ID: 961036078

View in Genome Browser
Species Human (GRCh38)
Location 3:123642521-123642543
Sequence CTGTGCCAGTGACAGCTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 239}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961036070_961036078 29 Left 961036070 3:123642469-123642491 CCACGTGACACACACACTCACTT 0: 1
1: 0
2: 4
3: 39
4: 355
Right 961036078 3:123642521-123642543 CTGTGCCAGTGACAGCTGGAGGG 0: 1
1: 0
2: 1
3: 17
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961036078 Original CRISPR CTGTGCCAGTGACAGCTGGA GGG Intronic
901822823 1:11841186-11841208 CTGAGCCAGTGACCACTGAAAGG + Exonic
902058603 1:13622803-13622825 ATGTGCCAGTTACTGCTGCAGGG - Intergenic
903402571 1:23066517-23066539 CTCTTCCAGTGTCAACTGGATGG - Intronic
905435970 1:37955428-37955450 CTGTGCCCCTTGCAGCTGGATGG + Intergenic
905794637 1:40808648-40808670 CTGTCCCTGTGGAAGCTGGAGGG + Intronic
909094860 1:71274139-71274161 CTGTGACAGTGACATCAGAAGGG + Intergenic
910992216 1:93067998-93068020 CTGTGCCAGAAACAGTTGCAAGG + Intergenic
912903906 1:113683154-113683176 CTGTGCCCATGACTGCTGGGTGG - Exonic
913047599 1:115087844-115087866 CCTTTCCAGTGATAGCTGGAAGG - Intronic
913266640 1:117051623-117051645 CTGTGAGAGTGAAAGCAGGAAGG + Intergenic
914220361 1:145676073-145676095 ATGTGCCAGGGACTGCTAGAGGG + Intronic
914472940 1:147998945-147998967 ATGTGCCAGGGACTGCTAGAGGG + Intergenic
914996193 1:152545471-152545493 CTGTGCCAGTCTCAGATGAATGG - Intronic
915080811 1:153350441-153350463 CTGTGAAATTCACAGCTGGAGGG - Intergenic
917208158 1:172600083-172600105 CTGTGCCTGTAGCAACTGGATGG - Exonic
917333022 1:173901939-173901961 CAGTGCCAGGGACAGGTAGATGG - Exonic
920370734 1:205477746-205477768 CTGGACCAGGGACAGCTAGAGGG - Intergenic
922022808 1:221721443-221721465 CTGTGTGAGTTACAGCTGGATGG - Intronic
922128988 1:222758083-222758105 CTGTCCCACAGCCAGCTGGATGG - Intergenic
922796052 1:228340429-228340451 CTGTGTCCCTGAGAGCTGGAGGG - Intronic
924784625 1:247183802-247183824 CTGCCCCAGTGACAGTGGGATGG - Intergenic
1067159378 10:43810422-43810444 CTGAGTCAGTCACAGGTGGAAGG + Intergenic
1068608654 10:59034108-59034130 CTGAGCCCTTGGCAGCTGGAAGG + Intergenic
1069663393 10:70138707-70138729 ATGTGCCAGTCAGAGCTGGGTGG - Exonic
1071547049 10:86536856-86536878 CTGTGCCAGTTTCTGCCGGATGG - Intergenic
1073267233 10:102235114-102235136 CTGTGACAGGGACAGCTGCCGGG + Intronic
1075021710 10:118956970-118956992 CTTTTCCACTGACACCTGGAGGG - Intergenic
1075058541 10:119238211-119238233 CTGTGCTGGTGACAGCCGGGAGG + Intronic
1076531278 10:131146958-131146980 CTGAGGCAGTGACAGCTGGTGGG - Intronic
1076550641 10:131275809-131275831 CTGTGCCAGCATCAGCTGGTGGG + Intronic
1076822407 10:132945972-132945994 CTGTGAGAGTGTCAGCAGGAGGG + Intergenic
1077196086 11:1280867-1280889 CTGTGCCAGGGACAGCTGAAGGG + Intronic
1078333810 11:10448174-10448196 CAGTGGCAGTGAGAGGTGGAGGG - Intronic
1080430061 11:32189717-32189739 ATGTGCCAGTGGCACCTGGTGGG + Intergenic
1080819414 11:35791052-35791074 CTGGGCCAGGGACAGTGGGAGGG - Intronic
1081248407 11:40798310-40798332 CTTTCAGAGTGACAGCTGGATGG - Intronic
1083271628 11:61575824-61575846 GTGTGCGGGTGGCAGCTGGATGG - Intronic
1083622708 11:64056908-64056930 CTGTGGCAGTGTCAGCCCGATGG - Intronic
1084703809 11:70804351-70804373 CGGTGCCACTGGCAGCAGGAAGG + Intronic
1086193197 11:84105283-84105305 CTCTGCCATTGACATCTGCATGG + Intronic
1087428205 11:98016965-98016987 CTGTGTCAGTGGTAGCTTGATGG - Intergenic
1088151045 11:106745829-106745851 CTGTGCTAATGACAGCCAGAGGG + Intronic
1090839463 11:130475728-130475750 CTGTGCCAGTGACCACTGTGGGG + Exonic
1091236839 11:134027797-134027819 CTGTGCCAGAGACAGCAGAAGGG + Intergenic
1092297238 12:7210212-7210234 CTGCCCCAGTGACAGTGGGACGG + Exonic
1093423708 12:19004002-19004024 CTGTGCCATTAAATGCTGGAAGG + Intergenic
1093916097 12:24803818-24803840 CTCTGCCAATGACAGTTGGTTGG - Intergenic
1095189397 12:39238973-39238995 CTTTGCCAATGACAGTTTGAGGG - Intergenic
1097020074 12:56014399-56014421 CTGAGCCAGTGCTAGCTGAATGG + Intronic
1098178146 12:67815299-67815321 CTGTGCCCTTGACTTCTGGAAGG + Intergenic
1098854603 12:75638046-75638068 CTGTGGCAGAAACAGCTAGATGG - Intergenic
1099512934 12:83559675-83559697 CTGTGACAGTGAGATCTGAATGG - Intergenic
1099785334 12:87255131-87255153 CAGTGCCTGTTAGAGCTGGAAGG + Intergenic
1102996998 12:117359123-117359145 CTCTGCCACTGACAGCTCCAAGG - Intronic
1104953127 12:132451321-132451343 GCGGGCCAGTGACAGCAGGAGGG - Intergenic
1107372839 13:39771368-39771390 GTGTCCCAGAGACACCTGGAGGG + Intronic
1109173681 13:59127932-59127954 ATCTGACAGTGACAGCTGTATGG - Intergenic
1114550083 14:23527680-23527702 CTGTGCCAGGAACAGCTGGTGGG - Exonic
1117468720 14:56020456-56020478 CTGTGGCAGTGAAATCTGGCTGG - Intergenic
1117830045 14:59741186-59741208 CTGTTCCAGGAGCAGCTGGAAGG - Intronic
1118122995 14:62867140-62867162 CTCTGCCAGTGAGAGGTGGGAGG - Intronic
1121421473 14:93818717-93818739 CTATGCCAGTGACACCCAGATGG + Intergenic
1123133542 14:106007330-106007352 CTGTTTCAGTCACAGCAGGATGG - Intergenic
1123435578 15:20251677-20251699 CTGTGACAGTGACAGAATGAGGG - Intergenic
1126100630 15:45116315-45116337 GTGTGTCAGGGATAGCTGGAGGG + Intronic
1129509739 15:76112586-76112608 CTGTGCTGGGGACAGCTGGGTGG - Intronic
1129616889 15:77105836-77105858 ATGGGCCACTGACAGTTGGATGG - Exonic
1130690836 15:86080107-86080129 CTGGGCCAGTGACTGCCAGAGGG - Intergenic
1131832235 15:96361282-96361304 CTGTGACAGTGGCACCTGGAAGG - Intergenic
1132149950 15:99452223-99452245 CAGAGCCAGTGACTGCTGGAGGG + Intergenic
1132385655 15:101398163-101398185 CTGTTCCAGTGACAGCCAGGTGG - Intronic
1133019836 16:2962559-2962581 CAGTGCCAGGGACAGAGGGACGG + Intergenic
1134770386 16:16804076-16804098 ATGAGACAGAGACAGCTGGATGG - Intergenic
1136186773 16:28593040-28593062 CTGTGCCTGAGTCAGCTGCACGG - Intronic
1137564407 16:49524432-49524454 GTGTGGCAGTGACAGATGGGTGG + Intronic
1137958949 16:52862251-52862273 CTTTGCCAGTGCAGGCTGGAAGG + Intergenic
1138337897 16:56267359-56267381 CCGTGCCAGTGCCAGCTCCAGGG + Intronic
1138729770 16:59182283-59182305 CTGTGCCAGTGGCAGTAGGGTGG + Intergenic
1139504715 16:67393161-67393183 CTGTCCCAGTGGGAGCGGGACGG - Intronic
1139795838 16:69482253-69482275 ATGTCCCAGTGAACGCTGGAAGG - Intergenic
1140225825 16:73076003-73076025 CTCTGCCACTAACAGCTGGATGG + Intergenic
1140706741 16:77637725-77637747 CTGAGCCCGTGACAGCATGAAGG - Intergenic
1141307909 16:82883819-82883841 CTGTGCCTGGGACAGCTTTAGGG + Intronic
1142184927 16:88690311-88690333 CAGTGCCAGTGCCAGGTGGCTGG + Intergenic
1143610992 17:8017250-8017272 CTGTGCACCTGACAGCTGGGTGG + Intronic
1143637443 17:8174247-8174269 CCATTTCAGTGACAGCTGGAAGG + Exonic
1144253035 17:13438709-13438731 CTTTTCCAGTCAAAGCTGGAGGG - Intergenic
1144675419 17:17158605-17158627 CTGAGCCAGGGCCTGCTGGATGG - Exonic
1145390660 17:22453393-22453415 CTGGGCCAGGGACAGCTGCCGGG + Intergenic
1147319642 17:39637975-39637997 CTGTCCCAATGGCCGCTGGATGG - Intronic
1148353984 17:46962672-46962694 CCTTGGCAGGGACAGCTGGAAGG - Intronic
1149661159 17:58334644-58334666 TTGTTCCAGTCACAGGTGGACGG - Intergenic
1150157831 17:62869017-62869039 CTGTGCCTGTGGCTGCTGGTGGG - Intergenic
1150234959 17:63585582-63585604 CTGTGCCCCTGAAATCTGGATGG + Intronic
1150587373 17:66531212-66531234 CACAGCCAGAGACAGCTGGAGGG + Intronic
1152001927 17:77651952-77651974 ATGTGCAAGTGACAGATGGGTGG - Intergenic
1152844856 17:82593484-82593506 CTGTGCCAGGATCAGCTGGCTGG + Intronic
1153660961 18:7325806-7325828 CTGTGCCAGGGACAGAGGAAGGG + Intergenic
1154359527 18:13647829-13647851 TTGTTCCAGTGACAGTTGGAAGG + Exonic
1156263728 18:35467691-35467713 CTGTGCAAGTGGCAGCTGCCTGG - Intronic
1157577386 18:48752676-48752698 CTGTGCCACTCACAGTTGCATGG - Intronic
1158009243 18:52709509-52709531 ATCTCCCAGTGACCGCTGGAAGG + Intronic
1161063460 19:2226623-2226645 CTGAGCAAGAGGCAGCTGGACGG + Exonic
1161646063 19:5454174-5454196 CTCAGCCAGTGACAGATGGGAGG - Intergenic
1162945255 19:14039528-14039550 CTGTGGCAGTGGCAGCCGGACGG + Exonic
1163493765 19:17632723-17632745 CTGTAGCACTGACAGCTAGAAGG - Intronic
1164881314 19:31734876-31734898 CAGTGCCACTTCCAGCTGGATGG + Intergenic
1165434016 19:35787102-35787124 CAGAGTCAGTGACAGCTGGCGGG - Intronic
1166783264 19:45353111-45353133 CCGGGCCACTGACAGCAGGATGG + Exonic
926300387 2:11597811-11597833 CTGCGCTACTGCCAGCTGGAAGG - Exonic
926696481 2:15772720-15772742 GTGTGGCAGAGAGAGCTGGAGGG - Intergenic
927528040 2:23766604-23766626 CTGCACCAGGGAAAGCTGGATGG + Intronic
929600238 2:43200044-43200066 CTTTCCCAGCCACAGCTGGAGGG + Intergenic
932740613 2:74287993-74288015 CTGAGCCAGTGGCAGCAGGCCGG - Intronic
933853624 2:86392656-86392678 CAGTTACAGTGACAGCTGGGAGG - Intergenic
933912656 2:86956949-86956971 CTGTGTCAGTGGCAAGTGGATGG + Intronic
934010338 2:87812941-87812963 CTGTGTCAGTGGCAAGTGGATGG - Intronic
935773905 2:106453661-106453683 CTGTGTCAGTGGCAAGTGGATGG - Intronic
935906158 2:107842252-107842274 CTGTGTCAGTGGCAAGTGGATGG + Intronic
935992627 2:108734775-108734797 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936127946 2:109807417-109807439 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936216751 2:110564068-110564090 CTGTGTCAGTGGCAAGTGGATGG - Intronic
936425890 2:112418649-112418671 CTGTGTCAGTGGCAAGTGGATGG - Intronic
938071679 2:128311708-128311730 CTGCCCCAGTGAATGCTGGAGGG - Intronic
940238554 2:151537880-151537902 CTGTGTCAGTGACTGCTCGGTGG + Exonic
944436579 2:199696260-199696282 ATGTGCCAGTGGCAGCAGGGTGG - Intergenic
946008451 2:216545273-216545295 GTGTGCCAGGGAGAGCTGGTTGG + Intronic
946691669 2:222312812-222312834 CATCGCCAGTGACAGCTGAAAGG - Intergenic
947462436 2:230314986-230315008 ATGTTAGAGTGACAGCTGGAAGG + Intergenic
947541732 2:230984679-230984701 CTTCGGCAGTGAGAGCTGGAGGG - Intergenic
948127993 2:235578904-235578926 CTGTGTGACTGACAGCTAGAGGG - Intronic
948384791 2:237574749-237574771 CTGTGCCTGTTCCACCTGGACGG - Exonic
948422541 2:237869204-237869226 CCCTGCCAGTCACAGCTGCATGG + Intronic
948613172 2:239182274-239182296 CTGTGCAGGTGACAGCCAGAGGG - Intronic
1171312944 20:24160322-24160344 CTGGGACAGTCATAGCTGGAGGG + Intergenic
1172891644 20:38270189-38270211 CTGTGCCAGAGACAGCGTGCTGG + Intronic
1174803418 20:53584620-53584642 ATGTGGCAGTGACAACTTGAAGG - Intronic
1175184687 20:57172177-57172199 CTGTGCCAGTATCCCCTGGAAGG - Intronic
1175363006 20:58429509-58429531 CTGTGCTGGTGACATCTGTAAGG + Intronic
1175803106 20:61812318-61812340 CAGGGCCAGTGACGGCTTGAGGG - Intronic
1176271605 20:64238208-64238230 CTGTGCCCCTAACAGCTAGAGGG + Intronic
1180561254 22:16616012-16616034 ATGTGGCAGTGACAACTTGAAGG + Intergenic
1180707711 22:17819249-17819271 CTGTTCTAATAACAGCTGGAAGG - Intronic
1181675209 22:24446820-24446842 CTGTTCCACTGACTGCTGAACGG + Intergenic
1181726786 22:24816966-24816988 TTGTGCCAGTCACAGTGGGATGG + Intronic
1182483677 22:30626575-30626597 CTGTTCCAGGGACATCAGGAGGG - Exonic
1182557809 22:31138476-31138498 CTGTGCCACTACCAGCTGGGTGG + Intronic
1183107157 22:35622771-35622793 CTGTCCAGGTGACAGGTGGATGG - Intronic
1183356121 22:37360581-37360603 CTGTCCCTGTGCCAGCCGGATGG - Intergenic
1183412173 22:37661231-37661253 CTATGGGAGTGACAGCAGGATGG - Intronic
1183438066 22:37806764-37806786 GGGTCCAAGTGACAGCTGGATGG + Exonic
1183534405 22:38388993-38389015 ATGTGGCAGTGACAACTTGAAGG - Intronic
1183628050 22:39016736-39016758 CTGGGCCAGTGACTGCGGGCTGG + Intronic
1183947098 22:41332661-41332683 CTGAGCCAGGGAGAGCAGGATGG - Intronic
1184035821 22:41917649-41917671 CTGGGGCAGTGTCAGCTGAATGG - Intergenic
1184334537 22:43845421-43845443 CTGAGCCTCTGTCAGCTGGAGGG - Intronic
1185195433 22:49466511-49466533 CTGCGGCAGTGAGAGGTGGAAGG + Intronic
950268525 3:11593890-11593912 CTGTGGCAAACACAGCTGGATGG + Intronic
950463401 3:13138903-13138925 CTGTGCCATGAACATCTGGAGGG - Intergenic
950542128 3:13618979-13619001 CTGCGGCAGTGGCAGCGGGATGG - Exonic
952400005 3:32954587-32954609 CTGAGCCAGTGTCAGGAGGAAGG + Exonic
952953964 3:38545201-38545223 CTGTGACAGGGCCACCTGGAGGG + Intergenic
953157571 3:40388460-40388482 CTGTGCCAGCAACATTTGGATGG - Intronic
953167959 3:40482144-40482166 CAGTGCCAGGGGTAGCTGGATGG + Intronic
953378763 3:42450605-42450627 CTATGCCAGGGACAGTTTGAGGG - Intergenic
955169379 3:56548539-56548561 CTGTGCCATTGACAGAATGAAGG + Intergenic
958784374 3:98581613-98581635 CTGTGCCAGTTCCAGCTGATGGG - Intronic
959943814 3:112106732-112106754 CTGTGGCAGTGACACATGGCAGG - Intronic
960190200 3:114695064-114695086 ATGTGCCAGACACAACTGGATGG + Intronic
961036078 3:123642521-123642543 CTGTGCCAGTGACAGCTGGAGGG + Intronic
961165763 3:124762731-124762753 CTCTGTCAGTAAAAGCTGGAAGG + Exonic
961432918 3:126895950-126895972 GTGTGCTAGTGAGAGCTGGGAGG + Intronic
961676814 3:128572654-128572676 CTCAGCCAGTGCCAGCTGGGTGG - Exonic
964767964 3:160196985-160197007 CTGTGCCAGGGACTGCTGCTGGG - Intergenic
968983996 4:3865566-3865588 CTGTGGCTGTGACAGCTGGGTGG + Intergenic
969090539 4:4690766-4690788 CTCTGGCAGTGGCAGCTGGTGGG + Intergenic
969408706 4:7013637-7013659 GTGTGCCTCTGTCAGCTGGAGGG + Intronic
969681113 4:8644087-8644109 CTCTGCAAGTGCCACCTGGACGG + Intergenic
969848318 4:9937039-9937061 CTGTGCCCCTGAGAGCTGGGAGG - Intronic
972641264 4:40927291-40927313 CTGAGACAGAGACAGCAGGATGG + Intronic
973333502 4:48933367-48933389 AGGTGCCACTGACTGCTGGAGGG - Intergenic
976835704 4:89370702-89370724 ATGTGCCAGTTACTGTTGGAGGG - Intergenic
977871411 4:102094690-102094712 CAGTGCCACTGACAGCTGTGAGG + Intergenic
980836422 4:138199022-138199044 CTGTATCCCTGACAGCTGGAAGG - Intronic
981038327 4:140195381-140195403 CTGTACCAGGGACAGGAGGAGGG + Intergenic
983457695 4:167985656-167985678 CAGTGGCAGTGACAGTTGGCTGG + Intergenic
985654340 5:1122111-1122133 CTGTTCCCTTGAGAGCTGGAGGG - Intergenic
985805413 5:2039364-2039386 CTGAGCCAGCGCCAGCAGGAGGG + Intergenic
987317777 5:16740186-16740208 CTGAGGGAGTGACAGCTGGGAGG + Intronic
990350246 5:54908816-54908838 TTGTGCCAGTGCCCACTGGATGG - Intergenic
995032624 5:107496568-107496590 CTGTGTCAGTGAGAGCAGGAAGG - Intronic
995354340 5:111221671-111221693 TTGTCCCACTGAAAGCTGGAAGG - Intergenic
997297059 5:132775063-132775085 CTATGCCAGCTTCAGCTGGAGGG - Intronic
998159587 5:139805935-139805957 CTCTCCCTGTGGCAGCTGGAGGG - Intronic
1002303390 5:178269988-178270010 CTGTGCCTGTGCCTGCTGGGAGG + Intronic
1002679674 5:180950979-180951001 CTGTGCCAGAGCCAGAGGGAAGG + Intergenic
1012594451 6:101023631-101023653 GGGTGCCAGTGACAGCAGGTGGG - Intergenic
1012914726 6:105157192-105157214 CTGTTCCAGGAGCAGCTGGAAGG - Intergenic
1012972491 6:105746352-105746374 TTGTGCCAGTGACAGCTTACTGG - Intergenic
1014553878 6:122821974-122821996 CTGTGCCAGTGGCAGATAGAGGG + Intergenic
1017749691 6:157479809-157479831 CTGGCCCAGAGAGAGCTGGAAGG + Intronic
1017882750 6:158573092-158573114 CTGTGGCAGTGACCCCTGGGGGG + Intronic
1018576733 6:165267313-165267335 CTGTGTCACTGACTCCTGGATGG - Intergenic
1019033587 6:169034777-169034799 CTATGCCAGTGTCAGCTTTAAGG + Intergenic
1019289134 7:241475-241497 CTGTGCCAGGGAAAGATCGATGG + Intronic
1019556392 7:1633591-1633613 CTGAGGCTGAGACAGCTGGAAGG + Intergenic
1019645960 7:2129107-2129129 CAGTCCCAGAGCCAGCTGGAAGG + Intronic
1019925997 7:4192160-4192182 CTGTGTCAGTTACAGATGGAAGG + Intronic
1022630449 7:32079619-32079641 CTTTGGCAGGGACAGCTGGAAGG + Intronic
1023931083 7:44707132-44707154 CTGTGCCAGGGACTGCTGCCAGG - Intronic
1024141529 7:46467405-46467427 CTGTGCTGGTGACCACTGGATGG - Intergenic
1026864075 7:73811789-73811811 CTGTGCTAGTGGCAGGTGGAGGG - Intronic
1027820720 7:83040564-83040586 CTGGGGAAGAGACAGCTGGAAGG - Intronic
1030934815 7:115572344-115572366 CTCTGCCAATGAGGGCTGGATGG + Intergenic
1032781589 7:135168785-135168807 CAGTGCCAGTGGCAGCAGCAAGG - Exonic
1032906272 7:136370977-136370999 CTGAGCTAGTGACAGAAGGATGG - Intergenic
1032991159 7:137396233-137396255 CTGTGTGAGTGGCAGGTGGAAGG + Intronic
1034503671 7:151468378-151468400 CCGTGCCAGCGACAGTTGGTAGG - Intronic
1034858635 7:154577335-154577357 CTGTGCAGGTGGGAGCTGGAAGG + Intronic
1035055264 7:156031074-156031096 CTGGCCCAGTGGAAGCTGGAAGG - Intergenic
1035282522 7:157786984-157787006 CTGAGCCTGGGACAGCTTGAGGG + Intronic
1037846523 8:22287573-22287595 CGTTGCCGGTGACAGCTTGATGG - Exonic
1039955907 8:42207096-42207118 ACGTGCCTGTGACAGCTGGGAGG - Intronic
1042962224 8:74315680-74315702 CTGCGCCAGTGTGCGCTGGATGG - Intronic
1045299838 8:100901540-100901562 GTGTTCCAGTGTGAGCTGGAAGG + Intergenic
1046062568 8:109156992-109157014 CTGTGGCAGAGACAGCTAAATGG + Intergenic
1047058765 8:121198072-121198094 CTGTACCAATGACATCTGAATGG + Intergenic
1047297779 8:123586604-123586626 CTGAGGGAGTGACATCTGGATGG - Intergenic
1049612503 8:143562057-143562079 CTGTGCCAGCTGCTGCTGGAGGG + Exonic
1050131988 9:2422432-2422454 CTGTGTCAGGGAGGGCTGGAAGG + Intergenic
1050425896 9:5512359-5512381 GTGTGTTAGAGACAGCTGGAAGG - Intronic
1051403723 9:16711123-16711145 CTATACCAGTGACAGCTGTGTGG + Intronic
1051982696 9:23043036-23043058 CTGTGCCATTGACAGAGGCATGG - Intergenic
1052203696 9:25812598-25812620 CTGTGGGAGTGACAGCAAGAAGG - Intergenic
1052866217 9:33466134-33466156 CTCTGCCAGGCGCAGCTGGAAGG + Exonic
1054715646 9:68555635-68555657 TTGGGCTAGTCACAGCTGGAAGG + Intergenic
1056767203 9:89452123-89452145 GTGTGCCAGAGGCAGCTGGATGG + Intronic
1057463314 9:95287474-95287496 CATTGCCTCTGACAGCTGGAAGG - Intronic
1057929944 9:99184701-99184723 CTGTGCCAGAGACAGGAGAAGGG + Intergenic
1058267307 9:102918696-102918718 CTGGGTGAGTGACAGCTGAATGG - Intergenic
1059023514 9:110600744-110600766 CTGTGTCTGAAACAGCTGGATGG + Intergenic
1060483049 9:124029210-124029232 CTGTGGCAGTGCATGCTGGAGGG + Intronic
1060888007 9:127169104-127169126 CTGTGCCATTCACAGCTGTGGGG - Intronic
1061951033 9:133935900-133935922 GTGTGTCAGGGACAGCTGGCTGG - Intronic
1062214160 9:135380041-135380063 CTGTGTCAGTGCCAGGTGGCAGG + Intergenic
1062673565 9:137725825-137725847 GTGTGCCAGGGCGAGCTGGAAGG - Intronic
1188468260 X:30507531-30507553 CTTTGATAGTGACAGCTGAATGG + Intergenic
1189319101 X:40076656-40076678 ATGGGCCATTGACAGCTGGTGGG - Intronic
1189965432 X:46367940-46367962 CCTTTCCAGTGACAGCTGGAAGG - Intergenic
1190093769 X:47462621-47462643 GTGAGCCAGGAACAGCTGGAAGG - Intronic
1190217240 X:48488123-48488145 CAGTGCCAGTGACTACTGGTGGG + Intergenic
1193291370 X:79777106-79777128 ATGTGCCAGTGGCAGCAGGGTGG + Intergenic
1194188665 X:90807792-90807814 CACTGGCAGGGACAGCTGGAGGG + Intergenic
1195676792 X:107512788-107512810 CTCTGCCAGTGACAGGTGAGTGG + Intergenic
1197825921 X:130590217-130590239 GTGTGCCTGTGACAGCTTGGGGG - Intergenic
1198677239 X:139144097-139144119 CAGTGCCAGTGAGAACAGGAAGG - Intronic
1200466731 Y:3528821-3528843 CTGTGGCTGTGGCAGCTGCAAGG + Intergenic
1200535249 Y:4389687-4389709 CACTGGCAGGGACAGCTGGAGGG + Intergenic