ID: 961037731

View in Genome Browser
Species Human (GRCh38)
Location 3:123654103-123654125
Sequence CTCCTGGGACAGCTTTCGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 100}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961037731_961037737 18 Left 961037731 3:123654103-123654125 CCCTGCGAAAGCTGTCCCAGGAG 0: 1
1: 0
2: 1
3: 5
4: 100
Right 961037737 3:123654144-123654166 GACTTGCACCATAGCTCTCAAGG 0: 1
1: 0
2: 1
3: 7
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961037731 Original CRISPR CTCCTGGGACAGCTTTCGCA GGG (reversed) Intronic
901771289 1:11531633-11531655 CTCCCGGGGCAGCTGTCCCACGG + Exonic
901780362 1:11590223-11590245 CCCCGGGCACAGCTTCCGCAAGG + Intergenic
901943027 1:12678375-12678397 CTCCTGGGGCAGCTGACACAGGG + Intergenic
902886287 1:19407331-19407353 CTCCTGGGACTGCTTTCTGGTGG - Intronic
903811819 1:26038910-26038932 CTCCTGGGCCAGCTCTGGAAGGG - Exonic
904367657 1:30025031-30025053 TTCCTGGGACAGCTCACTCAGGG + Intergenic
907497423 1:54854115-54854137 CTGCTCGTACAGCTTGCGCAGGG + Exonic
907509755 1:54949418-54949440 CTCCTGGGCCAGCATGTGCAGGG - Intergenic
910840166 1:91553640-91553662 CCCCTGGGACAGCCTTAACAGGG + Intergenic
913430832 1:118789037-118789059 TTCCTGGGACAGAGTTCTCAGGG + Intergenic
914898500 1:151697943-151697965 CTGCAGGGACAGGTTTCTCAGGG - Exonic
915250766 1:154586706-154586728 CTCCTGGGACAGCAGCAGCAGGG + Intronic
915924857 1:160009240-160009262 CTCCTTTTACAACTTTCGCAAGG - Intergenic
920004941 1:202826156-202826178 TTGCTGGGACATCTTTCGGAGGG + Exonic
920008219 1:202848961-202848983 TTCCTGGGCCGGCTTTCTCACGG - Intergenic
922564049 1:226589717-226589739 CTCCAGGAACAGCATGCGCAGGG + Intronic
1067807937 10:49406020-49406042 CTCCTGGGAGAGCCATTGCAGGG - Intergenic
1067851396 10:49756925-49756947 GTCCTGGGACAGCTTCTTCAGGG - Exonic
1072792350 10:98327387-98327409 ATCCTGGGAGAGCTTTGGGAGGG + Intergenic
1076451794 10:130561418-130561440 CTCCTGGGACCCCATTCTCAGGG + Intergenic
1076697643 10:132254796-132254818 CTCTTGAGACAGCCTTCGCGTGG - Intronic
1078579187 11:12525661-12525683 CTCCTGGCTCAGCATTAGCAAGG + Intronic
1079369904 11:19842665-19842687 CTCCAGGGACAGCTGGGGCAAGG - Intronic
1079481285 11:20883109-20883131 CTCTTGGAACAGATTTGGCAGGG + Intronic
1085333014 11:75668529-75668551 CTCCTAGGACAGCTCTCCCCGGG - Exonic
1088629492 11:111760968-111760990 CTCCTGGGAGATCTGTCTCAGGG + Exonic
1091097584 11:132838825-132838847 CTCCTGAGACAGGCTTCCCAGGG - Intronic
1091571619 12:1691422-1691444 CTCCTCCGACAGCGGTCGCAAGG - Intronic
1092188755 12:6501915-6501937 CTCCTGAAACAGCTTTGTCAAGG - Intronic
1092537371 12:9402848-9402870 CTCTTGGGACAACCATCGCAGGG + Intergenic
1095700891 12:45189969-45189991 CTCCTGTTACAGATTTGGCAAGG + Intergenic
1097284956 12:57870067-57870089 CTCCTGAGAAAGCTTTAGGAGGG + Intergenic
1097551916 12:61083484-61083506 CTCCTCTGACAGTTTTCTCAAGG - Intergenic
1098155874 12:67597932-67597954 CTCCTGGGTCAGCCTTGGGAGGG + Intergenic
1102146382 12:110658096-110658118 CTCCTGGGACCACTTTCCCTTGG + Intronic
1106138799 13:26993708-26993730 CTGCAGGGACAGCTTTAGCCAGG - Intergenic
1106203889 13:27570570-27570592 CTCCAGGGAATGCTCTCGCAAGG + Intronic
1113617469 13:111691251-111691273 CCCCTGGGACAGCTTGGCCAGGG + Intergenic
1113622999 13:111776511-111776533 CCCCTGGGACAGCTTGGCCAGGG + Intergenic
1113827046 13:113263712-113263734 CTCCTGGGTCATCTTTCACAAGG + Intronic
1117937146 14:60919341-60919363 CTTCTGTGTCAGCTGTCGCACGG + Intronic
1120594805 14:86420383-86420405 CTCCTGGGACAGGCTTGGCCTGG - Intergenic
1123147158 14:106142879-106142901 CTCCTGGGACTGGATTTGCAGGG + Intergenic
1133525622 16:6602595-6602617 CTCCTGGGAAAGCCTTCTCCTGG + Intronic
1133661800 16:7925631-7925653 CTCCTGAGACTGTTTTGGCAAGG - Intergenic
1134124961 16:11610205-11610227 CCCCTGGGACAGGTTTCTGAGGG - Intronic
1138505327 16:57475618-57475640 CACCTGGGACAGCATCCACAAGG + Exonic
1141713012 16:85710818-85710840 CTGCTGGGACACCTTTCCCAAGG - Intronic
1142274736 16:89112001-89112023 CTCCAGGCACAGCGTTCTCATGG - Intronic
1149548091 17:57519134-57519156 CTCCTGGGACTGCTCCCCCAAGG + Intronic
1151005498 17:70431487-70431509 CTCCTTGGACAGCAATCGCAAGG - Intergenic
1153699013 18:7673883-7673905 CTCCTGGCACTGCTTTCACCAGG - Intronic
1154251431 18:12748156-12748178 CTCCTGGTACAGCTGTGGCCGGG + Intergenic
1155931255 18:31711204-31711226 GTCCTGGGAGAGCTGTGGCAAGG - Intergenic
1157901200 18:51519645-51519667 CTCCAGGGCCATCTTTAGCAGGG - Intergenic
1160892560 19:1387023-1387045 CTCCTGGGAGAGCCTTCCCGAGG - Intronic
1163517655 19:17774740-17774762 ATCCTGGGCCAGCTTGGGCAGGG - Intronic
1163679848 19:18674845-18674867 CTCCTGGGACAGCTGGGGAATGG - Intergenic
1165090023 19:33381408-33381430 CTCCTGGGACAGCTTCTCCTGGG - Exonic
1166908643 19:46134310-46134332 CTCCAGGGACTGGTTTCCCAAGG + Intergenic
1168566003 19:57424351-57424373 CTCCTGGTGAAGCTTTCCCATGG + Intronic
925727403 2:6886960-6886982 CTCCTGTGACAGCTTTGACGAGG + Exonic
926748513 2:16180069-16180091 CTCCTGGGACATAATTCCCAAGG - Intergenic
1169028045 20:2386317-2386339 CTCCAGGGACAGATTCCACAGGG + Intronic
1171025142 20:21623587-21623609 TTCCTGGGATTGCTTTCTCATGG + Intergenic
1172787593 20:37479502-37479524 CTCCTGGGACAGCGCTCGATTGG - Intergenic
1178040400 21:28634352-28634374 CTACTGCGACAGATTTGGCAAGG - Intergenic
1179457176 21:41507853-41507875 CGCCTGGGACCCCTTGCGCACGG - Intronic
1179524065 21:41964315-41964337 CTCCTGGGACAGCTTCTGCAGGG - Intergenic
1180870297 22:19142739-19142761 CTCCCGGGACATCTTGCCCAAGG + Exonic
1180979464 22:19871889-19871911 CACCTGGGACTGCTCTAGCAGGG - Intergenic
1182418558 22:30237064-30237086 GTCCTGGGACTGGTTTCGAAAGG - Intergenic
1184710157 22:46245027-46245049 CTCCTGGGCCAGCCTGCGCCAGG - Exonic
1184884597 22:47334905-47334927 CCCCTGGGCCAGCTTTTCCAGGG + Intergenic
950166941 3:10808276-10808298 CTCCAGGGACACCATTCACATGG - Intergenic
950722019 3:14890223-14890245 CTCCTTGGAAGGCTTTCCCACGG + Intronic
952882968 3:37997085-37997107 CTCCTGGAACAGCTTTAATAAGG + Exonic
954146030 3:48634802-48634824 CTCTTGGGACCGCTATCTCAAGG + Intronic
954806744 3:53225042-53225064 CTCCTGGGCCAGTTGTCACATGG + Intronic
957319236 3:78607591-78607613 CTCCTGGGATAGCTAACGCTGGG + Intronic
961037731 3:123654103-123654125 CTCCTGGGACAGCTTTCGCAGGG - Intronic
961939950 3:130626701-130626723 TTCCTTGGCCAGCTTTCCCAAGG + Intronic
965373720 3:167895820-167895842 CTCCTGGAGCAGCTTTAACAGGG - Intergenic
966940133 3:184740987-184741009 CACCTGGGAGAGCTGTCCCAGGG + Intergenic
967819294 3:193826264-193826286 CACCTGGGACAGCTCTGACAAGG + Intergenic
968818132 4:2832275-2832297 CTCCTCGGGCAGCTTTCACACGG - Intronic
986686328 5:10278336-10278358 CTCCTGGGACCACCTTCCCATGG + Intronic
991900214 5:71453191-71453213 TTCCTGAGACATCTTTAGCAGGG + Intergenic
997751920 5:136354953-136354975 CTCCTGGGACACGTTTTTCAGGG - Intronic
999074273 5:148780191-148780213 CTCCTGGGAGCTCTTTCCCAGGG - Intergenic
999432211 5:151534350-151534372 CTCCTGGGTCACCTTGGGCAAGG - Intronic
1002305120 5:178278646-178278668 CTCCTGGGCCAGCCTCCGCCAGG + Intronic
1002347496 5:178558011-178558033 TTCCTGGGACAGCATCAGCACGG + Intronic
1002928568 6:1619019-1619041 CTCCGGGGACAGGCCTCGCAGGG - Intergenic
1004485580 6:16063313-16063335 CACCTGGCACAGCTTTGTCATGG + Intergenic
1011960940 6:93089172-93089194 CTCCCAGGACAGCTTTTGAAGGG + Intergenic
1012752895 6:103185016-103185038 CACCTGGGTCACCTTTGGCAGGG + Intergenic
1014272223 6:119348631-119348653 CTCCTCGGGCAGCTTCTGCAGGG + Exonic
1022113665 7:27245791-27245813 CTCCGGGGACAGTGTTCGCAGGG - Intronic
1033359033 7:140624631-140624653 CTCCTGTGACAGCTTCTCCATGG - Intronic
1034305553 7:150042513-150042535 CTCTTGGGACCACTATCGCAGGG - Intergenic
1042898512 8:73696239-73696261 TTCCTGGGAAAGCCTTCCCAAGG + Intronic
1056720450 9:89066816-89066838 CTCCTTGGAGAGCTTTTGTAGGG - Intronic
1060733485 9:126051947-126051969 CACCTGGGACACATCTCGCAGGG + Intergenic
1062591799 9:137277772-137277794 CTCCTGGGCCAGCTTCGGCCTGG - Exonic
1189674160 X:43443885-43443907 TTCCTGGGACAGAGTTCCCAGGG - Intergenic
1194908434 X:99608548-99608570 ATCTTGGGATAGCTTTCTCATGG - Intergenic