ID: 961042316

View in Genome Browser
Species Human (GRCh38)
Location 3:123686228-123686250
Sequence GTGTCCCCAAAGAAGTGTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 124}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961042308_961042316 2 Left 961042308 3:123686203-123686225 CCCCCAAGGCTGAAGTCCTTTGC 0: 1
1: 0
2: 1
3: 14
4: 208
Right 961042316 3:123686228-123686250 GTGTCCCCAAAGAAGTGTGGGGG 0: 1
1: 0
2: 0
3: 18
4: 124
961042310_961042316 0 Left 961042310 3:123686205-123686227 CCCAAGGCTGAAGTCCTTTGCTT 0: 1
1: 0
2: 0
3: 9
4: 214
Right 961042316 3:123686228-123686250 GTGTCCCCAAAGAAGTGTGGGGG 0: 1
1: 0
2: 0
3: 18
4: 124
961042306_961042316 19 Left 961042306 3:123686186-123686208 CCATTTCTAGATCTAGGCCCCCA 0: 1
1: 0
2: 1
3: 11
4: 118
Right 961042316 3:123686228-123686250 GTGTCCCCAAAGAAGTGTGGGGG 0: 1
1: 0
2: 0
3: 18
4: 124
961042309_961042316 1 Left 961042309 3:123686204-123686226 CCCCAAGGCTGAAGTCCTTTGCT 0: 1
1: 0
2: 2
3: 10
4: 173
Right 961042316 3:123686228-123686250 GTGTCCCCAAAGAAGTGTGGGGG 0: 1
1: 0
2: 0
3: 18
4: 124
961042311_961042316 -1 Left 961042311 3:123686206-123686228 CCAAGGCTGAAGTCCTTTGCTTG 0: 1
1: 0
2: 0
3: 16
4: 289
Right 961042316 3:123686228-123686250 GTGTCCCCAAAGAAGTGTGGGGG 0: 1
1: 0
2: 0
3: 18
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961042316 Original CRISPR GTGTCCCCAAAGAAGTGTGG GGG Intronic
900175747 1:1290697-1290719 GAGTCCCCAAAGTGGTGGGGTGG + Intronic
901773640 1:11544180-11544202 ATTTCCCCAAAAAAGTGTGTTGG + Intergenic
907983546 1:59508178-59508200 GTGTTCCCAGAGAACTGTGGAGG - Intronic
915648487 1:157290715-157290737 GGGTTCCCTAAGAAGTGTTGTGG + Intergenic
918681649 1:187362681-187362703 GTGTTGCCAAAGAAGTGGGCTGG + Intergenic
924722791 1:246638800-246638822 GTGTCCACACAGAAGTGTGCAGG + Intronic
1065997436 10:31071884-31071906 GTGTTCCCAAAGAAGTTTCTGGG + Intergenic
1066136055 10:32446973-32446995 CTCTCCCCAAAAAAGTGTGAGGG - Intronic
1067073032 10:43150803-43150825 GAGTCCCCAAAGAAGGGGGAAGG - Intronic
1068945327 10:62723777-62723799 GTGGCCCAGTAGAAGTGTGGTGG + Intergenic
1070708395 10:78658098-78658120 GTGTCACCATAGAAGTGAGGAGG + Intergenic
1070802757 10:79253255-79253277 GTGTCCACTAGGACGTGTGGGGG + Intronic
1073186893 10:101620429-101620451 CTGTCCCCAGAGAAGCTTGGAGG - Intronic
1073895866 10:108156740-108156762 GTTTCCTAAAAGAAGAGTGGAGG + Intergenic
1080742477 11:35079293-35079315 TTGACCCCAAGGAAGAGTGGAGG - Intergenic
1081343340 11:41954100-41954122 CTGTCTCCAAAGAAGACTGGTGG - Intergenic
1081777087 11:45683056-45683078 GGCTGCCCAAAGCAGTGTGGGGG - Intergenic
1082923769 11:58524104-58524126 CTGTCCCCAAAATATTGTGGAGG - Intergenic
1083419111 11:62543632-62543654 GTGTGCCCGAGGGAGTGTGGGGG - Intronic
1085858454 11:80203591-80203613 GTATTCCCAAAGTAGGGTGGGGG + Intergenic
1086879058 11:92132670-92132692 TTGTCCCTAAAGGAGTGAGGAGG + Intergenic
1087048690 11:93865729-93865751 GTGTCTACATAGAAGTGTGCAGG + Intergenic
1089336939 11:117731617-117731639 GTGACCCCGAGGAAGTATGGAGG - Intronic
1089784000 11:120895049-120895071 GTGTCCCCAGAGGAGGGAGGTGG + Intronic
1090614462 11:128502536-128502558 TTGTCTCCAAAGAAATGAGGAGG - Intronic
1090791748 11:130096102-130096124 CTGTTCCCAAGCAAGTGTGGTGG - Intronic
1095313284 12:40726538-40726560 CTATCCCCAGAAAAGTGTGGGGG + Intronic
1095923129 12:47551138-47551160 CTTTCCCCAAAGAACTGTGTAGG - Intergenic
1099861846 12:88231865-88231887 GTGTCTACACAGAAGTGTGCAGG - Intergenic
1100593238 12:96049111-96049133 CTGTTCCCAAAGAAGTGGAGAGG + Intergenic
1102826360 12:115950742-115950764 GTGTCCTCATAGTGGTGTGGAGG + Intergenic
1103632367 12:122272253-122272275 ATGTCCCCACAGCAGTTTGGGGG + Exonic
1104711502 12:130990068-130990090 GTGTCCACAAAGCAGAGTGAGGG - Intronic
1105603672 13:21909632-21909654 GTGCCCCCAGAGAGCTGTGGAGG + Intergenic
1105970413 13:25424620-25424642 GTTTCCAAAAAGAAGTTTGGCGG - Intronic
1113698481 13:112365428-112365450 GTGCCCCCAAACACGTGTGTTGG + Intergenic
1113891907 13:113740402-113740424 GTGTCACTAAGGCAGTGTGGTGG - Intergenic
1115973623 14:38973430-38973452 CTGTCCCCAAAAAAGCATGGGGG + Intergenic
1118756045 14:68844357-68844379 CTGTCCCAAAAGAAGAGGGGTGG - Intergenic
1118942221 14:70348413-70348435 GTGTTCACACAGAAGTGTGTAGG - Intronic
1121174281 14:91879168-91879190 GTTTCCTAAAAGAAGTTTGGAGG + Intronic
1121534971 14:94685033-94685055 TTGTCCCCAAAGCAAGGTGGTGG - Intergenic
1122648888 14:103214272-103214294 GTGGCCCTAAAGAAGAGTGGTGG - Intergenic
1129685262 15:77682512-77682534 CTGTCCCCAACTAAGGGTGGTGG + Intronic
1129718895 15:77866978-77867000 CTGTCCCCAGAGCTGTGTGGAGG + Intergenic
1131848300 15:96511284-96511306 TAGGCCCCAAAGAAGGGTGGGGG - Intergenic
1132232212 15:100192678-100192700 GTGTCCCCACAGCACTGTGCCGG + Intronic
1133520105 16:6549068-6549090 CTGTCCCCAAAAAAGGGAGGAGG + Intronic
1134155506 16:11839575-11839597 GTGAACCCAAAGAACTGTGAAGG - Intronic
1134502442 16:14779744-14779766 GTGTCCCCTGAGAACTGTGGTGG - Intronic
1134578120 16:15349150-15349172 GTGTCCCCTGAGAACTGTGGTGG + Intergenic
1134724471 16:16408396-16408418 GTGTCCCCTGAGAACTGTGGTGG - Intergenic
1134942960 16:18303463-18303485 GTGTCCCCTGAGAACTGTGGTGG + Intergenic
1137071195 16:35906307-35906329 GTGTCTACACAGAAGTGTGCAGG + Intergenic
1137395615 16:48114651-48114673 GAATCCCCAGAGATGTGTGGGGG - Intronic
1141269001 16:82522080-82522102 GTGTCCCCGAGGAAGTGCTGGGG + Intergenic
1145063342 17:19745715-19745737 ATTTCCACAAAGAGGTGTGGAGG + Intronic
1145726206 17:27127923-27127945 GTGTATCCAAAGAAGAGTGTTGG - Intergenic
1146480432 17:33200903-33200925 GGGTTCCCAAAGAACAGTGGAGG - Intronic
1146600159 17:34207156-34207178 GTGACTGCAAAGAAGTATGGGGG - Intergenic
1147991843 17:44338812-44338834 GAGGCCCCAAGGAAGTGTGAGGG - Intergenic
1153321306 18:3776636-3776658 ATGTCCCTAAAGAAATGTGCTGG - Intronic
1156494896 18:37519246-37519268 CTGTCCCTAGAGAGGTGTGGGGG + Intronic
1157878868 18:51299497-51299519 GTGCCCCCAGAGAAGTCAGGGGG - Intergenic
1162576015 19:11499266-11499288 GTGTCCCAGCAGAACTGTGGGGG - Intronic
1163003939 19:14385708-14385730 GTGTCCCTGAGGAAGCGTGGAGG + Intronic
1163685569 19:18710020-18710042 GGGTGGGCAAAGAAGTGTGGGGG - Intronic
1168081317 19:54012428-54012450 GGGTCCCCAGAGAAGACTGGCGG + Exonic
1168429440 19:56266435-56266457 CTCTCCCCAAAGAAGTGAGTAGG + Intronic
925439987 2:3877293-3877315 GTGTCCCTTAAGATGTGTGATGG - Intergenic
926301790 2:11610073-11610095 GTGTCCCCACACAAAGGTGGTGG - Intronic
927443273 2:23135119-23135141 ATGTCCCCGAAGAAATGGGGAGG + Intergenic
938087309 2:128409934-128409956 CAGTCCCCAAAGAACTGTGAGGG + Intergenic
938479166 2:131645685-131645707 GTGTCCACATGGCAGTGTGGTGG - Intergenic
941853360 2:170206339-170206361 CTGTGCCTAAGGAAGTGTGGTGG - Intronic
942564144 2:177249939-177249961 GTCACCCCTAAGGAGTGTGGAGG - Intronic
945184145 2:207122671-207122693 GTGCCTCCAAAGAAGTGTGCAGG - Intronic
945468289 2:210196901-210196923 GTGTTCTCAAAGGAGGGTGGTGG + Intronic
946012726 2:216579341-216579363 ATGTCCCCAAAGATGTGGGGTGG - Intergenic
946386120 2:219385574-219385596 GAGTCCCCTGAGAAGTGGGGAGG - Intronic
949061664 2:241962567-241962589 GTGTGCCCGCAGAAGTGAGGCGG + Intergenic
1171010012 20:21504436-21504458 GTGTCCCCTGAGAACTGAGGGGG - Intergenic
1171112505 20:22497007-22497029 GTGTCAGAAAGGAAGTGTGGGGG + Intergenic
1171135484 20:22691188-22691210 GTGGTCCCACATAAGTGTGGTGG + Intergenic
1173668227 20:44778168-44778190 GTGTCTCCAAGGATGGGTGGAGG + Intronic
1176871003 21:14083482-14083504 GTCTCCCGAAAGCAGTGAGGTGG + Intergenic
1176871010 21:14083516-14083538 GTGTCCCAAAAGCAGTGAGGTGG + Intergenic
1176871017 21:14083550-14083572 GTGTCCCGAAAGCAGAGAGGTGG + Intergenic
1177393385 21:20504196-20504218 GTGTCAGCAAAGGAGTCTGGTGG + Intergenic
1179667149 21:42920791-42920813 GTGTCCACACAGAAGTGTGCAGG + Intergenic
1182807852 22:33090667-33090689 GTGTCCCCAAATAATTTTGTTGG - Intergenic
1183253241 22:36744715-36744737 AAGTCCCCCAAGAAGGGTGGAGG - Intergenic
1183303152 22:37068452-37068474 GTGTCCCCAAAACTGTGCGGTGG + Intronic
1183707028 22:39480497-39480519 GTGGCCTCAAAGCACTGTGGGGG - Intronic
1183865613 22:40701906-40701928 GTATCCTCACAGAAGTGTGCAGG - Intergenic
952226063 3:31377427-31377449 GTGACCCCAGAGAAGTGGTGGGG - Intergenic
953884103 3:46705932-46705954 GTGTTCCCACTGCAGTGTGGTGG - Intronic
956135279 3:66092307-66092329 AAGACTCCAAAGAAGTGTGGTGG - Intergenic
956848939 3:73210723-73210745 ATTTCCCCAAAGAATTGTTGTGG + Intergenic
958448821 3:94247870-94247892 TCCTCCACAAAGAAGTGTGGGGG + Intergenic
960945118 3:122961113-122961135 GTGTGCCCAGGGGAGTGTGGGGG - Intronic
961042316 3:123686228-123686250 GTGTCCCCAAAGAAGTGTGGGGG + Intronic
961254148 3:125532606-125532628 CTTTCCCTAAAGAAGTGTTGTGG - Intronic
962119426 3:132545925-132545947 GGGTACCCAAAAAAGTGTGGGGG + Intergenic
963729313 3:148956232-148956254 CTGTCCCCAAAGAAGGGTGAAGG - Intergenic
965617008 3:170604210-170604232 GGCTCCCCACACAAGTGTGGGGG + Intronic
965872564 3:173279072-173279094 GTGTTCACACAGAAGTGTGTAGG - Intergenic
970794106 4:19891498-19891520 GTGTTCACACAGAAGTGTGTAGG - Intergenic
972245980 4:37245408-37245430 GTGTCCTAATAGAAGTGTGCAGG - Intronic
973052367 4:45611240-45611262 GTGTTCACACAGAAGTGTGTAGG - Intergenic
980778880 4:137471126-137471148 GGGTCTGCAAAGAAGTGTGGTGG + Intergenic
983606414 4:169591148-169591170 CTATCCCTAAAGAAGTGGGGGGG - Intronic
985971979 5:3385415-3385437 GTGACCCCAGAGAAGAGGGGAGG - Intergenic
996353100 5:122567457-122567479 GTGTCAGAAAAGAAGTGTGGTGG - Intergenic
997379862 5:133427827-133427849 GTGGCTCCAGAGAAGTGTGAGGG + Intronic
997836058 5:137194451-137194473 GTTTCCTCAAAGCAGAGTGGCGG + Intronic
998440747 5:142160021-142160043 ATGTCACCAAAGAAGTGGGTTGG - Intergenic
1000589645 5:163143553-163143575 GTCTGCCCAAAGTAGTGTGTAGG - Intergenic
1002882993 6:1269280-1269302 GTGCCCACCAAGAAGTGTGATGG + Intergenic
1005002981 6:21261423-21261445 GTGTCCAGAAATAAATGTGGAGG - Intergenic
1006470525 6:34226269-34226291 CAGTTCCCAAAGAGGTGTGGTGG - Intergenic
1019900267 7:4014972-4014994 GTGGCCCCAGAGAAGTTGGGTGG + Intronic
1022404568 7:30075705-30075727 TTGCCCCAAAACAAGTGTGGGGG + Intronic
1023283514 7:38595165-38595187 GTGTCCCCAAAGCAGGGGCGGGG - Intronic
1023303223 7:38795795-38795817 TTGTCCAGAAAGAAGGGTGGAGG - Intronic
1024512504 7:50214690-50214712 GTGCCCCCAGAGCAGTGTGGTGG + Intergenic
1028615850 7:92766018-92766040 GTGGGCCCAAGGAAGAGTGGAGG + Intronic
1030143655 7:106331097-106331119 GTGTTCTCAAGCAAGTGTGGAGG + Intergenic
1032433059 7:131878644-131878666 CTGTCCTCACAGAAGTTTGGGGG - Intergenic
1034727400 7:153350483-153350505 GTGTCCCCACAGCAGTGTCATGG - Intergenic
1035296365 7:157868938-157868960 GAGTCCCCAAACGACTGTGGTGG - Intronic
1037065348 8:14569899-14569921 GTGAGGCCAAAGAAGTGAGGAGG + Intronic
1040878060 8:52173711-52173733 GTGTCTCAAAAGCAGGGTGGGGG + Intronic
1041506378 8:58602981-58603003 GTGTCCTTCAAGAAGTATGGTGG + Intronic
1043051784 8:75394115-75394137 GGGACCCCCAGGAAGTGTGGAGG - Intergenic
1061197321 9:129113859-129113881 GTGTCCCTGAAGATGAGTGGGGG + Intronic
1188409403 X:29852494-29852516 TTGTCCCAAAAAAAGTTTGGTGG - Intronic
1190035146 X:47015969-47015991 GTGTCCCTAAATAACTGTGTGGG - Intronic
1192165111 X:68823297-68823319 GGCTGCCCAAAGAAGTGTTGGGG - Intergenic
1192557402 X:72101503-72101525 CTGTCCCCAAACAAAGGTGGCGG + Intergenic
1192945924 X:75965575-75965597 GTGTCCACGAAGAAGTGTGCAGG + Intergenic
1195121854 X:101762438-101762460 CTGTCCCCACAGAATTGTGTAGG + Intergenic
1200083567 X:153591706-153591728 CTGTCCCCAAGGCAGTGTGCAGG - Intronic