 CAGTGGTGATGGTGGCCACAGGG - Intergenic
913474307 1:119222320-119222342 AAGAGGTATTGGTGAGGACATGG - Intergenic
914444165 1:147735671-147735693 CAGCTGTACTTGTGGTGACAGGG + Intergenic
914446990 1:147758652-147758674 CAGTTGACCGGGTGGGGACAGGG + Exonic
915084017 1:153372243-153372265 TGGTGGTAATGGTGGTGACAAGG - Intergenic
916530678 1:165653527-165653549 CAGTGCTACTGTTAGGGATAAGG - Intronic
918634928 1:186764305-186764327 CTGTGCTAATGCTGGGGACACGG - Intergenic
919568456 1:199218455-199218477 GCAGGGTACTGGTGGGGACAGGG + Intergenic
919576078 1:199311324-199311346 CAGTGGTGGTGGTGGGGGCGGGG - Intergenic
920226947 1:204446137-204446159 CAGTGAGCCTGGTGGGCACACGG + Exonic
920381130 1:205535095-205535117 CAGTGATAGAGGTGGGGAGATGG - Intergenic
922122044 1:222681171-222681193 CAGAGGTACACGTGAGGACAGGG - Intronic
922606859 1:226894924-226894946 CAGTGGTCCAGGTGAGCACAGGG - Intronic
923183258 1:231543955-231543977 CAGAAGTACTGGTGGGAAGAAGG + Intronic
923219868 1:231883374-231883396 AAGTGGTAGTGGTGTGGAGAGGG + Intronic
1063121216 10:3106673-3106695 CAGGGGTAGGGGTGAGGACAGGG - Intronic
1063247582 10:4238301-4238323 CAGTGCTGCTGCTAGGGACAAGG - Intergenic
1063701760 10:8391564-8391586 AAGAAGTACTGGTGAGGACATGG - Intergenic
1064236509 10:13580963-13580985 CAGTGGTATTTTTTGGGACAGGG + Intergenic
1066203690 10:33166092-33166114 CAGTGGTAATGAGTGGGACAAGG + Intergenic
1067776469 10:49168051-49168073 CTGTGCTCCTGGTGGGTACATGG - Intronic
1068314212 10:55320365-55320387 CAGTGGTGGTGGTGGGGGCATGG - Intronic
1068925091 10:62527592-62527614 CAGTGCTGTTGGTGGGGGCATGG - Intronic
1072816615 10:98515906-98515928 CAGTGGAGCTGGTGGGGAGAGGG - Intronic
1074151037 10:110759994-110760016 CAGTGGTGGTGGGGGGCACAGGG + Intronic
1075698975 10:124456221-124456243 CCAAGGTACTGGTGGGCACAGGG - Intergenic
1075713308 10:124542205-124542227 CAGTGGCTCTGGTGGGCACGGGG + Intronic
1076335859 10:129706083-129706105 CAGTGTGACTGGTGGGGGCTGGG - Intronic
1076435110 10:130435224-130435246 CAGAGCTTCTGGTGGGAACATGG + Intergenic
1077108770 11:853086-853108 AAGTGGTACAGGTGCGGCCAGGG + Intronic
1077182148 11:1221561-1221583 CAGTGATGCTGCTGTGGACATGG + Intergenic
1078807608 11:14721768-14721790 CTGTGGTGCGGGTGGGGGCAGGG + Intronic
1080402342 11:31947643-31947665 TAGAGGTGGTGGTGGGGACAGGG - Intronic
1080805673 11:35651063-35651085 CAGAGGCACTGCTGGGCACAGGG + Intergenic
1081439356 11:43063361-43063383 CAGTGGGACAGGTGGGGTCCAGG - Intergenic
1083214286 11:61208750-61208772 AAGTGGTACTGAGGGGGAAATGG - Intronic
1083217170 11:61227579-61227601 AAGTGGTACTGAGGGGGAAATGG - Intronic
1083899816 11:65638178-65638200 CAGAGGTACTGGCGGGAGCAGGG + Intronic
1083958693 11:66002087-66002109 CAGTTGGACTGGTGGGAACTGGG - Exonic
1084161958 11:67354972-67354994 CACTGGTACACGTGGGCACAAGG + Intronic
1084223170 11:67697305-67697327 CAGAGGTAATGATGGGGAAAGGG + Intergenic
1084456769 11:69272393-69272415 CAGTGGGACAGGTGGGCAGATGG - Intergenic
1084666009 11:70576729-70576751 CAGTCTTACTGATGGGGAAACGG - Intronic
1085317591 11:75554865-75554887 CAGAGCCACTGGTGGGGGCAGGG - Intergenic
1085506680 11:77064855-77064877 CAGAGTTGCTGGTGGGGCCAAGG - Intergenic
1086453535 11:86940147-86940169 CACTGTTAGTGGAGGGGACAGGG - Intronic
1087509300 11:99069842-99069864 CAGTAGCACTGGTGTGAACAGGG - Intronic
1088009865 11:104986697-104986719 CTGTGGTGCTGGTGGCCACAGGG + Intergenic
1088087430 11:105997785-105997807 GATTGGGACTGGTGGGGAGAGGG + Intronic
1088335280 11:108696799-108696821 CAGTGGTATTGATGGGGACAGGG + Intronic
1089278417 11:117355501-117355523 CACTGGCCCTGGAGGGGACAAGG + Intronic
1089389082 11:118087775-118087797 CAGTGGTAGGGGTGGGGAATAGG + Intronic
1090611201 11:128472600-128472622 GAGGGGTGCTGGTGTGGACATGG - Intronic
1091764097 12:3107086-3107108 CAGTGGTGGTGGTGGCGGCAAGG - Intronic
1092111522 12:5968083-5968105 CAGAGCAAGTGGTGGGGACAGGG - Intronic
1096343899 12:50828530-50828552 CAGTGGTGGTGGTGGCCACAGGG - Intergenic
1097970356 12:65626804-65626826 CAGTGGTACTGGAGTGGCCATGG - Intergenic
1098333929 12:69382463-69382485 CTGTGGTAGTGGTGGACACAGGG - Intronic
1098777657 12:74641733-74641755 CAGTGGTGTTGGTGTGGGCATGG - Intergenic
1099392473 12:82098025-82098047 CAGTGCTGGTGGTGGGGGCATGG - Intergenic
1101197070 12:102394658-102394680 CAGTGGTGGGGGTGGGGGCAGGG - Intergenic
1104575713 12:129964185-129964207 CAGTGGAAAAGGTGGGGAGAAGG + Intergenic
1105621421 13:22071035-22071057 TAGTGGTGGTGGTGGGGGCAGGG + Intergenic
1106346659 13:28886099-28886121 CAGAGTTGCTGGTGGGGAGAGGG + Intronic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1112562558 13:100527022-100527044 CAGTGGTCCTCGTGGCGCCAGGG + Intronic
1113179192 13:107606162-107606184 CAATGGTACTAGTGAGCACATGG + Intronic
1113682649 13:112255095-112255117 CTGTGGGACTGGTGGGGAGATGG + Intergenic
1113704962 13:112424197-112424219 CAGAGATGCTGGTGGAGACAGGG - Intronic
1116351627 14:43871080-43871102 TATTGGTAGTGGTGGTGACAGGG - Intergenic
1117796443 14:59399014-59399036 GAGGGGAAGTGGTGGGGACAAGG - Intergenic
1117911189 14:60639850-60639872 GACTGGTAGTGGTGGGGACTTGG - Intergenic
1118002524 14:61536834-61536856 CAGTGGTAAAGGTGATGACAGGG - Intronic
1118230229 14:63940762-63940784 AAATGGTACTGGTGATGACAGGG + Intronic
1119532901 14:75375584-75375606 CAGTGGTGGTGGTGGTGGCATGG - Intergenic
1122138305 14:99647099-99647121 CGGTGGTTGAGGTGGGGACATGG + Intronic
1123932992 15:25180835-25180857 GAGTGGTCCTGCTGGGGTCATGG + Intergenic
1126015730 15:44348439-44348461 CTGTGGTAGTGGTGGACACAGGG + Intronic
1130390319 15:83448557-83448579 CAGCGGTGCTGGTGGGGAACAGG - Intronic
1131093717 15:89642519-89642541 CTGTGGTACTGGTGGTGCAAAGG - Intronic
1132771214 16:1564558-1564580 CACAGGGACCGGTGGGGACAAGG - Intronic
1134006919 16:10824181-10824203 CAGGGCTAGTGGTGGGGAAATGG + Intergenic
1134297952 16:12963232-12963254 GAGTGGGAATGGTGAGGACATGG + Intronic
1134821654 16:17251915-17251937 GAGTGGGAGTTGTGGGGACAGGG + Intronic
1135648666 16:24186518-24186540 CAGTGGTACAGGTTAGAACATGG + Intronic
1136080920 16:27852221-27852243 CAGAGGGGCTGGTGGGGACCTGG + Intronic
1137449788 16:48560942-48560964 CAGTGGCATTGGTGGAGAAAGGG + Exonic
1137677445 16:50310822-50310844 CAGTGGGACTGCTGCGGCCAAGG + Exonic
1140169814 16:72592867-72592889 CAGGGGTGATGGTGAGGACAGGG + Intergenic
1141494137 16:84395274-84395296 CAGTGACACTGGAGGGGAGAGGG - Intronic
1142422713 16:89982339-89982361 CAGGGGTGCAGGAGGGGACACGG - Intergenic
1142502335 17:340060-340082 CAGTGGGTCTGGTGGGGAGCAGG - Intronic
1143084537 17:4405918-4405940 CAGTGGTTCAGGAAGGGACACGG - Intergenic
1143156138 17:4837635-4837657 CAGTGGAAGTGGATGGGACAAGG + Intronic
1143563425 17:7708246-7708268 CATTGGTACTGCTGGGCAGAGGG + Exonic
1144130227 17:12239541-12239563 CAGAGGTGCCGGTGGGGTCAGGG + Intergenic
1146370242 17:32261632-32261654 TAGAGCTACAGGTGGGGACAGGG + Intergenic
1146453846 17:32994708-32994730 CAGAGGAACTGGAGGGGACTAGG + Intronic
1147881392 17:43656387-43656409 CAGGGGTAGTGGAGGGGACCTGG + Intronic
1148997381 17:51722981-51723003 CAGTGGTATTGGCAGGGACGGGG - Intronic
1149189206 17:54038447-54038469 CAGTGTTTCTCATGGGGACAGGG - Intergenic
1149459814 17:56819357-56819379 GAGTGGTGGTGGTGGGGGCAGGG - Intronic
1150074219 17:62179031-62179053 CTGTGGTATTGGCGGGGGCAAGG - Intergenic
1151443133 17:74146558-74146580 CAGGGGAAATGGTGGGGGCAGGG - Intergenic
1152016728 17:77755900-77755922 CTGTGGCTCTGGTGGGGACAGGG - Intergenic
1152187403 17:78866515-78866537 CAGTGGAATTGGTGGGGTCGGGG - Intronic
1152681706 17:81671855-81671877 CAGTGGTCCGGGTGGGGCCTGGG + Intronic
1152753906 17:82079020-82079042 CAGTGGCACTGGGCCGGACAGGG + Exonic
1152778760 17:82217310-82217332 CAGGGATCCTGGTGTGGACACGG + Intergenic
1154120962 18:11652179-11652201 CTGTGGTGCTGGTGGGGTCCTGG + Intergenic
1155259241 18:24025425-24025447 CAGTGTTGCTGTTGGTGACATGG + Intronic
1155282186 18:24250986-24251008 CAGTGGTAGTGGTGCTCACAGGG + Intronic
1160534877 18:79586449-79586471 CCGTGGCACTGGGGGGGAAAAGG + Intergenic
1162186104 19:8906302-8906324 CACTGCTGCTGGTGGGCACAGGG + Exonic
1162490439 19:10988022-10988044 AAGTGGCAGTGGTGGGCACAGGG - Intronic
1162967810 19:14164272-14164294 CAGGGGTGGGGGTGGGGACATGG + Intronic
1163437547 19:17304232-17304254 CTGTGGTACCGGCGGGGCCATGG + Intronic
1164923389 19:32106809-32106831 CAGAGCTACAGTTGGGGACATGG + Intergenic
1165362789 19:35346985-35347007 CAGTGGCCGTGGTGGGGGCAGGG - Exonic
1165398129 19:35578655-35578677 CAGGGGTCCTGGTGGGGCCCAGG - Intergenic
1165463461 19:35958382-35958404 CAGTGGAACTTCTTGGGACAGGG + Intergenic
1165748981 19:38248539-38248561 TAATGGCACAGGTGGGGACAGGG + Intronic
1165963331 19:39553425-39553447 CCGAGGGACTGGTGGGGCCAGGG - Intergenic
1166264189 19:41667311-41667333 CAGTGGTAGTGGTCATGACATGG + Intronic
1166274849 19:41746012-41746034 CGGTGGTAGTGGTGGTGGCATGG - Intronic
1166279886 19:41784919-41784941 CGGTGGTAGTGGTGGTGGCATGG - Intergenic
1166333468 19:42091677-42091699 CAGTGGGACCGATGGGGAGATGG - Intronic
1166397447 19:42452151-42452173 CAGTGGTAGTGGTGGTGGTATGG + Intergenic
1166412865 19:42568285-42568307 CAATGGTAGTGGTGGTTACATGG + Intergenic
1167399485 19:49255468-49255490 CAGTGTCACTGGTGAGGAGAGGG - Intergenic
1167701864 19:51053310-51053332 CTGGGTTACTGGTGGAGACAAGG - Intergenic
1168181771 19:54666603-54666625 CAGTGGCACTAATGGGAACAGGG + Intronic
925269487 2:2592098-2592120 AAGTGGTAGTGGTGGCCACAAGG + Intergenic
926218082 2:10917573-10917595 CTGTTGTACAGATGGGGACATGG + Intergenic
926581042 2:14633166-14633188 CATTGGCCCTGATGGGGACAAGG + Intronic
927570216 2:24152958-24152980 CAGTGGTGGTGGTGGCCACAGGG - Intronic
928490525 2:31778386-31778408 CGGGGGTGCTGGTGGGGACTGGG - Intergenic
929538432 2:42800293-42800315 CAGTAGTAGTGGTAGGGACGGGG + Intergenic
929937270 2:46302545-46302567 GCATGGTACTGGTGGGGAGAGGG - Intronic
930774540 2:55159273-55159295 CAGTGGAAGTGGAGGGGGCAAGG - Intergenic
932073792 2:68644805-68644827 CAGCTGCCCTGGTGGGGACAGGG - Intronic
932239514 2:70145833-70145855 CAGTAGTACTGGTAGAGGCAGGG + Intergenic
933384891 2:81597516-81597538 CAGAGGTACTAGTGGAGGCAGGG - Intergenic
934074700 2:88418074-88418096 CTGTGGTACTTGTGGGGCAAGGG - Intergenic
935751001 2:106233572-106233594 CAGTGGTGGTGGTGGCTACAGGG + Intergenic
937205711 2:120235930-120235952 CAGTCTTGCAGGTGGGGACATGG - Intergenic
937457586 2:122055786-122055808 CAGTGGGGCTGGTGGGGGAAAGG - Intergenic
937872231 2:126794060-126794082 CAGTGGTAGCTGTGGTGACAGGG + Intergenic
938246090 2:129779113-129779135 CAGGGGTGCTGCTGGGCACAGGG + Intergenic
938786791 2:134637183-134637205 CAGTGGCCCTGGTGGGGAATTGG - Intronic
939026394 2:137019105-137019127 CAGTGGAAGGGGTGAGGACATGG - Intronic
939706428 2:145458920-145458942 CAGTGGAGCTGGTGAGAACAAGG + Intergenic
942305041 2:174599196-174599218 GAGTGGGAATGGTGGGGGCAGGG + Intronic
943739610 2:191396922-191396944 CAGGTCTAGTGGTGGGGACATGG + Intronic
944751946 2:202718049-202718071 CTGTGGTAGTGGTGGCTACAAGG - Intronic
946026187 2:216673255-216673277 CAGAGGTGGTGGTGGGGAGATGG + Exonic
946606786 2:221413832-221413854 CTGTAGTACTGGCGGGGATAGGG - Intergenic
948261117 2:236605173-236605195 CAGCAGTGCTGGTGGGGTCAAGG - Intergenic
948792161 2:240384702-240384724 CTGGGGTACTGGTTGGCACAGGG - Intergenic
948910431 2:240999675-240999697 CAGTGGGACTCCTGGGGCCAGGG + Intronic
1170827862 20:19811521-19811543 CAGTGGGTGTGGAGGGGACAAGG + Intergenic
1172625817 20:36346162-36346184 CAGTGGTCTTGGTGAGGCCAGGG - Intronic
1174335730 20:49859067-49859089 CAGTGCTACTGCTGAGGCCACGG + Intronic
1174651319 20:52128292-52128314 CAGTGGACCTGATGGGAACAGGG - Intronic
1175048343 20:56128325-56128347 GAGTGGGACAGGTGGGGACTAGG + Intergenic
1176037213 20:63045403-63045425 CAGTGGCCCTGGTGGGGATTCGG + Intergenic
1180050145 21:45327355-45327377 CAGTGCTTATGGTGGGGACCTGG + Intergenic
1181109012 22:20590614-20590636 CAGTGGTGATGGTGGGCACAGGG - Intergenic
1181781193 22:25194748-25194770 CTGTGGTGCTGGAGGAGACAAGG - Exonic
1182074843 22:27488452-27488474 CATTGGTGCTGGTGGGGGCCAGG + Intergenic
1184749139 22:46474225-46474247 CAGTGGCACAGATGGGGACAAGG - Intronic
950262345 3:11552417-11552439 CAGTGCAACTGGTGTGGAGAAGG - Intronic
951822499 3:26827837-26827859 CAATGCTGCTGGTGGGGACAGGG - Intergenic
953135416 3:40177481-40177503 CAGTGGTGCTGATGGGGATTGGG - Intronic
953362355 3:42309262-42309284 CAGTGGTGGTGGTGGCCACAGGG - Intergenic
954215945 3:49124549-49124571 CAGTGGCACTGGTCAGGAGATGG + Exonic
954372321 3:50175305-50175327 CAGGGGAAGGGGTGGGGACAGGG - Intronic
954427163 3:50449502-50449524 CAGGGGTAGTGGTTGGGACTAGG + Intronic
954636638 3:52074439-52074461 CAGTGGGACTGGTGGGGATGGGG + Intergenic
955041981 3:55326652-55326674 CAGTGGTAGTGGTTGGGATTAGG - Intergenic
957322925 3:78655378-78655400 CAGTGGTACAGGTCTAGACATGG - Intronic
958505659 3:94973895-94973917 AAGTGGAAGTGGTGGGGAGAGGG - Intergenic
959384139 3:105680658-105680680 CAGTGGTACTTGTGAGAAAATGG + Intronic
961026519 3:123563144-123563166 CAGTGGTACTGGTGGGGACATGG + Intronic
961100596 3:124195393-124195415 CTTTGTTACTGGTGGGGAAAGGG + Intronic
961933046 3:130554313-130554335 CAGTGGCAATGGTGTTGACATGG + Intergenic
964179457 3:153865702-153865724 CAGTGGTGGTGGTGGACACAGGG + Intergenic
967424986 3:189316658-189316680 CAGTGTGCGTGGTGGGGACAGGG - Intronic
967804587 3:193704255-193704277 CAGTGGTGGTGGTGAGGATATGG - Intergenic
968331988 3:197878605-197878627 CAGTGGTTGTGGTGGGGACGTGG - Intronic
969291600 4:6243640-6243662 CAGGGGTACTGGTGTGGTCAAGG + Intergenic
969291613 4:6243691-6243713 CAGGGGTACTGGGGGTGCCAAGG + Intergenic
969604623 4:8196362-8196384 AGGTGGCACTGGTGGGGACGTGG + Intronic
969621219 4:8279893-8279915 CAGTGGTTCAGCTGGGGGCAAGG - Intronic
970442494 4:16093714-16093736 CAGTGGTGGTGGTGGCCACAAGG + Intergenic
977423226 4:96830373-96830395 CAGTGGTACTCTTGGTGAAACGG - Intergenic
978112463 4:104978935-104978957 CTGTGGTAGTGGTGGCCACAGGG + Intergenic
979777491 4:124609251-124609273 CTTTGTTACTGGTGGAGACAGGG - Intergenic
980442557 4:132867615-132867637 CAGTGGTGGTAGTGGGCACAGGG + Intergenic
980456126 4:133046133-133046155 CAGTGGTGGCTGTGGGGACAGGG - Intergenic
981341445 4:143626393-143626415 CAGGGGTGCTGGTTTGGACAGGG + Intronic
983629763 4:169838011-169838033 TCATGGTACTGGTGAGGACACGG + Intergenic
985189345 4:187354927-187354949 CAGTGCTGCTGGCAGGGACAGGG + Intergenic
985758896 5:1734660-1734682 CTGTGGTTCTGGTGGGGGCGGGG + Intergenic
985788182 5:1910869-1910891 CAGAGGGAAGGGTGGGGACATGG + Intergenic
986420555 5:7576770-7576792 CAGTGGTGTTGGTGGGGAAGGGG - Intronic
986619082 5:9651895-9651917 CACTGGTACAGATGGGGAGATGG - Intronic
987072412 5:14350859-14350881 CAGCGGTGTTGGTGGGGGCAGGG + Intronic
987953084 5:24701753-24701775 CAGTGGTAGTAGTGGCCACATGG - Intergenic
988854927 5:35219126-35219148 GAGTTGGACTGGTGGGGAGATGG - Intronic
990332441 5:54740958-54740980 CAGGGATACTGGTGAGAACAAGG + Intergenic
991663681 5:68974811-68974833 CAGGGGTAGTGGTGGCTACAGGG + Intergenic
992005379 5:72472454-72472476 CTGTGGCACTGGTTGGGAAAGGG - Intronic
994274660 5:97821811-97821833 CAGTGGTGGTGGTGGCCACAGGG - Intergenic
994660055 5:102642234-102642256 CAGTGGTGGTGGTGGCCACAGGG + Intergenic
995290217 5:110443349-110443371 CAGTGGTATTAGTGGCCACAAGG - Intronic
995829207 5:116334807-116334829 CAGCTGTACGGCTGGGGACAGGG - Intronic
997032139 5:130142802-130142824 CAGTGGGACTGGAAGGGCCAAGG + Intronic
1000181439 5:158815632-158815654 CAGTGCTATTGGTGGTGCCATGG + Intronic
1000790907 5:165605987-165606009 CAGTGGTAATGGTGAGCAGAAGG - Intergenic
1001575261 5:172759132-172759154 CAATTCTACTGGTGAGGACAAGG + Intergenic
1002027602 5:176406089-176406111 CAAGGGTAGGGGTGGGGACAGGG - Intronic
1004696640 6:18040260-18040282 CAGTGGTGGTGATGGAGACAAGG + Intergenic
1004790085 6:19015953-19015975 CAGTGGTGCTGCTGGGGATATGG + Intergenic
1005089660 6:22043311-22043333 CAGTGGCCAGGGTGGGGACAAGG - Intergenic
1006582933 6:35087083-35087105 CAGTGAGACTAGTGGAGACAGGG - Intronic
1006634169 6:35450411-35450433 CAGTGACACAGCTGGGGACATGG + Intergenic
1006926753 6:37660094-37660116 CAGTGGTACTCTTGGGCTCAAGG + Intronic
1006938891 6:37738257-37738279 CCATGGTTTTGGTGGGGACAGGG + Intergenic
1007741252 6:44010897-44010919 CAGTGGGGCTGCTGGAGACAGGG - Intergenic
1007783324 6:44266304-44266326 CAGGGGTACGGGTAGGGAAAGGG + Intergenic
1012555495 6:100506235-100506257 TAGTGGTAATGGTGGGGATGAGG + Intergenic
1012727043 6:102826582-102826604 TATTGGTACAGGTAGGGACAGGG + Intergenic
1014841854 6:126228687-126228709 CAGTGGTACTGCTGGCCCCAAGG + Intergenic
1014957382 6:127637655-127637677 GTGTGGGAATGGTGGGGACAGGG + Intergenic
1016292401 6:142539434-142539456 TAGAAGTACTGGAGGGGACAGGG - Intergenic
1016829354 6:148418054-148418076 CAGTGGTCCTAGTGGGCACTTGG + Intronic
1017881450 6:158565358-158565380 CAGTGCATCTAGTGGGGACATGG + Intronic
1017924764 6:158901391-158901413 CAGTGGTGGTGGTGGCCACATGG - Intronic
1018154607 6:160974172-160974194 CAGGGGAGCAGGTGGGGACAGGG - Intergenic
1019640817 7:2102720-2102742 CAGTGGTGATGGTGGGGACGTGG - Intronic
1022341831 7:29475892-29475914 CAGTGGTACTGATGGGTACAGGG + Intronic
1022970697 7:35514212-35514234 CAGTGGAAGGGGTGGGGAGAGGG - Intergenic
1023205505 7:37745344-37745366 TATTGGTACTGGTAGGAACAAGG + Intronic
1023241424 7:38151596-38151618 GAGGGGTGCTGGTGGGGACAGGG - Intergenic
1023515388 7:40996560-40996582 CAGGGGAATTGGTGGGGACCAGG + Intergenic
1023968274 7:44974793-44974815 AAGTGGTGCTCCTGGGGACACGG - Intronic
1024156534 7:46631242-46631264 CAGTGGGATTGTTTGGGACATGG + Intergenic
1029142777 7:98423590-98423612 CAATGGTATTGCTGGGGACTAGG + Intergenic
1029905864 7:104093021-104093043 CAGTGGGGCTGGAGGAGACAAGG + Intergenic
1031989639 7:128189326-128189348 CAAGGGGACTGGTGGGGACGGGG + Intergenic
1032307409 7:130748999-130749021 GTGTGGTACTGGTGGGAAAATGG + Intergenic
1033246119 7:139717621-139717643 CAGCCTTACTGGTGGGGACTGGG + Intronic
1033363562 7:140654969-140654991 CAGTGGTAGTGGTGGTGATGGGG - Intronic
1033638550 7:143237699-143237721 CAGTGGTAGTGGTGGGCACTGGG + Intergenic
1034984096 7:155496833-155496855 CAGAGGTCCTCGTGGGGAGAGGG - Intronic
1037307145 8:17516958-17516980 CAGTGTTGATTGTGGGGACAGGG - Intronic
1038424879 8:27458644-27458666 CAGGGGTAGGGGTGGGGAGAGGG - Exonic
1039144980 8:34437621-34437643 CAGTGCTGTTGGAGGGGACATGG + Intergenic
1039418790 8:37418665-37418687 CAGTGGTTCTGGTTGGGATATGG - Intergenic
1041944020 8:63421873-63421895 AAGTGGTAATGGTGGTGAGAGGG - Intergenic
1043887747 8:85622044-85622066 TAGTGGTGCTGGTGGGGAGGTGG + Intergenic
1046906889 8:119583069-119583091 CAGTGGCACTTCAGGGGACAGGG - Intronic
1049551447 8:143261795-143261817 CAGGGGTGCGGGTGGGGGCAGGG - Intronic
1049640619 8:143713512-143713534 CTGTGACACTGGAGGGGACAGGG + Intronic
1049820897 8:144632581-144632603 CAGGGGTTCTGGTGGGCTCATGG + Intergenic
1050769021 9:9173383-9173405 CATTTGTACTGGTTGGGTCATGG + Intronic
1051327099 9:15983949-15983971 CAATGGTTCTGGTGGGAAGATGG - Intronic
1052204868 9:25827458-25827480 CAGTGGTGGTGGTGGCCACAGGG - Intergenic
1052323155 9:27190166-27190188 CAGTGGGACTGGAGGGTACTAGG + Intronic
1052576537 9:30299269-30299291 CAGAGGCACGGGTGGGGACTGGG + Intergenic
1055719514 9:79156109-79156131 CGGCGGTACAGGTGGGGCCAGGG - Intergenic
1057415701 9:94860388-94860410 CAGTGGCAAGGGTGGGGACGGGG + Intronic
1058513112 9:105740687-105740709 AAGAGTTACTTGTGGGGACAGGG - Intronic
1059053374 9:110952902-110952924 CAGTGGTGGTGGTTGGGGCAGGG - Intronic
1059318066 9:113444040-113444062 CAGTGGTAGGGATGAGGACAAGG + Intergenic
1060697085 9:125718565-125718587 CAGAGGTATTGGTGGGGAGAGGG + Intergenic
1061180063 9:129020062-129020084 CAGGTGTGCTGGTGGGCACATGG + Intronic
1061681239 9:132243393-132243415 AAGGGGTGCTGGAGGGGACAGGG + Exonic
1061741326 9:132708496-132708518 CTGTGGTCCTGGTGGGAACATGG - Intergenic
1062281490 9:135753887-135753909 CAGTGGTGCTAGAGGGGCCAGGG + Intronic
1062319626 9:135984385-135984407 CAGAGGGGCTGGAGGGGACAAGG + Intergenic
1062447932 9:136603522-136603544 CAGGGGTCCTGGTGGGGTCCAGG + Intergenic
1186534938 X:10337246-10337268 CAGAGTTACTGGTGGAGACAGGG + Intergenic
1187274245 X:17804569-17804591 CAGTAGGACTGGTGAGGACAAGG + Intronic
1187889388 X:23920066-23920088 CAGTGGTGGTGGTGGCCACAAGG - Intronic
1188002866 X:24998522-24998544 CAGTGATGCTGGGAGGGACAGGG + Intergenic
1189226711 X:39419399-39419421 CAGTGATCCTGCTGGGGACACGG + Intergenic
1189536193 X:41937460-41937482 CAGTGGTATAGGTGGTGGCAGGG + Intergenic
1189880876 X:45491080-45491102 CAGTGGAGCTGGTGGGGGGAAGG - Intergenic
1190262326 X:48805267-48805289 CAGTGGCAGTGGTGAGGAGAGGG + Intronic
1191029952 X:55959045-55959067 CAGCTGCACTGGTGGGGCCAGGG - Intergenic
1191177139 X:57516498-57516520 CGGTGGCAGTGGTGGGGGCAGGG + Intergenic
1193134026 X:77949611-77949633 CAATTCTACTGGTGGGAACAAGG + Intronic
1193253368 X:79319319-79319341 CAGTTGTAGTAGTGTGGACAGGG + Intergenic
1193311923 X:80020686-80020708 CAGTGGTAGTGGTGGTGGTAGGG - Intronic
1193790213 X:85808149-85808171 GAGTGGCACTGGAGGGGGCAGGG + Intergenic
1194479306 X:94400886-94400908 CAGTGGTGGTGGTGGATACAGGG - Intergenic
1194574014 X:95589218-95589240 CAGTAGTGCTAGTAGGGACAAGG - Intergenic
1196112485 X:111962168-111962190 CATGGGTACTGGTGGGGAATGGG - Intronic
1196271352 X:113715973-113715995 TAGTGATACGGGAGGGGACAGGG + Intergenic
1196477742 X:116108465-116108487 CAGTGGCGCCGGTGAGGACAAGG - Intergenic
1197161215 X:123324517-123324539 CAGTGGGAGTTGAGGGGACATGG - Intronic
1197376043 X:125682777-125682799 CAGTGGTGGTGGTGGGCACAGGG + Intergenic
1197476336 X:126929788-126929810 CAGTGCTATTGGGAGGGACATGG - Intergenic
1198293074 X:135257396-135257418 CAGTGGTGATGGTGGCCACAGGG + Intronic
1199036131 X:143053033-143053055 CTGTGGTAGTGGTGGCTACAGGG - Intergenic
1199525761 X:148790104-148790126 CAGTGGTACTGGTTGTCAAATGG + Intronic