ID: 961033656

View in Genome Browser
Species Human (GRCh38)
Location 3:123627437-123627459
Sequence CCATTACAACTCAAAGAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 252}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961033656 Original CRISPR CCATTACAACTCAAAGAAGT AGG Intronic
900794474 1:4699731-4699753 AAAATACAACTCAAAGAAGGTGG - Intronic
900815323 1:4839280-4839302 CCATTCCAAATGAGAGAAGTTGG + Intergenic
902414074 1:16228744-16228766 TTCTCACAACTCAAAGAAGTGGG + Intergenic
904903638 1:33877513-33877535 GCATTACAACTCTGAGAATTTGG + Intronic
907628815 1:56059581-56059603 GCAAAACAACTCTAAGAAGTAGG + Intergenic
907683240 1:56584199-56584221 TCTTTACAACTCACTGAAGTAGG + Intronic
908213660 1:61928652-61928674 TCATTACAACCCTATGAAGTAGG - Intronic
908457434 1:64317951-64317973 CCATAACAACTCCGAGAAATAGG + Intergenic
909116715 1:71546587-71546609 TCACAACAACTCAGAGAAGTTGG + Intronic
909274818 1:73669591-73669613 CCATAAGAACTGAAAGAAGAGGG + Intergenic
910039450 1:82831606-82831628 CAATTATAACTTAAAGAAATAGG + Intergenic
910517733 1:88082145-88082167 CCATTATAAATCAATGAGGTAGG - Intergenic
910955640 1:92701166-92701188 GCTTTAAAACTCAAAGCAGTTGG + Intronic
911226644 1:95314381-95314403 CCTTTAAAACTAAAAGGAGTTGG - Intergenic
911277400 1:95879087-95879109 CCATTACAAATGGAAGAAATTGG + Intergenic
911994004 1:104739314-104739336 CCATTAAAAATTAAAGAAATGGG - Intergenic
913200142 1:116489329-116489351 ACCTTGCAACTCAAAAAAGTAGG - Intergenic
913418442 1:118637638-118637660 CCATTACAATCCTATGAAGTTGG + Intergenic
914953068 1:152135306-152135328 ACTTTGCACCTCAAAGAAGTGGG + Intergenic
916492089 1:165311015-165311037 ACATTAGAACTTAAAGAAGTGGG - Intronic
916560841 1:165933217-165933239 TCATAACAACTCTATGAAGTAGG + Intergenic
916630181 1:166604156-166604178 CCCTTTCAACTCAAAGATGTGGG + Intergenic
917769745 1:178264743-178264765 CCATTAAAACTCTAAACAGTGGG - Intronic
918564077 1:185905810-185905832 CCTTTAAAACTCTAACAAGTTGG - Intronic
918927994 1:190812480-190812502 GCATCACAACTAAAAGAACTAGG + Intergenic
919231643 1:194781401-194781423 ACATCACAACTAAAAGAACTAGG + Intergenic
919316192 1:195972721-195972743 TCAATACAACACAAACAAGTCGG + Intergenic
920828175 1:209441953-209441975 TCCTCACAACTCTAAGAAGTAGG + Intergenic
924887608 1:248236484-248236506 ACATCACAACTAAAAGAACTAGG + Intergenic
924931152 1:248733446-248733468 CCATGACAACCCATAGAGGTAGG - Intronic
1064353361 10:14596884-14596906 CTAAGACAACTCTAAGAAGTAGG + Intronic
1064687718 10:17881376-17881398 TCATCACAACTCTAAGAAGCAGG + Intronic
1065074897 10:22067528-22067550 ACATAACAAATGAAAGAAGTTGG - Intergenic
1065263187 10:23947393-23947415 CAATTGCAAGTCAAAGAAATGGG - Intronic
1069277157 10:66606847-66606869 ACATCACAACTAAAAGAAGTAGG + Intronic
1069340842 10:67406495-67406517 ACATCACAACTAAAAGAACTAGG + Intronic
1072094500 10:92163692-92163714 CCATTATAAGTCAAAGATATAGG - Intronic
1072779173 10:98233477-98233499 CCATGACAAGGCAAAGAAGATGG - Intronic
1072807081 10:98430404-98430426 CCCTTACATCTGAAAGCAGTGGG + Intronic
1073667473 10:105550045-105550067 CCATAACAGCACAAAGAAGGTGG + Intergenic
1074000009 10:109362360-109362382 TCATAACAACCCAAAGAGGTAGG + Intergenic
1074258796 10:111831296-111831318 TCATAGCAACTCAAAGAGGTAGG + Intergenic
1074694292 10:116034492-116034514 CAATAACAGCTCAAAGAAGCGGG - Intergenic
1076593186 10:131605530-131605552 ACATTATACCTCAAAAAAGTTGG + Intergenic
1078649887 11:13180095-13180117 CCATTATAAGCCAAAGATGTTGG - Intergenic
1079285061 11:19121538-19121560 CCTATACAAATCACAGAAGTAGG - Intronic
1080908580 11:36572351-36572373 GCATTACAACTCAAATCAGTCGG + Intronic
1082202315 11:49386936-49386958 CCATTAAATCTTAAATAAGTGGG - Intergenic
1082796104 11:57379075-57379097 TCACCACAACTCTAAGAAGTTGG + Intronic
1085729830 11:78987796-78987818 TCATTACAACTCAGAGAAGTAGG + Intronic
1085890442 11:80573018-80573040 CCATTATAAATGAAAGAAATTGG + Intergenic
1086652701 11:89313152-89313174 CCATTAAATCTTAAATAAGTGGG + Intergenic
1087822490 11:102728236-102728258 TCATAACAACCCAGAGAAGTGGG + Intergenic
1090023030 11:123144253-123144275 TCAACACAAATCAAAGAAGTTGG - Intronic
1090153256 11:124407734-124407756 CCATTGCCAATCAAAGAAGAAGG - Intergenic
1091083072 11:132691081-132691103 CCATGACAACCCTATGAAGTAGG + Intronic
1093215371 12:16355499-16355521 CCATTATACCTCAAAATAGTAGG - Intronic
1093239839 12:16656698-16656720 ACATCACAACTAAAAGAACTAGG - Intergenic
1093388338 12:18586121-18586143 ACATCACAACTAAAAGAACTAGG + Intronic
1095537257 12:43264888-43264910 CAATAACAAGTCAAGGAAGTTGG + Intergenic
1097371896 12:58793748-58793770 GCATTAAAACTTAAAGAAATAGG + Intronic
1097392725 12:59035176-59035198 CCATTACTGTTCAAAGAAATAGG + Intergenic
1097575599 12:61389084-61389106 CCATTCCAAATGAAAGAAATAGG + Intergenic
1097635971 12:62122494-62122516 CCATTACAACTCCAGGTAGTAGG + Intronic
1097959633 12:65519812-65519834 TCATTACAACCCAATGAAGTAGG - Intergenic
1098493777 12:71111857-71111879 CCATTCCAAATGAAAGAAATTGG + Intronic
1099495761 12:83343832-83343854 CCATTTCAAAAGAAAGAAGTTGG - Intergenic
1099694201 12:85997579-85997601 CCATTACAAATGGAAGAAATTGG + Intronic
1101537103 12:105628487-105628509 CCTTTCCAACTCAAAGAAAGGGG + Intergenic
1101642449 12:106597369-106597391 CCAATACAATTAAAAGAACTTGG - Intronic
1105394171 13:20012671-20012693 CCAGTACAAAACAATGAAGTTGG - Intronic
1106297150 13:28425431-28425453 CCCTTACACCACAAAGAAATTGG + Intronic
1106646736 13:31642615-31642637 CTATTATAACTCAATAAAGTTGG + Intergenic
1107761163 13:43680657-43680679 TCATAACAACTCAATGAGGTGGG - Intronic
1108468345 13:50741748-50741770 CCATGATAATTCAATGAAGTGGG + Intronic
1108538252 13:51408671-51408693 TCTTGATAACTCAAAGAAGTAGG + Intronic
1108745470 13:53388912-53388934 CCATTACAACCAAAGGAAATAGG - Intergenic
1110170080 13:72490136-72490158 ACATTACAACTCAAATATGCAGG + Intergenic
1110597493 13:77335309-77335331 CCCTTACAACTGAATTAAGTTGG - Intergenic
1110678136 13:78275493-78275515 TCATTACAACTCTAGGAAGGAGG + Intergenic
1113255955 13:108505160-108505182 GGATTAAAACCCAAAGAAGTAGG + Intergenic
1113341692 13:109432315-109432337 CCATTCCAAATGAAAGAAATTGG + Intergenic
1115389265 14:32836119-32836141 CCATTGCAACACACAGGAGTTGG + Exonic
1118431818 14:65726896-65726918 CCATTACAAATGAGAGAAATTGG + Intronic
1118630439 14:67697562-67697584 CCATAACAACTCTAAGAGGTAGG + Intergenic
1119269770 14:73292344-73292366 CTACTACAAATGAAAGAAGTTGG - Intronic
1120132311 14:80822330-80822352 CCATTCCAAATGAAAGAAATTGG + Intronic
1120380545 14:83773502-83773524 CCATTAAAACAAAAAGAACTGGG - Intergenic
1121143724 14:91565271-91565293 CAATTACAACTCAATAAAGCTGG - Intergenic
1127043534 15:55002625-55002647 CCATTCCAAATGAAAGAAATTGG + Intergenic
1127225299 15:56920563-56920585 CCATTAAAAATAAAAGCAGTGGG - Intronic
1127890527 15:63246651-63246673 CCATAAAAACTCAAAGGACTGGG - Intronic
1128268942 15:66292295-66292317 CCACAACAAGTCAAAGGAGTGGG - Intergenic
1129386681 15:75200363-75200385 CCATTCCAACTCAGGGAAATTGG + Intronic
1130942010 15:88518436-88518458 CATTTACAAATAAAAGAAGTAGG + Intronic
1133803205 16:9101418-9101440 CCATCACAACTCTGAGAAGGTGG - Intronic
1135722373 16:24828604-24828626 CCAGTACCACTCTAAGAAGCAGG + Intergenic
1136859200 16:33686413-33686435 ACATTACCACTGAAAGAAATTGG + Intergenic
1138254709 16:55545495-55545517 CCATTTCAACTCTAAAAAGAGGG - Intronic
1139033242 16:62911248-62911270 CCATTTCAAATGAAAGAAATTGG + Intergenic
1139248905 16:65475724-65475746 TCATTACAACTCTACCAAGTAGG + Intergenic
1140381400 16:74491600-74491622 CATTTACAGCTCAAAGAAGTTGG - Intronic
1203120709 16_KI270728v1_random:1534599-1534621 ACATTACCACTGAAAGAAATTGG + Intergenic
1143721116 17:8810621-8810643 CCATTCCAAATGGAAGAAGTTGG + Intronic
1144271498 17:13621707-13621729 TCATAACAATTCTAAGAAGTGGG + Intergenic
1146254384 17:31381737-31381759 CCATTTCAACTCTGAGTAGTGGG + Intronic
1148713126 17:49696426-49696448 CCATGACAAAACACAGAAGTGGG + Intergenic
1150666827 17:67147828-67147850 CCATAAAAACCCAAAGAACTGGG + Intronic
1153454461 18:5264748-5264770 ACATTACAACTAAAAGAACTAGG + Intergenic
1154308499 18:13248266-13248288 CAATCACAGCTCAAAAAAGTGGG - Intronic
1154370442 18:13756641-13756663 TCATTTCAACTAAAAGAAATTGG + Intronic
1155115049 18:22756301-22756323 CCATTACACCTCAAGGAACTAGG + Intergenic
1155590876 18:27425770-27425792 CCATTACAACTTAGAGTATTTGG - Intergenic
1156264918 18:35479094-35479116 CCATGACAACACAAACAAATAGG + Intronic
1158676656 18:59526269-59526291 ACATCACAACTAAAAGAACTAGG - Intronic
1159440384 18:68471344-68471366 TCCTTAGAACTCAAAGAACTGGG + Intergenic
1159503519 18:69304908-69304930 CAATTACAATTCAATTAAGTTGG + Intergenic
1159697263 18:71575521-71575543 CCATTCCAAATAAAAGAAATTGG + Intergenic
1164478867 19:28596212-28596234 CCATGACAACTGAAAGAGGGAGG + Intergenic
1167022146 19:46885355-46885377 ACATAACAACCCAATGAAGTAGG + Intergenic
925461231 2:4064609-4064631 ACTTAACAACTCAATGAAGTAGG - Intergenic
926502408 2:13672879-13672901 CCATTCCAAATGAAAGAAATTGG + Intergenic
926950506 2:18237588-18237610 GCATTACAACTGAAAGAAGGGGG - Intronic
927265719 2:21148191-21148213 CAATTATAACTCAACAAAGTAGG - Intergenic
927358420 2:22202898-22202920 ACTTTACATCTCAAAGTAGTAGG - Intergenic
930004747 2:46887795-46887817 CCATAACAACCCAATGAAGTAGG + Intergenic
931728991 2:65136504-65136526 CAATTCCAACTCAAACAACTGGG + Intergenic
933249043 2:80007955-80007977 ACATTACAAGTTAATGAAGTGGG - Intronic
935254734 2:101299721-101299743 CCATTACCACACAAAGAACGTGG - Intronic
935731759 2:106070108-106070130 CCATTAAACCTCAAAAAATTGGG + Intronic
936442349 2:112565731-112565753 CCATAACAACCCAAAGGACTGGG - Intronic
937927248 2:127176726-127176748 CCAGGACAACTCCAAGAGGTCGG + Intergenic
938174000 2:129107626-129107648 CCAAAACAAAGCAAAGAAGTTGG - Intergenic
938878834 2:135563594-135563616 CCATTACTATTTAAATAAGTTGG + Intronic
941826170 2:169899278-169899300 CCTTTAAAAAGCAAAGAAGTAGG - Intronic
942164252 2:173226167-173226189 CCATTAAAAATCAAGGAATTAGG + Intronic
942249173 2:174033114-174033136 TAATTACAATTCAAAGAAGAAGG + Intergenic
943531801 2:189091782-189091804 CATTAACAATTCAAAGAAGTCGG + Intronic
1168920946 20:1535655-1535677 CCTTTACAACTATAAGAAATAGG + Intronic
1170059917 20:12248042-12248064 CCAATACAACTGATAGGAGTTGG - Intergenic
1170138843 20:13104938-13104960 CCATGACACCTCTGAGAAGTAGG - Intronic
1170407797 20:16057429-16057451 CAATAACAAGTCAAAGAAATTGG + Intergenic
1170573215 20:17644138-17644160 TCATTACAAGTCAAAGCATTTGG + Intronic
1170668693 20:18409761-18409783 CAATAACAACACAAAGAAGGTGG + Intronic
1171822770 20:29869588-29869610 ACATCACAACTGAAAGAATTAGG + Intergenic
1171910725 20:30949894-30949916 CCATTCCAAGTCAAAGAAAGGGG - Intergenic
1173109069 20:40168444-40168466 TCATAACAACTCCAAGAAATAGG - Intergenic
1174886935 20:54346213-54346235 AAATTAAAACCCAAAGAAGTAGG + Intergenic
1176881416 21:14199170-14199192 ACATCACAACTAAAAGAACTAGG + Intronic
1176890253 21:14308031-14308053 CAATTATACCTCAAAGAAGTTGG + Intergenic
1177208844 21:18044828-18044850 CCCTTACAACTCTGTGAAGTAGG - Intronic
1177305981 21:19316874-19316896 CCATTCCAAATGAAAGAAATTGG + Intergenic
1178037336 21:28599813-28599835 CCATTCCAAATGAAAGAAATTGG + Intergenic
1178046105 21:28696313-28696335 CCATTCCAAATGAAAGAAGTTGG + Intergenic
1178583441 21:33854555-33854577 CCAATAAAAGTCAAAGAACTCGG + Intronic
1181329206 22:22076017-22076039 GCAGCACAACTCAAAGTAGTGGG + Intergenic
949156187 3:829924-829946 CCATTACAAGTGGAAGAAATTGG + Intergenic
950072275 3:10162263-10162285 CCCTCACAACTCTAAGCAGTAGG + Intergenic
950689508 3:14644378-14644400 ACGTTACAACTCAAGGAATTAGG - Intergenic
951405075 3:22286466-22286488 ACATTATACCTCAAAGAACTAGG - Intronic
951791857 3:26494740-26494762 ACATCACAATTAAAAGAAGTGGG + Intergenic
954480317 3:50793807-50793829 ACATCACAACTAAAAGAATTAGG - Intronic
955586192 3:60480582-60480604 CCATTACAAATGAGAGAAATTGG + Intronic
956465172 3:69512987-69513009 ACTTTATAACTCAAAGAACTAGG + Intronic
957274313 3:78070803-78070825 CCATTAGAAGTCAGAGTAGTAGG + Intergenic
960924762 3:122783664-122783686 ACATGACAAGACAAAGAAGTTGG + Intronic
961033656 3:123627437-123627459 CCATTACAACTCAAAGAAGTAGG + Intronic
962502142 3:136006126-136006148 CCATTACTTGTCAAAAAAGTGGG - Intronic
964150435 3:153518220-153518242 CCATTACAAATGAGAGAAATTGG + Intergenic
965490752 3:169332931-169332953 CCATTATAATTCAAACAACTAGG + Intronic
967189316 3:186972082-186972104 CCATGACAACCCTAAGAATTGGG + Intronic
967594595 3:191314790-191314812 CCATTGAAACCCAAAGGAGTGGG + Intronic
969146597 4:5129702-5129724 CCTTAACAACCCTAAGAAGTAGG + Intronic
969960576 4:10940745-10940767 CCATTACAAATAAGAGAAATTGG - Intergenic
970070842 4:12158207-12158229 CCATCACAATTAAAAGAACTAGG - Intergenic
970120244 4:12745700-12745722 GGATTTCAACTCAAAGAAGCAGG + Intergenic
970144185 4:13016041-13016063 ACTTTACACCTCAAAGAACTAGG + Intergenic
973730591 4:53818657-53818679 CAATTACATCTCAATGAAGTTGG - Intronic
974069149 4:57108963-57108985 ACAATACAAATCAAAGAAATAGG + Intronic
974897680 4:67958510-67958532 CCATTCCAAATCAGAGAAATTGG - Intronic
976889833 4:90033049-90033071 CCATAAAAACTCAAAAAATTGGG - Intergenic
976961061 4:90974417-90974439 CAATTACAACTCAATAAAGCTGG + Intronic
977356327 4:95952049-95952071 CCATTCCAAATTAAAGAAATTGG + Intergenic
978448438 4:108803188-108803210 TCATTAAGACTCAAATAAGTGGG + Intergenic
978700816 4:111643782-111643804 ACATTACAACTGAAAGGAGTGGG + Intergenic
979853383 4:125601349-125601371 CTATTACAACAGAAAGATGTGGG - Intergenic
980168135 4:129252845-129252867 CCATTCCAAATAAAAGAAATTGG - Intergenic
980588484 4:134851507-134851529 AGATGACATCTCAAAGAAGTTGG - Intergenic
980647448 4:135660884-135660906 ACATTACAAGTGAAAGAATTAGG - Intergenic
980718784 4:136664878-136664900 ACATTACAACTTAAAGAACTAGG + Intergenic
982467753 4:155751158-155751180 CCATTACAGGCCAAAAAAGTAGG + Intergenic
983255973 4:165401104-165401126 CCAGTACAAATCAAAGAAGTGGG - Intronic
983899264 4:173115949-173115971 ACATCACAACTAAAAGAACTAGG + Intergenic
984355610 4:178654025-178654047 CCATTCCAAATGAAAGAAATTGG - Intergenic
985543926 5:499916-499938 CCACTGCACCTCAAAGAAGAAGG + Intronic
987894268 5:23925197-23925219 CCATTCCAAATCAGAGAAATTGG + Intergenic
990624950 5:57600213-57600235 CCATGACAAGTTCAAGAAGTGGG + Intergenic
992354529 5:75967412-75967434 CCTTTCCTACTCAAAGAAGGGGG + Intergenic
992774296 5:80076375-80076397 CCATAACAACTCTATGAGGTAGG + Intronic
993041091 5:82815700-82815722 CCATTCCAACTGAGAGTAGTGGG + Intergenic
993114651 5:83705647-83705669 ACATCACAACTGAAAGAATTAGG + Intronic
993146367 5:84098832-84098854 ACATCACAACTAAAAGAACTAGG + Intronic
993777073 5:92012702-92012724 CCATTACAAGTAAGAGAAATTGG - Intergenic
994886838 5:105574852-105574874 TCATTACAACCTAAAGAAATAGG + Intergenic
995318760 5:110806718-110806740 ACATTACAACTTAAATAATTAGG - Intergenic
995349671 5:111160417-111160439 TCAGTACAACTCTAAGATGTAGG - Intergenic
995821913 5:116244906-116244928 ACATCACAACTAAAAGAACTAGG + Intronic
995851938 5:116555305-116555327 TCATTACACCTCAGTGAAGTAGG + Intronic
998260896 5:140631281-140631303 CCCTTACCACTCAAGGAAGAGGG - Intergenic
999068494 5:148717034-148717056 CCATTTCAAATGAAAGAAATTGG - Intergenic
1000500686 5:162045512-162045534 GCATCACAACTTAATGAAGTAGG - Intergenic
1001197837 5:169689608-169689630 GCATTATTGCTCAAAGAAGTTGG - Intronic
1004331916 6:14729385-14729407 CCATTAAAACTCAAGTTAGTGGG + Intergenic
1005006540 6:21292848-21292870 CCATTTCATCTGAAACAAGTTGG + Intergenic
1006712460 6:36086227-36086249 ACATCACAACTAAAAGAACTAGG + Intronic
1007216021 6:40238629-40238651 ACATCACAACTGAAAGAATTAGG + Intergenic
1008399393 6:51047232-51047254 CAATAACAAGTCAAAGATGTTGG + Intergenic
1008771822 6:54988381-54988403 TCATTTAAACTCTAAGAAGTAGG - Intergenic
1011015608 6:82751339-82751361 TCATTACAACTCTCTGAAGTAGG + Intergenic
1012645655 6:101677238-101677260 TCACTACAACAAAAAGAAGTAGG + Intronic
1013635511 6:112025798-112025820 TCATAACAACTCCATGAAGTAGG + Intergenic
1014670823 6:124301756-124301778 CCATTCCAAATGAAAGAAATTGG - Intronic
1015408914 6:132869781-132869803 CCATTAGAAAGCAAAGAATTGGG - Intergenic
1018080280 6:160253571-160253593 CCATCACAACACATAAAAGTAGG + Intronic
1021532589 7:21664974-21664996 CCATGGCAGCTCAAAGAATTTGG - Intronic
1021533230 7:21673349-21673371 TCATCACAACTCTACGAAGTAGG - Intronic
1026660546 7:72298331-72298353 CCATCTCATCTCAAAGATGTAGG + Intronic
1027974562 7:85134752-85134774 CCATCATATGTCAAAGAAGTGGG - Intronic
1028176684 7:87668544-87668566 CCTTCACAACTGAAAGAATTAGG - Intronic
1030018024 7:105244171-105244193 CCATGAGAACACAGAGAAGTTGG + Intronic
1030882271 7:114895053-114895075 ACATCACAATTAAAAGAAGTAGG - Intergenic
1034586252 7:152095322-152095344 TCATTAAAACTTAAAGAACTTGG + Intronic
1035468745 7:159096521-159096543 CCTTTAGAACTTAAAGAACTTGG + Intronic
1035816679 8:2548707-2548729 ACATTACAATATAAAGAAGTAGG - Intergenic
1035959699 8:4123937-4123959 CAATTACAACTCAAAAAAGCTGG + Intronic
1038031092 8:23641074-23641096 ACAATTCAACTCAAAGACGTGGG + Intergenic
1038736196 8:30171852-30171874 ACATTTCAGCCCAAAGAAGTAGG + Intronic
1038809393 8:30824763-30824785 CCATAACAACCCTAAGAAGTAGG + Intergenic
1040755958 8:50774797-50774819 CAATAATAACCCAAAGAAGTGGG + Intronic
1042046057 8:64653072-64653094 ACATCACAACTGAAAGAATTAGG + Intronic
1043080687 8:75761254-75761276 CCATTCCAAATGGAAGAAGTTGG - Intergenic
1044927774 8:97223995-97224017 CCACTACAACTCAAACCAGGAGG - Intergenic
1048586040 8:135775200-135775222 CCTTTTCTACTTAAAGAAGTAGG + Intergenic
1051268109 9:15328214-15328236 CCATTTCAAATCAGAGAAATTGG + Intergenic
1056072526 9:83003270-83003292 TCATTACAGCTCAAGGAGGTAGG + Intronic
1058018327 9:100062206-100062228 AAATTACAACCCAAAGAAGTGGG - Intronic
1058275170 9:103031892-103031914 CAATTACATCTCAATAAAGTTGG + Intergenic
1059442471 9:114316608-114316630 TCATAACAACCCAATGAAGTAGG + Intergenic
1059582095 9:115561201-115561223 TGATTACAACTCAAGAAAGTAGG + Intergenic
1059952959 9:119486888-119486910 TCATGACAACTCAAAGATGAAGG + Intergenic
1060165324 9:121409044-121409066 GCATGACAACTCAAACAGGTAGG - Intergenic
1062131828 9:134899876-134899898 TCATTACAGCTCAATGAAGGTGG - Intergenic
1186160222 X:6769587-6769609 CCATGACAACACAAACAAGAAGG - Intergenic
1187144226 X:16622924-16622946 TCCTTACAACTCTATGAAGTAGG - Intronic
1187559816 X:20391494-20391516 ATACTACACCTCAAAGAAGTGGG + Intergenic
1187611124 X:20944496-20944518 CCATCAAAACACAGAGAAGTAGG - Intergenic
1188036104 X:25318830-25318852 CCGTTCCTACTCAAAGAAATGGG - Intergenic
1188215720 X:27474563-27474585 CCATAACAACTAAATGAAGTAGG - Intergenic
1188428331 X:30075554-30075576 AGATTACAACCCAAAGAACTTGG + Intergenic
1189113507 X:38319637-38319659 TCATAACAACTCTATGAAGTAGG - Intronic
1189540084 X:41978040-41978062 GAATTAAAACTCAAAGAAATTGG - Intergenic
1191743415 X:64460655-64460677 ACATCACAACTGAAAGAACTAGG - Intergenic
1193499743 X:82260998-82261020 CCCTTTCAACTCTCAGAAGTAGG - Intergenic
1194730839 X:97452912-97452934 GCAGTACACTTCAAAGAAGTTGG - Intronic
1194739616 X:97557228-97557250 CAATTTCATCTCAAAGAATTGGG + Intronic
1197383462 X:125774616-125774638 CCTTTATAACTCAAAGAAAGGGG - Intergenic
1197388564 X:125831091-125831113 AAATTACAACTGAAAGAACTAGG + Intergenic
1198872908 X:141194373-141194395 CCATTACAAATGAGAGAAATTGG - Intergenic
1199016758 X:142826158-142826180 CCATGACAACCCAATAAAGTAGG - Intergenic
1199240714 X:145544810-145544832 CCATTCCAAATCAGAGAAATTGG + Intergenic
1199530320 X:148839432-148839454 CCACTACAACCCAAAGAGATTGG + Intronic
1199621164 X:149702961-149702983 CAATAGCAACACAAAGAAGTAGG - Intronic
1199779641 X:151046369-151046391 CCACAACAACTCTAGGAAGTAGG - Intergenic
1199783762 X:151085491-151085513 TCATGACAACTCTATGAAGTTGG - Intergenic
1200606978 Y:5276665-5276687 CCATAGCAACTCAGAGGAGTTGG + Intronic
1201865907 Y:18653992-18654014 CCATTACAAAACAAACAAGAAGG + Intergenic