ID: 961034633

View in Genome Browser
Species Human (GRCh38)
Location 3:123634045-123634067
Sequence TAGTTCCATCAGCAGATGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 156}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961034633_961034637 -5 Left 961034633 3:123634045-123634067 CCACACATCTGCTGATGGAACTA 0: 1
1: 0
2: 0
3: 6
4: 156
Right 961034637 3:123634063-123634085 AACTACTGACTGCTAGGAAGGGG 0: 1
1: 0
2: 1
3: 11
4: 160
961034633_961034636 -6 Left 961034633 3:123634045-123634067 CCACACATCTGCTGATGGAACTA 0: 1
1: 0
2: 0
3: 6
4: 156
Right 961034636 3:123634062-123634084 GAACTACTGACTGCTAGGAAGGG 0: 1
1: 0
2: 0
3: 8
4: 143
961034633_961034635 -7 Left 961034633 3:123634045-123634067 CCACACATCTGCTGATGGAACTA 0: 1
1: 0
2: 0
3: 6
4: 156
Right 961034635 3:123634061-123634083 GGAACTACTGACTGCTAGGAAGG 0: 1
1: 0
2: 1
3: 8
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961034633 Original CRISPR TAGTTCCATCAGCAGATGTG TGG (reversed) Intronic
903973946 1:27137243-27137265 TCGTTCCCTCCGCAGAGGTGAGG - Intronic
914371390 1:147027946-147027968 TAGGTCCATCAGTAGATGAATGG + Intergenic
914783708 1:150809160-150809182 TTCTTCCATAAACAGATGTGGGG + Intergenic
916834190 1:168525640-168525662 GATTTCCATCAACAGATGAGTGG + Intergenic
917665919 1:177225563-177225585 CAGTTCCACCAGAAGTTGTGAGG + Intronic
917865384 1:179189688-179189710 TATTTCTAACACCAGATGTGTGG + Intronic
918834761 1:189447153-189447175 TAGTACCTTAAGCAGGTGTGTGG - Intergenic
923070427 1:230559232-230559254 TAGTACCATTATCTGATGTGTGG - Intergenic
923095410 1:230771589-230771611 TAGTTCCATGAGCACCTTTGAGG + Intronic
924152059 1:241139610-241139632 TATTCCCATCAGCAAGTGTGAGG + Intronic
924775872 1:247114268-247114290 AAGTTCCCTGAGCAGCTGTGTGG + Intergenic
1063652029 10:7947309-7947331 GCTTTCCATCAGCAGCTGTGAGG + Intronic
1063704499 10:8417833-8417855 TAGATTCATCAGCACATGGGTGG - Intergenic
1065303856 10:24350303-24350325 TAATTCCAGGAGCAGATGTGGGG + Intronic
1065875888 10:29996682-29996704 TACTTCCAACAGCAGATGACTGG - Intergenic
1066708483 10:38206215-38206237 AGGTTCCATCAACAGATGAGTGG + Intergenic
1069200516 10:65609376-65609398 TGGGTTCATCAGCAGATGAGTGG + Intergenic
1072571738 10:96663981-96664003 TACTTCCCTCAGCAGCTGGGGGG - Intronic
1075672730 10:124273777-124273799 AATTTCCATCAGCAGATGAGTGG - Intergenic
1085737971 11:79055973-79055995 TAGTTCCAGTGCCAGATGTGTGG - Intronic
1087360905 11:97158373-97158395 TATCACCATCAGCAGCTGTGGGG - Intergenic
1089869639 11:121660757-121660779 TAGTTCTATCTGCAGAGGTTGGG - Intergenic
1093029834 12:14278073-14278095 TAGATGCTTCAGCAGATTTGAGG - Intergenic
1093847881 12:23996558-23996580 AATATCCATCAGCAGATATGTGG + Intergenic
1095453237 12:42353358-42353380 TAATTCCAACAGCCAATGTGAGG - Intronic
1097920001 12:65061759-65061781 TATTTACATAAACAGATGTGTGG + Intronic
1098947618 12:76606210-76606232 TATTTTCATCCGCATATGTGTGG + Intergenic
1099057519 12:77863323-77863345 AAGTCCCTTCAGCAGATGTTAGG + Intronic
1103654064 12:122456447-122456469 CACTTCCAGCACCAGATGTGTGG - Intergenic
1104697999 12:130879239-130879261 TGGTGCCATCAGCAGGTGTTGGG + Intergenic
1106879008 13:34108684-34108706 AAATTCCAGCAGCTGATGTGAGG - Intergenic
1111102189 13:83602847-83602869 TAGTTTCATCAACATATGTGAGG - Intergenic
1112221308 13:97494086-97494108 TAGTACCATCCTCAGATCTGGGG + Intergenic
1115935670 14:38549223-38549245 TAGTTACAAGAACAGATGTGGGG - Intergenic
1116451248 14:45068881-45068903 TAGTTTTGTTAGCAGATGTGAGG - Intronic
1119202285 14:72765055-72765077 TATTTCTGTGAGCAGATGTGTGG - Intronic
1121974455 14:98390052-98390074 TTGTTCCTTCTGCAGCTGTGAGG + Intergenic
1129119944 15:73390071-73390093 TTGTCCCATCGGCAGATGGGAGG - Intergenic
1130041215 15:80406247-80406269 CAGTTCCATCAGCAGAAATAGGG + Intronic
1130732290 15:86509314-86509336 TGGCTCCATCAGCAGGTGAGGGG + Intronic
1131296115 15:91150648-91150670 TGCTTCCATAAGCAGATGGGTGG + Intronic
1132882354 16:2168023-2168045 GGGCTCCCTCAGCAGATGTGGGG - Intronic
1134570190 16:15284198-15284220 TAGGACCCTCAGCAGATGAGAGG + Intergenic
1134732185 16:16471855-16471877 TAGGACCCTCAGCAGATGAGAGG - Intergenic
1134935252 16:18240108-18240130 TAGGACCCTCAGCAGATGAGAGG + Intergenic
1136858833 16:33682804-33682826 TACGTCCATCAGCAGATGAATGG + Intergenic
1138895787 16:61202721-61202743 CAGTTTCTTCAGCAAATGTGTGG - Intergenic
1140306397 16:73806893-73806915 TCATCCCATCAGCAGATCTGAGG + Intergenic
1141840490 16:86571302-86571324 TAGTTTCAACAGCAGAGCTGGGG - Intergenic
1203120407 16_KI270728v1_random:1531298-1531320 TACGTCCATCAGCAGATGAATGG + Intergenic
1147341074 17:39753736-39753758 AAGTTCCTCCAGTAGATGTGTGG - Intergenic
1148426731 17:47604707-47604729 CAATTAGATCAGCAGATGTGAGG - Intronic
1148802149 17:50236100-50236122 GTGTTCCAACAGCAGATGGGAGG + Intergenic
1149655633 17:58308425-58308447 TGCCTCCATCAGCAGAGGTGGGG - Intronic
1152729931 17:81964718-81964740 AAAGTCCATCAGCAGATGAGTGG + Intergenic
1152914108 17:83024082-83024104 TAGGTCCAACAGGAAATGTGGGG - Intronic
1153398870 18:4659204-4659226 TATTTCCTGCAGCAAATGTGTGG - Intergenic
1154153654 18:11927261-11927283 TAGGTCAATCAGCAGAAGTTAGG - Intergenic
1155073349 18:22335056-22335078 AAGTTCCATCAACAGATGAATGG + Intergenic
1157923573 18:51738992-51739014 AAGTTCCATCAACAGATGCATGG + Intergenic
1158075219 18:53520236-53520258 TGAGTCCATCAGCAGATGAGAGG + Intronic
1158751013 18:60260935-60260957 TACTCCCATCAGCAGTGGTGAGG + Intergenic
1167809595 19:51816864-51816886 TACTTCTAACAGCATATGTGTGG - Intronic
925785160 2:7424764-7424786 CAGGTCCTTCAGCAGATCTGAGG - Intergenic
925939652 2:8804780-8804802 TACTTCTATGACCAGATGTGTGG + Intronic
927765539 2:25803922-25803944 TACTTCTAACACCAGATGTGTGG - Intronic
929531276 2:42754581-42754603 GAGCTCCCTGAGCAGATGTGAGG + Exonic
930090080 2:47525582-47525604 TTGCTTCATCAGGAGATGTGAGG + Intronic
931825038 2:65991515-65991537 CAGTGTCCTCAGCAGATGTGTGG - Intergenic
932277309 2:70461304-70461326 TAGATCCATCAGCAGGTGGTGGG - Intronic
932454270 2:71836547-71836569 TAGTTACAGAAGGAGATGTGAGG - Intergenic
932582536 2:73001132-73001154 TAGCTTCCTCAGCAGATGTGGGG + Intronic
935281617 2:101522638-101522660 GAATTCCACCAGCAGATGTTGGG + Intergenic
935416333 2:102822968-102822990 TAGTTCCAGCATCAGGTGTTGGG + Intronic
935460416 2:103325532-103325554 TTTTTCCATCAGCAGCTCTGAGG + Intergenic
936117511 2:109713872-109713894 TACTTCCAACACCACATGTGTGG + Intergenic
937729918 2:125216599-125216621 AAGTTCCAACAACAGATGAGTGG - Intergenic
937938053 2:127262078-127262100 AATGTCCATCAACAGATGTGTGG + Intronic
938073620 2:128320667-128320689 CAATTCCATCAGCAAATCTGCGG + Intergenic
938638241 2:133252159-133252181 TTGTTTAATCAGGAGATGTGGGG - Intronic
939205076 2:139091381-139091403 TAGTTCTATCAGCTGCTGAGAGG - Intergenic
939206944 2:139118879-139118901 TAGTTACATCAGGAGATGAAAGG - Intergenic
944554189 2:200871864-200871886 TACTTCCAACACCAAATGTGTGG + Intronic
945231463 2:207594608-207594630 AATGTCCATCAGCAGATGAGTGG - Intronic
947739162 2:232477069-232477091 TGTTGCCATCAGCAGATGAGAGG - Intergenic
1171363956 20:24611081-24611103 TAGTTCCAGCAGCAGAAATAAGG - Intronic
1175884190 20:62279609-62279631 GAGTTCCAACTGCAGACGTGAGG - Intronic
1176093749 20:63330207-63330229 TGGTCCCAGCAGCAGGTGTGGGG + Intronic
1178496968 21:33094954-33094976 GAGTCCCACCAGCAGCTGTGAGG + Intergenic
1178729981 21:35092663-35092685 TATTTCCATCAGAAAATTTGGGG + Intronic
1183581160 22:38727429-38727451 TAGTTCCAGCTGCAGCTGGGTGG + Intronic
1183991846 22:41602339-41602361 TAGATCCCTCAGCAGAGCTGTGG + Intronic
953515171 3:43583738-43583760 TAGGTGCAGCAGCAGCTGTGGGG - Intronic
955580830 3:60419610-60419632 CATTTCCATTAGCACATGTGTGG + Intronic
957732576 3:84159287-84159309 TAATGCCAGCAGCTGATGTGCGG + Intergenic
959898914 3:111638119-111638141 TAGATCCATTGGCAGTTGTGGGG - Exonic
960741517 3:120838893-120838915 TAGTTAAAAAAGCAGATGTGAGG + Intergenic
961034633 3:123634045-123634067 TAGTTCCATCAGCAGATGTGTGG - Intronic
961608022 3:128112071-128112093 TATTTCTATAAGCAGATCTGAGG + Intronic
963920864 3:150903380-150903402 CATTTTCATCAGCAGATGTATGG + Exonic
965853849 3:173064545-173064567 TAGTCCAACCTGCAGATGTGTGG - Intronic
966099998 3:176256814-176256836 TAGTTCCATCAGAAAAGCTGAGG - Intergenic
970369993 4:15396726-15396748 TTGTCCCATCAGCAGAGGAGAGG + Intronic
970751754 4:19372090-19372112 TATTTCTATCATCAGTTGTGTGG - Intergenic
972054686 4:34784876-34784898 TACTTCCATCAATAGATGAGTGG + Intergenic
973910514 4:55575293-55575315 GAGTTCCAAAAGCAGATTTGAGG + Intronic
978042204 4:104081322-104081344 TATGTCCATCAGCAGATGAATGG + Intergenic
979666602 4:123317493-123317515 TGCTCCCATCAGCAGATCTGAGG - Exonic
982717516 4:158824534-158824556 GAGCTCCAGCAGCAGAGGTGGGG - Intronic
982817985 4:159909671-159909693 TGTGTCCATCAGCAGATGAGTGG + Intergenic
985624555 5:978302-978324 TCTGTCCATCAGCAGATGTGTGG - Intergenic
985791287 5:1928744-1928766 TAATTTCATCAGTAGATGAGCGG + Intergenic
992193185 5:74314085-74314107 CAGATGAATCAGCAGATGTGTGG + Intergenic
992343876 5:75856184-75856206 AAGTTCCATCAACAGATGAAAGG - Intergenic
992770428 5:80042251-80042273 CAGTTCCTTCAGCAGATGCTAGG - Intronic
992981429 5:82177955-82177977 TAGTTTCCTCAGTAGATGTTAGG + Intronic
993640383 5:90396865-90396887 TGGTTGAATCTGCAGATGTGAGG - Intronic
995543619 5:113207897-113207919 TACTCTCATCAGCAGAGGTGGGG + Intronic
997021091 5:130002444-130002466 CAGTTCCCTCTGCAGATGAGAGG + Intronic
1001803317 5:174562031-174562053 GCGTTCCAACAGCAGATGGGAGG + Intergenic
1006593380 6:35174440-35174462 AAGGTCCATCAACAGATGTATGG + Intergenic
1008456900 6:51721658-51721680 AAGTTCCAGTAGCAGATATGGGG - Intronic
1009891087 6:69683805-69683827 TAGAACCATCAGCTGATGAGAGG + Intronic
1013279080 6:108618010-108618032 GTGTTCCAACAGCAGATGGGAGG - Intronic
1013729470 6:113147169-113147191 TAGATCCAGTAGCAGGTGTGAGG + Intergenic
1018657734 6:166055613-166055635 TGTTTCCATCAGCAGAAGTAGGG - Intergenic
1021054586 7:16031882-16031904 TAGTTCCAAAAGCAAATATGAGG + Intergenic
1021693995 7:23258759-23258781 TAGTTCCATCAGAAGTTATAAGG - Intronic
1023788875 7:43736307-43736329 TAGTCCCAGCTACAGATGTGAGG + Intergenic
1026553664 7:71388351-71388373 GATTTCCTTCAGCAGGTGTGTGG - Exonic
1027686249 7:81281634-81281656 TAGTTACAACTACAGATGTGTGG + Intergenic
1028796269 7:94907686-94907708 TAATCCCATCAGCCGAGGTGAGG + Exonic
1030346185 7:108435446-108435468 TAGTTCCAAAAGCAGAGGAGAGG + Intronic
1030949901 7:115777180-115777202 TAATTCCATCCGAAGAGGTGTGG + Intergenic
1031772720 7:125865230-125865252 AAGTTCCATTAGGAGATCTGTGG - Intergenic
1033973801 7:147074369-147074391 CAGTGCCATATGCAGATGTGAGG - Intronic
1034866887 7:154649592-154649614 TGGTTCCACCTGCAGCTGTGGGG + Intronic
1035621512 8:1038797-1038819 TGTTTCCATGAGCAAATGTGGGG - Intergenic
1035936306 8:3844610-3844632 TCCTTCCATCTGCAGATGGGAGG - Intronic
1037463258 8:19134728-19134750 AAGTTCCAACAGCAGATACGGGG - Intergenic
1037551023 8:19971517-19971539 TGGATTCATCAGCAGCTGTGTGG - Intergenic
1040631197 8:49213769-49213791 TGGGTCCATCAGCAAATGTATGG + Intergenic
1041078877 8:54195574-54195596 AAGTTCCATCAACAGATGAATGG - Intergenic
1043696804 8:83230152-83230174 TATGTCCATCAACAGATGAGTGG - Intergenic
1043968334 8:86504253-86504275 TAGATCCTCCAGCAGTTGTGGGG + Intronic
1044749653 8:95403618-95403640 TTCTGCCATCAGCAGATGTGGGG + Intergenic
1046142269 8:110109167-110109189 TATGTCCATCAGCAGATGAATGG - Intergenic
1052433319 9:28394636-28394658 TAAATCCATCAGAAGATGTATGG + Intronic
1052573456 9:30260370-30260392 TATGTCCATCAGCAGATGAATGG - Intergenic
1052974094 9:34399175-34399197 TGGATCCACCAGCACATGTGGGG + Exonic
1053310455 9:37014989-37015011 CAGTTCCATCAACAGGTGAGGGG - Exonic
1054983659 9:71236423-71236445 TATTTCCTTCTGCAAATGTGGGG - Intronic
1059374088 9:113868765-113868787 TATCTCCATTAGCAGATGAGGGG - Intergenic
1061018924 9:128001326-128001348 CAGTTCCATCAGGATATGTTTGG + Intergenic
1188543039 X:31270513-31270535 TGGTGACAACAGCAGATGTGAGG + Intronic
1190532834 X:51396577-51396599 TAGTTTCTGCAGCAGGTGTGGGG + Intergenic
1190805406 X:53831254-53831276 AATGTCCATCAGCAGATGAGTGG - Intergenic
1191903713 X:66065064-66065086 TGCTTCCTTCAGCAGATCTGTGG + Intergenic
1192386416 X:70676132-70676154 AAGTTCCATCAACAAATGAGTGG - Intronic
1195362735 X:104100821-104100843 TATTTCCATGTCCAGATGTGTGG + Exonic
1195619733 X:106941114-106941136 TAGATCAATCAGCAGATATTGGG - Exonic
1196387905 X:115178186-115178208 TACTTGCATCAGCAGAAGTCCGG - Intronic
1198449111 X:136748682-136748704 TATTTCCATCACCACATTTGGGG - Intronic