ID: 961032484

View in Genome Browser
Species Human (GRCh38)
Location 3:123618601-123618623
Sequence GCTTCTCTTCACCATGAATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 168}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961032484 Original CRISPR GCTTCTCTTCACCATGAATA GGG (reversed) Intronic
906523735 1:46482026-46482048 AATTCTCTTCTCCTTGAATATGG + Intergenic
907077670 1:51593162-51593184 TCTACTTTTCACCATGAAGAGGG + Intronic
910471711 1:87560406-87560428 ACTTCTCTTCACCATCACCATGG + Intergenic
916290741 1:163163739-163163761 GCTTCTGTCAACAATGAATAGGG - Intronic
916981224 1:170139479-170139501 ACTACTCTTCCCCATAAATATGG - Intergenic
917681937 1:177376285-177376307 TCTTCTCTGCAGCATGAAAATGG - Intergenic
919168971 1:193930127-193930149 ACTTCTCTTCAACATTAATCTGG - Intergenic
921256055 1:213340671-213340693 GCCTCCCTTCACCATGCAAATGG + Intergenic
924931681 1:248737867-248737889 GCTGCTCTTCTCCAAGAGTAAGG - Intronic
1064719621 10:18215811-18215833 GCTTCTCTTAAACATCAACATGG - Intronic
1066145722 10:32555599-32555621 GCTACTCTTACCTATGAATATGG - Intronic
1068279819 10:54854315-54854337 CCTTCTCTTCACCCACAATATGG + Intronic
1069876066 10:71563524-71563546 GAATCTCTTCACCATGAACTTGG - Intronic
1078300666 11:10129036-10129058 GCTTCTTATCACCAAGAAAATGG - Intronic
1078756648 11:14217095-14217117 GTTTCTCTGAACCAGGAATAAGG - Intronic
1081264388 11:41001755-41001777 GCTACTCTTCACCTTGAACATGG + Intronic
1082100589 11:48169900-48169922 GCTTCTCTGCATCCTGAAAAGGG + Intronic
1083031990 11:59601229-59601251 ACATATCTTCACCATCAATATGG - Intronic
1084629535 11:70338437-70338459 GCTTCACTTCATCATGGGTATGG + Exonic
1086611031 11:88755996-88756018 GATTGTCCTCACCATGAACAAGG + Intronic
1086745563 11:90422627-90422649 GCCATTCTTCACCATAAATAGGG - Intergenic
1089401737 11:118168380-118168402 GCCTCTCTTCCCCAGGAAAAGGG - Intronic
1089610429 11:119665591-119665613 GTCTCACTGCACCATGAATAGGG - Intronic
1093742675 12:22706337-22706359 CCTTCTTTTCTCCATGAAGAAGG + Intergenic
1095365790 12:41403400-41403422 GCTTATATTCACCATGTATTTGG - Intronic
1096370847 12:51067780-51067802 GCTTCTCTTCAGCATCAATACGG + Exonic
1100976549 12:100128607-100128629 GCTTGCTTTCACCAGGAATAGGG - Intronic
1102614603 12:114142392-114142414 GCTTCTGTTCTCCATCAGTAAGG + Intergenic
1105356149 13:19661817-19661839 CCTTCTCTGCAGCATGAATGAGG - Exonic
1107484510 13:40813306-40813328 GCTCCTCAGCACCATGGATATGG - Intergenic
1107594175 13:41944622-41944644 GCTGGTTTTCACCATGATTATGG - Intronic
1109536980 13:63734893-63734915 GCTTCACTTGGCCATGAATAAGG - Intergenic
1111297260 13:86296487-86296509 GCTTCTCTTCACAATTAAGGAGG + Intergenic
1111507487 13:89212736-89212758 TCTTCTCTGCAACATGAAAATGG - Intergenic
1114832263 14:26159164-26159186 GCTTCTCTTGACCATGCTTTTGG + Intergenic
1117542329 14:56760427-56760449 CTTTCTCTTCACCATCAATGTGG - Intergenic
1119890498 14:78178836-78178858 GCTCCTCTTCTCCATGATTCAGG - Intergenic
1120230324 14:81834644-81834666 GCTTCTCTTTCCCTTGGATAGGG - Intergenic
1120244895 14:81994984-81995006 GCCTCTCCTCTCCATGACTATGG - Intergenic
1121243257 14:92445010-92445032 GCAACTCTACTCCATGAATAAGG + Intronic
1121325228 14:93015862-93015884 GCTTTTCTTCACCAGGACAAAGG - Intronic
1121811309 14:96893386-96893408 GCTTCTCCTCACCATAATTTTGG + Intronic
1128613238 15:69090212-69090234 GCTTCTCCTCACCAGAAAAAGGG - Intergenic
1128713204 15:69887464-69887486 TCTTCTCTACCCGATGAATATGG - Intergenic
1130846899 15:87756021-87756043 GCTTTTCTTCACCCTGCAAAGGG - Intergenic
1131193134 15:90333318-90333340 GATTCTCTTTCCCAGGAATATGG - Intergenic
1131865501 15:96704404-96704426 GTTTCTGGTCCCCATGAATAAGG + Intergenic
1134078362 16:11308119-11308141 CCTTCTCTTCACCCACAATATGG + Intronic
1135239419 16:20790850-20790872 GCTTTTCTTCAGCAAGAATTTGG - Intronic
1138923679 16:61565082-61565104 TCTTCTCTTTACCATGAAAAAGG + Intergenic
1143928515 17:10395419-10395441 GCATCTCTTGAACATGAAGAAGG - Exonic
1143932810 17:10448104-10448126 GCATCTCTTGAGCATGAAGAAGG - Exonic
1143937030 17:10496527-10496549 GCATCTCTTGAACATGAAGAGGG - Exonic
1143939486 17:10525043-10525065 GCATCTCTTGAACATGAAGAGGG - Exonic
1148741574 17:49896269-49896291 GCTTCTCTTCACTAACAAGAAGG - Intergenic
1148768521 17:50053501-50053523 GCTCCTCTTCTCCAGGAACATGG + Intergenic
1151059455 17:71074399-71074421 TCTTCTCTTCACCATCATTCTGG + Intergenic
1153979264 18:10295431-10295453 GCTTTGCTTCTGCATGAATAAGG - Intergenic
1158391024 18:57045033-57045055 GCCTCTTTTCACCACAAATAGGG - Intergenic
1158798894 18:60882402-60882424 GTTTTTCTTCACCATCAACATGG - Intergenic
1160455873 18:78999560-78999582 GTCTCTCTTCACCATGCAGAGGG - Exonic
1167387267 19:49171388-49171410 TCTTCTCATCACCATCAATCAGG - Exonic
1168171422 19:54592440-54592462 GCTCCACTGCACCATGTATAGGG - Intronic
927930802 2:27042466-27042488 GTTTCTCTTCTCCAGGAAGATGG - Intronic
928188549 2:29138932-29138954 ACCTCTCTTCACCAACAATATGG - Intronic
930225398 2:48787136-48787158 GCTTCTTTCCTCCATGTATAGGG - Intergenic
930564075 2:52997647-52997669 GCTTCTCTTAATAATCAATATGG - Intergenic
930610500 2:53537792-53537814 CCTTCTCTTCTCCATGAAAGGGG + Intronic
932772111 2:74506241-74506263 GTTTCTCTTCACCTAGAAGAAGG + Exonic
933231433 2:79812260-79812282 ACTTCTATTCACCATGATAATGG - Intronic
938925877 2:136041813-136041835 GCTTGTCTTAAAAATGAATATGG - Intergenic
939327293 2:140709990-140710012 TCTACTCTTAACTATGAATATGG + Intronic
940545170 2:155073850-155073872 GTCTCTCTTCATCATGTATAAGG + Intergenic
940719521 2:157266845-157266867 GCATCTCTTACCCATGTATAAGG - Intronic
941628855 2:167862007-167862029 GCTTCCCTTCACCATGGGCAAGG - Intergenic
941655260 2:168136718-168136740 GCTTATCTTCCCCTTGAATTTGG - Intronic
944355919 2:198787736-198787758 GCTTCTCTTACCAAAGAATAAGG - Intergenic
945741156 2:213663234-213663256 CCTTCTGTACACCATGACTATGG + Intronic
946433214 2:219636440-219636462 GCTTCGCCTCACCTTGAAGAAGG - Exonic
946901753 2:224379916-224379938 TCTTCTCATCACCTTGAATCCGG - Exonic
948335754 2:237205795-237205817 GGTTCTGTTCACAATGAATTAGG - Intergenic
948359770 2:237412041-237412063 GCTTCTCTCGACCATGAGTGAGG + Intronic
1173097800 20:40053606-40053628 GTTTCTCTTCTCCATGATAAAGG - Intergenic
1173257289 20:41403658-41403680 GCTTTCCTTCACCAAGAATAAGG - Exonic
1174268261 20:49347742-49347764 CCTTCTCTTCTCCATGACTCAGG - Intergenic
1176894289 21:14357853-14357875 CCTTCTCTTCCCCATGAGTCTGG - Intergenic
1178363680 21:31970541-31970563 GCTGCTCTCCATCATGAGTATGG - Intronic
950573015 3:13813687-13813709 GCTTCCCTACACCTTGAATCTGG + Intergenic
952001656 3:28792847-28792869 GCTTCTCCTTACCATGAACTAGG + Intergenic
953019593 3:39105039-39105061 GCTGCTCTCCATCATGAATGAGG + Intronic
959121743 3:102241155-102241177 GCTGCTGTTCACCATGAACCAGG - Intronic
960171756 3:114470471-114470493 GTTTCTCTTCAAGATGAAAAAGG - Intronic
960272181 3:115687276-115687298 GCTGATCTTCACAATGAGTATGG + Intronic
960963223 3:123086684-123086706 ATTTCTCTTCACCATCAATGTGG + Intronic
961032484 3:123618601-123618623 GCTTCTCTTCACCATGAATAGGG - Intronic
963490736 3:145997061-145997083 ACTTCTCTTCATCATGACTCTGG - Intergenic
963555965 3:146789220-146789242 GCTTCTCGTCACCAATAAAAAGG - Intergenic
964557633 3:157957582-157957604 GTTTCTCTTCCACATGAATTTGG + Intergenic
969194340 4:5548306-5548328 ACTTCTCTTCACCTGGAATGAGG + Intronic
971097517 4:23424416-23424438 TATTCTCATCACCAAGAATAGGG + Intergenic
971399729 4:26265003-26265025 TTTTCTCTTCCCTATGAATAGGG - Intronic
974122341 4:57654674-57654696 GCTTATGTTCATTATGAATATGG - Intergenic
977082915 4:92555999-92556021 GCTTCTCTTACCCATGACAATGG + Intronic
977609653 4:99018926-99018948 CCTTCTCTTGACCATAAATCCGG + Intronic
977846515 4:101773634-101773656 GCTGCTCAGCACCATGGATATGG + Intronic
979010852 4:115366299-115366321 CCTTCTCTTCACCAGCAACATGG - Intergenic
979115046 4:116812976-116812998 GCTTTGCCTCAACATGAATACGG + Intergenic
979128919 4:117014425-117014447 GTTTTTCTTCGCCATGAATGTGG - Intergenic
979686632 4:123517606-123517628 GCATCTCTTAATCTTGAATATGG + Intergenic
980596186 4:134957889-134957911 ACTTCTCTTCACAATGTAAAAGG + Intergenic
984203148 4:176752530-176752552 CCTTCTCTTCACTATTAAAACGG + Intronic
987936349 5:24470351-24470373 GATTCTCTTGACCCTGAAAAGGG + Intergenic
988512363 5:31876068-31876090 TCTTCTCTTCTCCATAAATAAGG + Intronic
989346379 5:40434977-40434999 GCTTCTCTTACCAAGGAATAAGG - Intergenic
990530647 5:56670015-56670037 GCTTTTCTGCACCATGCACAAGG - Intergenic
992133703 5:73721173-73721195 GCTGCTCTCCACCATGTATGAGG + Intronic
992177889 5:74168666-74168688 CCATGTCTTCTCCATGAATATGG + Intergenic
993482776 5:88445382-88445404 GATTCTTTTCACATTGAATAGGG - Intergenic
995071610 5:107929108-107929130 GTTTCTTTTCACCACCAATATGG - Intronic
995486179 5:112642199-112642221 TCTTCTCTTCACCATGTAGGAGG - Intergenic
995675803 5:114661066-114661088 TCTTCTTTACACAATGAATAGGG + Intergenic
996583834 5:125062647-125062669 TCTTCTCTACACAATAAATATGG - Intergenic
998975241 5:147637980-147638002 TATTCTCCTCACAATGAATAAGG - Intronic
999704822 5:154262613-154262635 GCTTCTGTTCAGCATCAACAGGG - Intronic
1001240320 5:170063917-170063939 GCTCAGCTTCACCATGAAGATGG + Intronic
1003632270 6:7798359-7798381 GCTTCAGTTCACCATCAGTAAGG - Intronic
1005559439 6:27023123-27023145 GTTTCCCTTCACCTTGAATTTGG + Intergenic
1006723084 6:36172904-36172926 GCTTCTCCTCTCCATGACTTGGG + Intergenic
1007139047 6:39553463-39553485 CCTTATCTTCACCATTAAAAAGG - Intronic
1012708564 6:102567280-102567302 GAATGTTTTCACCATGAATAAGG - Intergenic
1013577715 6:111501256-111501278 GTTTCTCTGCTCCTTGAATACGG - Intergenic
1013991204 6:116255755-116255777 GCTTCTCTTCATCTTGACTCAGG - Intronic
1014187253 6:118449015-118449037 GCTTCTTTTCAACTTGAAAATGG - Intergenic
1017698817 6:157047536-157047558 CCTTATCTTCACCATCACTAAGG - Intronic
1018994308 6:168699647-168699669 TCTTCTCTTTACTTTGAATATGG + Intergenic
1021922622 7:25501817-25501839 GCATCTCTTCTCCATGCATCAGG + Intergenic
1023452771 7:40305066-40305088 TCCTTTCTTCACCCTGAATACGG + Intronic
1023611759 7:41978712-41978734 CCTTCTTCTCTCCATGAATATGG + Exonic
1023920474 7:44625680-44625702 GCTTATCTTCACTGTGAATTTGG + Intronic
1028024664 7:85821877-85821899 GCTTCTCTTCACCCACAACATGG - Intergenic
1028636868 7:92998643-92998665 GCTTCTTTTCCCTTTGAATAAGG - Intergenic
1028812063 7:95098921-95098943 GCTTCTCTTGAGCGTGAAAATGG - Intronic
1029379415 7:100203133-100203155 ACTTCTCTTCTCCAAGAATTGGG + Intronic
1030168502 7:106578575-106578597 GCTTTTCTTCTCCATTAAAATGG - Intergenic
1032476506 7:132214849-132214871 GCTTGGCTTAACCATGACTAGGG + Intronic
1034300793 7:150013728-150013750 ACTTCTCTTCAGCATGACTGAGG - Intergenic
1034805258 7:154083572-154083594 ACTTCTCTTCAGCATGACTGAGG + Intronic
1035447434 7:158952387-158952409 GCTTTTCTTCTCCATGGCTAAGG + Intronic
1036772662 8:11589751-11589773 CCTTCACTTCACCATGAGGAGGG + Intergenic
1038694977 8:29798405-29798427 GCTTCTTTTAACCTTGAATAGGG + Intergenic
1043732749 8:83705125-83705147 GTTTCTCTTGAACTTGAATATGG + Intergenic
1044524896 8:93241056-93241078 CCTTCTCTTCACCCACAATATGG + Intergenic
1044663137 8:94611273-94611295 GTTTCTCTTCACCCTCACTAAGG + Intergenic
1045167327 8:99621284-99621306 CCTTCTCTTCTCCATAAATAAGG + Intronic
1045464445 8:102456726-102456748 GCTTCTCTTCAAGTTCAATAAGG - Intergenic
1045667638 8:104506726-104506748 TCCTCTCTTCCCCATGGATAAGG + Intronic
1045987341 8:108264168-108264190 ACTTCTCTTCCCCCTAAATATGG + Intronic
1046174200 8:110553539-110553561 GCTTATCTTGATCATGTATATGG + Intergenic
1046300126 8:112276461-112276483 GTTTCTCTTCACCAAGATAATGG + Intronic
1046347688 8:112956238-112956260 TCATTTTTTCACCATGAATAAGG - Intronic
1046379233 8:113432328-113432350 GGTTCTCTTCTCCCTGAATGCGG - Intronic
1050532432 9:6602200-6602222 GCATCTCTACACCAAGAATAAGG + Exonic
1053359983 9:37478449-37478471 GCTTGTTTTCAGCATGCATAAGG + Intergenic
1056387593 9:86111946-86111968 GTGTCTCTTCCCCATGAATCTGG + Intergenic
1056499196 9:87190992-87191014 GCTTCTCTACAAAATGACTATGG - Intergenic
1058028466 9:100168663-100168685 TATTCCCTTCACCATGAATAAGG - Intronic
1058879494 9:109274200-109274222 GCTGCTTTTCAACATGAAAAGGG - Intronic
1061561324 9:131405783-131405805 GCTACTCTCCACCAGGAAGAGGG - Intronic
1062479722 9:136745686-136745708 GCTTCTCTTCACCCTCAGGATGG + Intronic
1186723178 X:12327964-12327986 ACTTCTCTTCCCCTTGAATCTGG + Intronic
1187937485 X:24350232-24350254 CCTTTTCTTCACCTTGATTATGG + Intergenic
1190886075 X:54531721-54531743 GCGTCTCTTCACCCTGGAGAGGG - Intronic
1195623743 X:106986079-106986101 CCTTGTCTTCACCAAGAATGGGG - Exonic
1195853659 X:109308601-109308623 GCTTCTCTTCCAATTGAATAAGG + Intergenic
1198700550 X:139392852-139392874 TCTGCTCTTCACCAAGAGTAGGG + Intergenic
1200418565 Y:2937731-2937753 GCTTACCTTCACCAAGAAGAAGG - Intronic
1200674544 Y:6134936-6134958 GCTCCTCACCATCATGAATATGG - Intergenic
1200739528 Y:6838189-6838211 GCTAGTCTTCAACCTGAATAAGG + Intergenic
1200798599 Y:7364218-7364240 CCTCCTCTTCACCAGGAAGAAGG + Intergenic